Gallus_gallus Locus NP_990024.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_990024.1
Gallus_gallus
NP_990024.1
12
SNORA7
4984..5122
7199
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCGGGACTCCGCAGATG
CTGGCGAGCGTCTCGTGGCCTTCTGACATGAAAAGTTTCATAGCTCTTCAAGCGCCACGA
GGTACAGGTGTGTTTGTAAGCAGAATATTATTCTTACGGGTCGTCCTGAGCTGTCCAAGA
AAAGTATTTGGTTTCAGGTCAAGCGCCTTCTACAGCACTCTCATTTCTGGAGCTCTTTTG
GCCTTTTCAGCTGCGCGGTGTAACCCACTGATGAACGCTCACTGCTCTGCCTCTTCCGTG
TTGCTGCTGTGTTGGTCCGTTTGCTTTGTGAAGGCGGCTTTAGTTGTAGCTCCTTTCATG
ATGTGGAGTGTGGGGACGGCGTGTACCTCTTCGCTGTCGTCTGAGCCTGTTTTCCAGGCT
GCCTTGGAGTCGTGGTTTCTTTTCAGAATGGTTATCTCAGAGCTGAAATGCAGAAAAACA
CATTTATGTCATGCATTCCTATATGGAATCCGTGTGTTTCCAGCACAAATTGAAGAGGAA
GCTGTCTCTGAGCCATGACAGCCACTATGTGGGGTTTTCCATTTTAATACTGGCTATAAT
CTCTTTACAGAAGAATCTGCCCCACGGACACAGGTGGACAGGAGGAAAACGAGTCCGTAT
TTTTCAAGTAAATACAGCAAAGAAGGTAGGATACGCCTTCGGGAAATGATTCCTGTTTTG
CAGGGGAGAGGAATGAGATGGCTCAGGATGAGGTGATGATGCAGGAAAGGCACACAGGGT
GCATACAGGCAGCCCTCCCTGTGGGCTTACAGCGTGAGGTCCCTTGCAGCTTTGTAAAAG
AAAGCGCACAGATTACCAGTGCTGTGCCCACGTGCTGTGCCCACCAGGACAAAACTGCTT
CTAAAGTTCACTTTAATGTTTTTCCCCCTAAATAGGTAACTCCATCCTTTACTACCCCAT
GTATTTCCTCTTCTTGCCTTTGTGTGCAGCTCTCAGCCCACCCAGGAGGAAGGCCTTCAG
AAAGTGGACTCCTCCACGCTCCCCCTTCAATTTGGTCCAAGAAACACTTTTCCATGATCC
ATGGAAACTTCTCATTGCGACCATATTTCTCAATAAGACCTCAGGTAAACGGAGTAATAC
GGTTTCGTGTTGTGTAAATGCTGGGTGGTGATATAGGATTGAAACAGCTGCCAATTTCTT
TGTCATGAATGAAAGAATAGATGTGTCTGTTTGATGTAAAATAATAATAATAATAATCTG
TTTCTTCTGCATTGGCAAAACCCACGCAGAGCCAAAGCAGGGAGTTGCCTGCACAGTTCG
TGATGTTCCTTTGACCAGGTAAAATGGCAATTCCTGTGCTCTGGGAGTTCCTCAGGAAGT
ACCCCTCTCCCGAAGTAGCCAGAACTGCAGACTGGAAGGAGATGTCGGAGCTGCTCAGAC
CTCTCGGCCTTTATGCACTCAGAGCAAAAACTATAATCAAGTTTTCAGGTAAGGCTTTGT
GGCTGTCTGTGCAATGATGTCAGTCGCATTAGAAGAGAACCCCTGCTATTTTCCAAACTG
CTTTGTGACATCTCTCCTTGGGCAGTCCTGGTGGTTGGTTTTCTGAAGCTTTGGGAGGTG
TTGGTTTTACATGTGCGAAACTGTTGATCGGATCGTCTTAACTGAGTAGTTTGTGGTGTT
TGTAGTGGCTTGATTTAAAGTGCCGCCACGTGCAGGTCTGGGGCAGCATCCTGCTCTGCT
CAGACCTGGGCCTGCAGGGTGAGGGCTGTGCGTGTGTTCCAGACGAGTACCTGAACAAGC
AGTGGAAGTACCCCATTGAGCTGCACGGAATCGGAAAGTACGGAAATGACTCCTACAGAA
TCTTCTGCGTCAATGAATGGAAAGAGGTGCGCAGTGCTGCCCTGAGCGGGGGGTGCGGGC
AGTGTGTGCCTGGGCTCCCTGCTGGCACTGCCGCTGTGCGCTCACTTGGATTTAAAAAAA
AAAAAAAAGGGGGGGGGGGCTCTTTTCTTTTGGTCTGCAATGAGTTGAATTCTCAGAATG
CATCTTCTGCAAGTCTGCCTCAAGTGGAGCCTGGCTGAGCCGTGTGCCTTAGCTCACACA
GGGCCGGGTCTGCTGCTCTGACTGGCACTGTGGGTTGGGCAAGGGCAGGTTTGTGAGCTG
GGAGGGGAAGCAGTGTTAAGATATTCTAGTAAACGTCGGTTGCCTTCGCTGTGTTTTAGG
TACAGCCACAGGACCACAAGTTGAACATCTACCACGCGTGGCTCTGGGAGAACCATGAGA
AGCTGAGCGTGGACTGAGTGCAGCCGCCATGCGTGCCAACGGTGAGCTGTGCAGCCTCAG
CCCTGTGCTGAACATCACGTTCTTAGTTTATATGTTGGTGTGACATTGGACTCAGATAAT
CGCTGTAATAAAACGTTCAAATGCTTTAAAGGTTTTTAATAAACCGGTTGTACCGAACGC
GCCCTGCTGCCCGCACTGCCCGCTGCCGCCCCTCCGGCCTCGTTCCGCCGGTACGTGCCG
TGCCGCCAGGGGGCGCTCTCCCGCTCAGAGGTTCTGGCGGAAGCCGCGTGTCGCCTGACC
CTGAGCTTCCTGGCGGAAGTGGCGCCGGGCAGGTCCTGTCAGCTTCGTAGTGAACGCTCA
GAGCGGGACGTGGAGGAAGTACCTATCCATTCTCCCGAGACGCCCTCCCGAAACTATCCC
GCCTTTCTGCAGCTCAGGGCTCTGTGTGACGCCGCGAGGGGCAGCTGCTCGCTCGCGGTG
CTGGCTCCGTGCGCGCGGGGCGCGGCGCTGACCTGTCAGTACCGCCCAGGTCTCCCATAA
GCCCCTGCGCGCGGCAGCTCCTCCCTCTCTCGGCGGGCCGCGCCGTGCCGTGCCGGCGCC
ATCGCGTAGCAGGTGAGAGCCATCCGCCGCCATCCGCCCCGGGAGTGCCCGCCCGGTCCC
GCCATCTGCCCCGGGGGCCCTCCTTGCTGTCCCGGGTGCGGGGAGCCCTGGCGCCGGGGC
CTTCCCGCGGCCCGTAGCCCGGCGGCGGCGGGGCAAAAGGGGCCGGGCTCGGGCTCAGGC
GGTGCGGGCCGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTCGGGCTCAGGCGGTGCGGGCCG
CGCCGTACGTACGTCGCTTCCAGCGGCGGTGAACCGGGCGCGGCCCAAAGGCGGTGCTGG
GGGTGCCGGGCCGCGTCCGCGCCGCCGCGGGATCTGAGCTGGGTGAGCGCTCGGAACGTT
CCGTCCCTAAAAAGGGCTCCGGCCGCTGCCCGCTGCGGGGCTGCTCTGGAACCGGGAGGG
CCCTGAAGTCGGTGGGCGGGGAACGGAGCGTCTGAGAGCGCGGGTGGGGAAACCGACGGC
GGGCCACCTCCCAGGATCGCATCTGGGGAGCTCACGGTGCTCTGCCAGCTTCGGACACGG
GAGGGAGAGACACTGCAGAGGAACACCCATTCCCTCCCTGGCTCTGGCGGTGGCTTGGGG
GTGGAAGATAACCTGCTACAGCCCTTGCTGGTGGGCTGACGCATCGCCGCTGTGTCGTGT
GTCTTTTCTCACCCTGCTCCGTTTCCCTCAGCCGCCATGCCTGCCCTCCGGCCTCTCGTG
AAGCCTAAAATCGTTAAGAAGAGGACCAAGAAGTTCATCCGCCACCAGTCTGATCGCTAT
GTCAAGATCAAGGTAGAAACTTATGGAAACTTCGTTACAGCAGCGCTTCGGGGGGTCGGG
TTTGTGATTGCCCGGAGGGCTGGCGATGATTTGGAGCGTAAGGGTCAGGTATTGCAGCCG
TGGGCTGGGCAGTAGTAGTGCAGGTATGAGACCTGTGGGTCACGATACAGCAGTGTGGCA
CAGTGAACCTTCGTGGGCTGGTTTTGGCCAGCCTTGGTGCGGGCGTTCTCACGCTGGTGT
AGTTTTGTAACTGAATACCAAATGCTTTCCCACATTTCTTCAGCGCAACTGGCGGAAACC
AAGAGGTATCGATAACAGAGTTCGCAGGAGGTTCAAGGGCCAGATCCTGATGCCCAACAT
TGGTTATGGGAGCAACAAGAAGACGAAGCATATGCTGCCCACGGGATTCAGGAAGTTTCT
GGTCCACAACGTCAAAGAGCTGGAGGTGCTCATGATGAGCAACAAGTAAGTCCCTGGGTT
TATTCCTCATCCTTGCCTTGAGTCATTGCTGCAGTTCTGCAGTCAGCGCTGTGGCTGTGT
GCTGCTGTGCTGCCCATCCCATAATGGCACTGGGGACAGGACGATGCGGGTGGGAGACCT
GGGAGGTGAGCAGCTTTGGGGAACACAGGTGCCGTCTTGCTTTACTCAGCGCCGCGGCAC
TACTCGGTGGCAATGGCGGTGCTGGGAAGTGTATGGAGAGCTCAAGGCTGTCGAAGCTCT
GTCTGTGGCTCGCTGTGTCTGTTAAAACTCCTGTGCTTTGCTGTCGGCAGGATAGCCCTC
ACTGCTTTGCCTGCACTGCTGCCACACATTGGATTGAGGCGAGCTTAACATATGGTCTGT
TCCCTGCAGGTCGTACTGTGCGGAGATCGCTCACAACGTGTCTTCCAAGAACCGGAAGGT
CATTGTGGAGAGAGCAGCTCAGCTCGCCATCAAGATCACCAATCCAAATGCCAGACTGCG
CAGTGAGGAAAACGAATAAGCTGGCTTCTACATCTGGGATGTATTTAATAAAGTGTAAAA
ACTGATCAGGATTGACCTGTTGCCTTTTTCTGAGGGCTTGGCACACAGTGCTGTGACTCC
ACTTGCACCCACAGTTTGTGCTGACAGTGGGCTTGCAGCAGTGCCCTTTGTGCATCTCTT
GCTCTTGTTAGGATATTTGCTTCCTTCCAGGTAGTTGTGCTTTGGGGGCCTGGAGCCATA
CCCTACTTCTGAGCATGTTGCAGGGGAGGGAACTGACATCTCTTAGTGGAGGCTAAGAAA
AGGTCGTGCAAGCAGATTTTCCCCTGTTCTGTGGGCTCCTGGTAGTATCAGCAACGTAGT
GTTGCTGTGATAAGTAATGAATTCAGGAACGAACACAGCTTCATAGGTACATTTTTTATT
TTAAGTCACCACTCAAACAGGGTGGATATTCTTTAACACTGCACTATAAATATTTTTCAC
ATCAACTGCTGTCAAAAACGAGAAATGAAAACTTATTACAACTCCACGGCTGTAAGAACT
GTGTTGTGGTGCCCTTCTCTAATTTGCTGTTACATTTTCTCTTAAGGCTTTTCTTCCCCT
CTGCAAAGCAGTATTTGAACAAAACATCTGCTTTAGAGGTTTTCAAATGACAGAAGGTAC
TGTGGACTGTGTGTTTCAGCAGCTCTGGTTACTGAGATTCACCTGTGGTACTGGAGCACT
CAATATGAGCTTCCCTCCAAATTTGTGCTGCTGCTGTGTAATTTAACGACCAGAATTTGG
AGCAGATGGGTGCTGTGGTGGTGGTCACTCAGTACAAACACTGATCTGTTCCAAGGGGCC
AAGAGAGGCCACTGCTTAATGCAAAGAACAAATACATGATTTGTATTGTACTACAGTCCT
GCAGTCTCTTTTGGAAGGCAGCCCATTGAGGTATTCTGCAGTAAAAAGTAGAAAAAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1086, 1570..1644, 1949..2083, 2298..2447, 2742..2845, 3179..3280, 5191..5291, 5563..5744, 6129..6199
2303..2447, 2742..2845, 3179..3253
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved