Gallus_gallus Locus GNL3
snOPY snoRNA Orthological Gene Database
Gallus_gallus GNL3
Gallus_gallus
GNL3
12
SNORD19
5228..5299
10246
TGAGGCAACTTCTGGTCGGAACCGAACCCCGAGAGAAGCGGGTTCCTCCTGCAGCGCTC
GGGCACTGCTCCGCACGCCGCGGCTGCGGGCCGCTCAGCGGGGAGAAGCGCTGCAGCGCG
GGGCGACGCGTCCCGAAGGCCTCTCCCACCCAGACGGCACCGAATCCCGCGAGCGCGGCC
GGGCCCCAACGCGGCGGGCCTCGCTCCGCGGAGCGGAGAGCGGCGGGGAAGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGCGCGGGCGGTTCCA
GGGGGGCGGCTGAGCGGGGCTGACGGGTACTGAATTGTTTTGCAGAGCTGAGGAAGGCGA
GCAAGCGGCTGACGTGCCACAAGCGGTACAAGATCCAGAAGAAGGTGAGGCCGGGCCGTG
GGGCGGAGCGGGGCACGCGGCCGCGCGGCGCTGCTCGGGCTCTGCCGACGCTCCCGTGTG
CGCCCACAGATCCGGGAGCACCACCGCAAGGTCCGGAAGGAGGCCAAGAAGCGCGGCCGC
AAGAAGCCCCGCAAGGACCCCGGCGTGCCTGGAGCGGCGCCGTTCAAGGAAGCACTGCTG
AGGGAGGCCGAGCTGAGGAAGCAGCGGGTAACGGCGGCGGGACAGCGTGTGTGTGTGTCT
GTGTGTGTGTGTCTGTGTGTGCGCGCGTGTGTCCAACTGAGCTGCACTGCCGTCTCTTTG
CACAAATCAGTAAACGGGGGCAGAAGGGGGGCATCCCGTACTGCCCTCACACGTGTTTTA
CCTGAGTTGGCCCTTGCTTGTTTGTGATCAGCTCGAAGAACTGAAGCGGAAGCAGAAGCT
CGATAGGCAGAAAGAACTCGAGAAGAGGAGGAAGCTCGATGCCAAGAGGAGCGCGGCTGC
GATCCAGGAGCAGACTGAGGGGAAGGTCGGTGTCTGCTGTGATGGTTGTGACTTGAAGCT
TGGGGAAGCAAAGATGTCGTCCTAAAATGACACTTCTACAGGTCTCATGTTGTGTCTCCT
GTCTCCAGGCTGTGTGCACACACAAATATAATACAATAATTCTCAGTTAAATCATTTCTT
TTCTGCTTTATTTGCATGCAGGAATCCTCTGGCAAATCTGAAGCAAAGAAGACCAAGAAA
GCGCTGGATAAAAATGCAAAGAAATCATTTCACAGTGAGCTTGAGAAAGTAAGAAGCTTC
AACTATTTGTATGTAATTTTGATAAGAGGCAATGAGACAACTTAAAATCATAGAATGGCT
TGGGTTGGAAGGGAACCCAAGGATCATCAAGTTCCAACCCCCTGCTTCAGGCAGGGCCAC
CAACCTCCATATCTAGTATGAGACCAGGCTGCCCACGGCCCCATCCAACCTGGCCTTGAA
CACCTCCAGGGATGGGGCAACCACAGCTTCTTTAGGCAGCTGTTCCAGCACCTCACCACT
CCCTCTAAAGAACTGCACCCTGCCATCCGCTCTAAACCTTCCCTCCTTGAGCTTAAAACC
ATTCCCCCTTGTCCTGTCACTGTCTACCCAAGTAAAAAGTTGATTTTCTTCCTTTTTATA
ATCCCCTGTGTTGTTTTCCTTCCTGCATTACTGTGCAGCAATTAGGGAGTGTAAAGGTTG
GTCGTGATAAACTTCAGCACTGAAGTAAGTGATATTACTGCTGAAACCACGAGGGTTTCA
GTCTTGCCTGGTGTTGACTACTGAGATATTGAGTGTTTTGAAGCATTACATTTCTAGAAC
CAGTGTCAGTACATAGCAACCAGTCAGAGAGCTCTTTGAGTTGTGAGGTATTCCTGTCCA
AGGATTTCTTGACTTCAGAAAGCTGAAGCAATTTTCATCTTTTTCTCCCGATTTGCCTTT
CAGAAGAAGAGAGCTCAAACAAACAGCCTTAAGAAACCTCACCTACCAAACATTCTGTGA
AATTCAGTAGTCACTGTTGTAGGCTCCTGCTTAGCTATTACAGAGTTACCATCTGTCAAA
TTTTGCCATCTCTTATTTGAGAGTTCTCTTTTATTTTTTTTTTCTTTATTTTCCCTTATG
CAGGTGATTGAGGCCTCAGATGTGGTTCTGGAGGTTTTAGACGCAAGAGATCCGATGGGC
TGTCGGTGTCCCCAGCTGGAGCAAGCTATTACTTGCTCTGGAGGAGAAAAAAAGCTATTG
TTGGTTCTGAACAAAATTGGTAAGAAACAGATTTTCTTGAAGTTTTACTTTAGTCACTGG
GTCGTTCTGTTTTAAGTGAGCTGTGAAGAAATATATAAAGAAATCTGAGATTCTGTTGAA
GTCATAAGATCCAACTCTGAGCTCGCTGCCTTAGGGAAGTAGCCCCACTCCCTCCGCCAT
TTAGTCTATTTTGCTAAGAAAGCACTAAGACAGGTAGTTGCACATTAGCCCCTTTCTTTT
GTGATAACTTCTGAAGCCATTGGCCAGTGTCAGCCAAACTTGGCAGGAAGAGATCTAGCA
ATGTTTCTTTGAACAAAGACGAAGTAGGCAGAGGTCATGATGCTGATACCACTGAGATGA
GTTAAGCATCAGCAAATCAGCACAAGAGTTGTCTTTGAAGTTTAACTCCCATTGCTGTAT
GAGGGAGACCACATAAAAGGGGATGAGACCAGCTGGGAGAACTGGTTATTAGTGGGTTAG
CAGTGCAAACAGAAGGAAATACGGAATGACAGAGCAATAGGAACTTTGTATTAGCATAGC
CTGTGCAGGGATGATGGGGTAGCCTGCATAACATCACCCTTCGTACCACACAGAGTCTCC
TTGTGATACTCCAACACTGAAAACACAGGGTAACTGTGGTATGTTCTGTTTGGGGCAGAA
AATAAACATTAAAAGCTGCAGCTGTGGATGGCTTTGGGGAACTCAACAAATAGTTTACTG
GAAGTGTATATAACAATAAATGCAAAAGTTTTCAGCCAAGCATTAATTTTCATAGAGAAG
TGTTCAAAGTGGACAGAATACATCCTGGTTTCTGATTCTGCATTAGATAGACAGCAGCAC
GCAACATTCACAGCAGTGAGAAGGCTGTGCTCTTTTTCCAGATTTAGTGCCAAAGGAGAA
CTTAGAGAAGTGGTTGAATTATTTGAAGAAGGAATTTCCAACAGTTGCCTTTAAATCAGC
AACGCTGCTGAAGGACAGGAATATGGTAAGAGCTCTGTGTGCTGACTCAGATGACTGAAT
CATACATGCTTGCAGTTGCACGTGTTGAAACACATTGAAAAGTGGGAACTCTTGTTCTTC
AAAATTCTTTTTTCCTGTATTTGATTATACTGCTGTGACTGATGAATATTCTTTCACACG
TTGAGGTTTGTAGTACAGTTGTAGAATACATGCTGTTAAGGTACGTATTGTTTTGTGCAT
GGGATGCTGATCTAGAGAGTGAAAGTAAGTTGTTTTGCTGTAGACAGGACTGTACGGGGA
GGAAGATGAGGAGTTTTCCATCTATGCAATGTGGTTGCACATCTGAGTTGCTTTGTAGGT
AAACAGCAGGTTATGCTACATTCATCTTGGCTGTCACTGTTACTAAAGGCTGCGGCTGCT
GTTATTTCATGATGGATTATCAGGGAGTTGAGTTCCATGGGTTCTAGTCTCAGCTCTGTG
AAGATGCTGGCTTGGGACAATGCGTATTGATACATCATGCTTCACCTGTCCTAACCCTGG
TAACAGCATAGTCAGATAGATCCTCGTGTGAAATGGCACAGAAACCCAAACACAGAGAGC
AGTTTTAAAATCATCAAAAAAAAAAAAGTTTGAACAGTTCATTGAGTGAATGTGCAGATT
AAAGGACTCGACTCCATGAGTGTACATGGTTACTTCATGCTCACTCAGCCAATCTGCAGC
ACAGACTGAACTGAAAGCCCTGTAGGTTTGTTCACACTTCTTCTAGTGTTTGCTACCTTT
TTATTTTTACTTTTAACCATCACTTAACTGCTAGAATCATTTTAGCCAAATTCTTATTGT
GCTAATTCCATCTGTTTAAGAAGAAGGACCCAGTAACATCAGCTAATGTAACACTTCCAA
CTCTTGTGCTTCATTAGGTGAATAAATGTAAGGATATGCGTGTTTGTTTTGTTGGCTTTT
TTTTCCCCTTTGAATCCTGTAGCAGACTTTCTCGAGAAGAAGGGCACGTATTGATTTATC
AAGACACACTGAAAGTTTTGGAAGTGAATGCCTTGTGAAACTTCTTCAGGAGTATGGCAG
GACTCAGGACAGAGCCATTCAGGTTGGGTTAGTAGGTAAGAGTTTAGAGAGATGGTAGAA
GTTTCCTTTTCCTCCCATTAAAACTCGGTATCCTGCATTAAACAACCAACACATGACTTG
CTTCTGGGCCTTCTAGGCAGTGTTCTCACTTACAGCTGGGACTCATAGCACCTCAGCTGA
TAGTGATCTGTCTTGTACTTTAATGCAGAGTGTATGTGACCCATGGAATGCACATTTTAT
GAGGTCTTAGCTGATAAAGCAGCTTTAGGTTACGTACTACATAGCCTACACTGCCTCTTC
CTCCCATCTGGTGAGGTTTGTGGTGTGACATTCAGTGATGTCTTTCACATCCTTTCCATT
GTGAATGTGAGAAATGAGGATACAGACTTTGTCTGAGTTTTATATGAAGACTTCAGATCC
AACTCTGATCTCACATGGAAGATGTATGTTACCAAAAACATGTGATCAGTTGTTAAACAA
GCTGAGCTTTCTTACTTATGAGGATTTTTTTTTTTTTCTTCCAGGTTTTCCTAACGTGGG
GAAGAGCAGCATAATCAATAGTATTAAGAAAGATCGTGTTTGTGATGTTGGGCCAGCCAG
GGGTGTCACCAAGTAAGCCGAGTGTTAAGAGATGTTTATTTTCCTGTCTGTTCTGATTAC
CTGAGTTGGTTGTGTACAATTTCTGTGCATCAGGAGCAGTCAGAGCATGCCTAAGTTCAG
TTTTAAATGCACATTTCAGTTTGCGTCAGTCAGAACATTCTTTCATCCTGGCCAGTTGCC
ATATGAGAATACAATGTGTAAATTTGCTCTTACTGTGCGTTTGGATTTCTGTCCAGCCCA
AAGCACATGATGAGGAAGCACTGAAACTGACTCTGTATGAAGTGCATTCAATCCAATGCT
GAGCTTTGTGGCTTGCTTCTCTCACTGTTATCAGTCCTTTGCTGTTTGATTTGTCTTCAA
CTGTGGCCTGTTTCTCTCTCTGGCCAGGTCCATGCAAGCTGTGCGTATTGATAAACAGAT
GAAGATTTTAGACAGTCCAAGCATAGTTGCAGATCCTACCAACAGTGCTGTGACTCTGGC
ACTGAGAAGTATCATACACACTGGGGAATCGTGCTCAGTGAACATGGTTAAAGCAGTGGA
TGCTGTTCTGAGTCACTGCAATAAGCAGCAGGTAAGTTCCATCATCATTCTTTCACAGCA
TTCAACTCCTCTCTAGCTTTCTTAGGCCAATCACTGAAGTTCATTTCACTTCGGATAGTT
CTTCTGCACTGCTTTCTCTTTAACCAAACGTTGGCTAGCATATCCAGTGCTGAGTGTGAT
CTTTCGCCCCTGTATGTGGAAGATGGTTGCAACACACCAGGGTCCTGTCAGCCACTTTGT
TTTCCCAATGAATTCACTGATTTAAAGAAAATCCATCAACAAACCACCTGCTTGTAAATA
TATATATATATATCATATAATGTAATAGAGTGAAAAATGAAGATACTTTCATTGCTTCTT
ACTACAGTGAAGACTTCAGATCCAACTCTGATTTCACTCTATGTTTCAAGTATATTCACA
TAAGTCTGATCCCCTTCCAGTTCTGTGATAAATGCTTCTTCTCACTGTTTTCTTTTGCAC
TAGGTAATGATGTTCTACAGTATCCCAGATTTCAAGAACACTGAAGAGCTTTTAAGCTTA
CTTGCTCAGAAAAGGGGTATGCTGAAAAAAGGAGGTGTTCCTGACATAGAGAACATAGCT
AAATCACTACTTTGTGATTGGACAGGGTATGCATGTTACTAATTTTGTGTTATGCTGCTT
ACCTTTTTAATTTTGATATTGTTAAATGTGCTGTGACCACACAGCAGAAGCACTGAGTCC
TGAGAACTGCTTCCTTAAAGGAGGGAGGTGCTTTGGTTTTTATTTTGAGTAGTCAGGCTG
GATTGGCCAATAGAGGACACCACCCAAGGCTAGTTTTCTAAAATATTAACATATGGAGAG
AGTAAAAGCAAATTACATGGAATTCTGTGGCCAGAATTCTGTGATCCCTGCTGTAAGTTT
GTTAGGGGAATTTGCCCTGATCTCAGATACTGTTTCTGTAGTGCTCTTTTCCATCAAGAA
GGAATCTTGCAACATTTTTTTGTTTGTTTGTTTTGAATCTGTAGTGATTCCTGTGTTCTG
CTGAGTGTGGAAGGGATTAATTCAGAATGAGTGATGAATGGGGTGTGAACATTTCACTTG
CTGAAGTGGTTCAGGTGCTTCAGAGCAGGCTGTCTTTAATTCTGTTACTGACAGCTTCTG
AGTCTGATTTAAACAGTCGTTTAACTGTTGCTAAGCAAATAATATTGAATGAGTGAGTGG
TTCAGTTGAGGAGTTTGGAAGGTATGGGCTCTAGGTTTTATTCTTAAGTATGGTGATTTA
AGTATGTTATCCCTTGGTTTTTGCAGAGCTAAAATAAGCTACCATTCAGAACCACCAGCA
TCTCAGATCCTGCCACCATACCTGACAGAAGACAAAATAGCTGAAATGCAGGCGGGCTTT
AATTTAAAGAAGCTGGAAGAAGAAAACAGCAGCACAGTTCAAGGTACTGCACTGCTACCA
CTGAAGGCCATTTTAGCAGCTGTAATGGGAGACCATGAGTGGAAGTTGTCCTGGGGTTTA
TGTGACTGCTTTGTCGTTATGCAGCAGGCATAAATCTTTAGAGAATGAAATGCATTCCAG
TGGAACAAAACAGTGGACTTGGGTGCCACCTTAACGCAGATTACCCCCACTAGATTACCC
CAGCAATTCTCAGTTTCTGCTTATCTGATTTTAACCTTTCTAAATAGCCAGTGCTTATGG
GCCCTTTCATGTTCTTACCCTCCCCCATTTCCTAGTTAGACCAACAAAATGTATTTCTGT
TCAGTACATCTTATACTCCGGACCCAGTTCTTCACCACGGCAATCTTTTTGTTCTCATTT
TTTCTCCCTGCTTATGTGGGAAGGCGATCCTTTTAATGGATAGACATTGTATCTCGTGCT
AACAGTGATGTAACAGACAGCTTTGTATGTATTTCTCAGCTTTAAAGTACCCCAGTCCAG
CAAGCAGCATTGTTTTCCAATCGGCTGGCATGACTAATGGGAAAATAGTGAAAAATAAAG
TGGTAGAAGAAGAATCAGAGTGGGAAGACTTGGAAACAAGCCATGAGGAAGAGGATTTCA
TGGAAACTGATGATGATCAAGATAGTATAGAAAAAGAAGAAGGGAATAATGTCAAAGAGG
TAAACCTGGGTTTCATTTGTTTTCTACCTGCTTGGCCCTGACGCTAAGTAGCCAGTTACT
GTTCTGCTATAAATGGTGTGCAGGCACTGCAGAGCCACCTGGAGTAACCCCAACGCCTTT
CCCCTAGAAATAAAGGCTGAGCATTTTGCTCACTTAAGAAATCAGCTAATTAAGAAATCA
GTGTTAATGAGTCAGTCAAGTGTGTTCCTGACCAGCAGCTGCACACAGGGACAACCACAC
TATCCTCAGCCTCTGTATTTATATGGGAAGTTTCATTAGTGATGTCTGAACAAACTCATA
TGTCTGACCTCTCCAACCCATCGTAGGATGGCAGGACACAGATGACCAGGAATGCTGAGC
TTGGAATGGGACAAACAGGACACGCACATTCAGAAAATGAGATAGCAGGTCTGTGCTAAA
ACCCATAGCGTGAAGTACAACGCATGGTACTCCAGTACTTGCATTGATTTCACTAACACA
TCATTTCCTTTTCTCAGAAAGTGGACTTGCCAACTCACTGTCATTCAGCTTAGACAAGAC
AGCAGGTGAAAATGATGCCTATGATTTTAATACAGACTACGTGTAATGAGATGCGTGAAG
AGAAGGCTTGGAGACTCTTCCTGGCTTTCAGAACAGACAGATTTCTTTTACAAAAGGTGG
AGGAATGCCATATACCATAGCTGCTGCCAAGACTCCAGTAATGTATATAATACTGCCTCT
CAATGGTTGCAGATTTTGTACAGTTGTAGGATGCTAAAATCCTATACATTAATTCCTGTT
GAAAAAAATAAAAGAAATATTTAAAAAAAAATATTATACTGCATTACTCTGTTCTTTGTG
CCTTACAAAAACATTTCAAAATCACAAACTGGTGTTTTCTTTGAAAAATAGTAAATGTTT
AATTGCTAGAATTAAATTTTATTCTCCCTTCATAAAAGGTGTAAAAAATAACCCTGTTTT
TCCTACAGGGTTGCAGAGGCTGTACCTCTACAACAGAGCCTTATGGCAGTAAGTGTTCAT
GGTTTTGCAAAGCTGTAGGACTTATGGAGGTAAAGGTTGGTTAAATAACTGCTTAGTTCA
GCTGGCTGTAACAGTTTATGGAGGCACGGCTTTGTATGTTCAGTAGCTTTGCTGGGGGAG
GCTAAGGGGGAGTGTGATAACTGTAACTTGACTCCATTGGGATGGAAACTCTTGAACAAA
AGATGGAAATACAGTAATAACTAACTGGTAACTAAAGCAAAACTTGTTCCTCTGTGCAAT
AAAGATGTGTTCCTGCAGAACAGAGCTACCCTTTAACTTCACAGATCAGTAACAAACCAA
GGACCAGCACCTAGGGCAGAGTCAGAACAGTATGCAGTGAGATCAAAAGTTGGAAATCTT
TTTCACTTATAAGGCATGAAAACATATCTGTACACACAACTGAGCCCTTGAGCTCCCTGG
TGATGTTTCTCAACCCACAAAACACTGACCCAGTCACTACATAACTGTCTTGACATCTTG
CTCACAAGTATTATTACTGAATAAAAACAAGAACTTGAGTTCAGTTTGTATTAAGTGGAA
CAGTAGGCACAGTAGCTGCTGGGATGCGTTAGCTAATAACAACCAGCACAACAACACCAA
ACACTATGGCAATTTAAAAAAAAAAAAAGCTGATGGACAGCAAAGCTACAGCAGGTGTCA
GCAGGCTCTTGCTGAGGAATTCAAAGCATGAGACCATGAAGGGCACAATGGGAGAAACTC
CTGGCAGAGAGAACAGTGAGGAACTTGTGAACAACACTGATCTGTTTCATAGAGCCCGAT
CCCAAAAATAAATACTTAGCACATTCTTAGATTATTTTCCCCAAAATGAGATCAATTGGC
TTTGACTTCAGTTAGTATTTAACACTATTTAATCAAGTAAGAATGAAGCACGCGCTTCAC
ATATCAGAACAAGTCACAAACCATACTGCCATTAGCAGAGGTTAATGTCAAAAACGTAAC
ATTAGTTTTTATTTTTAACACATTTTCTCCACCAGTTACAGAAAATGTTTGTGTGCAGTA
ACAGTTCAAACCACTGTGCTTAGTCAAATAACACTTGAACAACCCTTCAAAAATCAAGAT
TCAATTTTGCAGAATTGCACAAGAAATGCTGACACAAATGGTTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1149..1286, 1471..1584, 1761..1847, 2703..2838, 3701..3804, 4762..4894, 5384..5471, 5847..6030, 6483..6625, 7286..7422, 7899..8098, 8426..8477, 8597..9246
1001..1063, 1149..1286, 1471..1584, 1761..1847, 2703..2838, 3701..3804, 4762..4894, 5384..5471, 5847..6030, 6483..6625, 7286..7422, 7899..8098, 8426..8477, 8597..8682
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved