Gallus_gallus Locus CNOT1
snOPY snoRNA Orthological Gene Database
Gallus_gallus CNOT1
Gallus_gallus
CNOT1
11
SNORA50, SNORA46
14903..15038, 23119..23254
44776
AAATTCTAAAAAACAAATGAAAGCTTTATCTAACATATGTTACCTAATGGCTTGTTTGT
GGCAGGCAGTACCAAAGTAAATCATCAGCGCTTCTGTTTCTGTCAGTATAAAAGCCATGA
CAGGGATTTAATTGTGAAGTTAAATTAATACAGGGAGTAAACTTTTGGTCTACACACATC
CAAAAATAGTTCTAGAGATGCTTAGCTTTCCACTATAAGATGTGTTAGCTTGCAGTAGAA
CAGTTACTAATATTCAAGACCTGCAAACAGGCATCTAGATTGCCTGCTATGACAAGTGAG
ACTAATCACAAAATCAGCTCTATTTAACTTTTTGTTACTCATTTCAGAGTCTAAAGCCTT
CACCCCATTTATTTGCCCAATTGAGTAAAGTCATCAAATTAAGTAAAGTTCAAGAGGTAG
GTGAACCTTCTGTTTTCAAACTGTTTTAGTGTTTTATGACTGAGCTTGTTGAAAAGGGCA
ATGTCTCCTTACTGTTGTTTGGGGGTTTTTTGTTTGTAGGTGATATTTGGTCTCGCTTTA
CTGAACTCTTTCAGCTCAGATCTACGAGGTTTTGGTAAGTGAGCCTTCCAAAACACCGCA
GCAAAGACATTGTTTCCCATTTAAGCAGTGGGCTTTCTAAATAAGTAGGTATTTGCATGC
GTGATATTGCAGTCAGTGAAGGCGCTGAAGTCTTAAAGCCTTTTCTGGGGAGGGCAATAG
GTAACGTGGCCATCTTGTCTTCTGTGAAGTCAGAGGTCCCTTCAATGAGTGACTTGCTAG
GTAATGAGTCATACTGAGGTAGTATCTTACTGTTATGGTTGTCCACTAACAATTAAGCTC
AGAGGTTTGAATTATGAAGTTTATCTTTAAATCTGAACTGTTGTAGTTTGTGATCAACAA
ACTCAGAGTAAGAGAATGGTACTTAACTGAAATAAATCGTTATATTGAAAACAGATTTCA
GATTTTGACTCTTCTCTTTTGCATTCAACAGCTGCCCAGTTTATCAAACAGAAACTCCCA
GATCTTTTACGCTCTTACATTGACGCGGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAA
GATATTGCAATAGAGGTCCTGCACCTTCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGA
GCCTTTGGGGTGGGACAGGAACAGATTGACGCTTTCCTCAAAACATTACGTAGAGGTAAG
TGTGGTGTTTTTCTGGGAGCCAGACTAAGTGCCAATTTAGAAATGGGCATTTGTAAACCT
GCTGTCAGTACAGGCTGCTGAAATGGGGGTGGGGCTGAGGTAGAACTCAGTAATTTTTCC
TAACAAAACTGACAGAAGTACTACTGCTCTGACTTCTGGCCAGAATGGTATTTCTTTTAG
CTTGCAGGAACTTGAGACAACCTTAAGGCTTGGTTTTTTTTGGTTTGGTTTTTTTTTTTT
GAAAGACTTTTGATTAAATAAGCGTAGTAAATAAGATGATATTTTAGTCTACTTGTTTGC
TTGTGTGGGATGGCACTTGTGGTTTTAACTAACACATAACAGTGCATTGTAGTTGGAAAA
GCCTGAGCTCCTCTACAGGGTAAGGAACATAGACTTTAACATGTTGTTGTTTTTTTTTAA
AGCTTTAAAATCATTAACTTGAAAGAGTAATCACTGGGTGTTCTATATTAGGTGCAGATC
TGTGAAATACTAGCAGAGTATGGGATGTGGTTTCTGATTAAATTCCTGGAATCTCCCATT
CACCTTGTGTGGTCGCAGGGGGATAATGTCAATGAGATGTGAAGTGGTAGTCCTTTCCTT
TCCAAAACCAAAGTGCGAACTGTAAACACTTGAGGATGAGAATTTGGACTCAAAAACTGT
GTTTAACACAACCCACTGCTTGGTTCTACACAGATCTAGAGGAATTCATCCGTTGTACAG
GAGAGCAGAATGTTTCTACCGTTTGTTCAGGTGTGACTTCTTAGGTCATGCTTGCTTTAA
TGAAGATTAGTGCATTAGCTTCTGTTATTTTCCTTGCTTTGATGTGGGAAACTTGGAACT
CTTCTCTGAGTGGCCCCAAAGGGTATTGGAGGTATTATGCATTGTCTTCAAGACAGTGCT
GTGTAAGGAGGGCCTGCCCATAGGTTGTCTTTACTCTGCTATTTTGCTGTGAACAAAACT
GCCAGCAATACTTGTCATCTTCTCAGTACTGTGTCTTCTCTAAACTTTTTTTTCCTGAGA
GGAAGAGTGAGTATTCTTCCATCCTCAAGTGCCTCAGTTTGACTGATGCACTTCTTAAGC
TGTGGACTCGATAGCAGCTCCTTTGTTTCCTAATAATTCCCAGTGTGGGGGAGAGCCTTC
TTTACTGCTGTATTATTCCTTGCTCTGTGCTTTTTTTGGGTGGCTGCTGTTAGCAACAGT
CTGTAGCTGTAAAGCTCCCACTGCAACTGCTGGTTTTCTTGGCCAGCTGCAGTGAAAATA
TTAATCTAGTCTCTTGTACGTTCTTGTTCTCTGAGAATATCTGAGAGTCAGCAGGGAACT
ACTAGGTGGTATGGAAGAATACTTGAAGCAGCATCTGAATTTCCTTGCTGCTGCAGAAAT
TTTAGTATGGCATTCTGTTTCTGAATAGCCAGTTGCATACGACAACTATTGTTCTGGGTC
TTTGACGTGACTTTGTTTCATTATGTTTGCCTTCAGATTTTCCCCAGGAGCGTTGCCCTG
TGGTGCTTGCACCACTTCTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGC
CTGATTCTGGAGGGATAGCCAAAACAATGATGGAGAGTTCTCTGGCAGACTTTATGCAAG
AAGTTGGCTATGGCTTTTGTACAAGGTTTGTAGGAAAAGACAATTTTTTCTAAGTGAAAT
CAAGCACTTTGGGTGCTGGTGGCTTTCTTTATTTCTCAAGATGCACAAGATTAAGAAAGA
GCAACGTAAACTATTTTGAGATTGTCAGTTTTAATCCTTATTTTGTTTTGCTTTCTTCTG
TTGTGTGTAGCTTTTCTGTTGAAATTGTATATTATGATGTCGTGGTAAAAACTGTTAGCT
AAAGGTATTCGCCTTCCCTGGGAAGGTTTTATAAACAAGGAGGATGGTTACATTCCTAAA
AACAAGATGGTTTAGGAAACATGAGTCCCACCTAAATCCTATTCTGCACTTATGGCGCAC
TCCTGCTGGCTCACTGACCACATGAAGTGAATTACAGAACTGCAGATAATAGTGTCTCTT
CAAGGGAGTTGCCCAACAGCAGCTTCTTGTTTGTACAGTGCTTATCAAAGCTTAAACTTC
ATAATTAAGATTACTTGAAGCTGTGGAATATAATTATGATAGTGAATTGCTGGTGATAAA
GCGGAGTATCCTGACAGCTGCTTCAGAGCCTGTGCCTGCTTAGGCTTATTTTGGTAGAAA
TACAGCTGTCTTAAACTTGCCCTGGCTTTGTGTGTATATTTGTGTACATACTTAACCCAC
ATTCTCATTCAGAGTGTTCCAGATTCTCTTGGCTATCTTCCCCTTCTATAAATGTGAAAT
ATGCATCTCTGTTAGCTGGAGTTCCCAGTGTTGTGTGAAACAGGCTGCCGTTTAAAGAGC
TGTGTAGGCTTGCTGAGAGCCATGTGAGCATGACTATACATCTTTGCACCTAGCACAGAT
ACTGTGTGCCATTGATTGTTTATATACGTGTTTGAGTTGTCATGATTACCAGAAATACAG
GAGGAAAAACTAGATGATAGTTAGAATGCCTCTACTGAGGAATTATTTTTAATATCTTAC
GAGTTTATTTCATGCTATATATCTGTTACCTTTCCATAAATAGAATCTTATAATACAGTT
GCTAGGGCTCAAGGAGAGTGCTGTAATACCTGACCATGGTAGCAGGAGCCTGCAAACATG
TGGCTGTTTCTGGCTTAGCCTCGTTCTGAGGGCTAAGCCTGTGTTTGTTTGAAGGATGAT
TGGCTTTATTGAAGTCTGTCTGTTTTGTCCCATCCTAGCATTGAAGAATGTCGCAACATA
ATCATGCAGTTTGGAGTCCGGGAGGTGACGGCTGCCCAGGTTGCCAGGGTTCTGGGGATG
ATGGCTCGAACGCATTCGGGGTTGACGGATGGTATTCCATTACAAGTGAGTGCTGTACAG
GATGGCTTGTTTGTATTTTAATAAGTGGAAATTGGGAAATGAAAACTTAAGAATGTAAGC
TTTTATTATTCAACATTTATACTTCTGAAGGTTCTATTGTAAAGTTCTGTAATACCTTCT
TGAGTGAAGGTTATTTTAGCAGCATGCAAGTGGTGTCATTACTGGTCTGAACCTCTCTTT
TCATTTGTAGTGAGAAGTTCTATGGCTGGTGGGCTTTGAGAGTTCTCTATTTCTAGCCAA
TGCTTGATTGGGTGTGTTTAACTTGCAGTCTATTTCGGCTCCTGGCAGTGGAATTTGGAG
CGATGGGAAAGATAAAAGTGATGGAGCACAAGCCCATACCTGGAATGTGGAGGTCCTAAT
TGATGTTCTTAAAGAGCTGGTAAGTTTTCTGAGCACCTTGATCTTCAGTGCTGAACAGTT
CAAAGAAAGGCATGAATATAAAGCTTTTTGAGTTCCAGCAGCCTGAATGGCTTTGAATCT
GAATAATGTATTTGTGCTGCTGTGCTTCAGTGATGGGTTTTTCCCATTGAAGGAGAGTAT
TTTGAAGAACTGTGGTAAATAAAAACTACCTGAATGGCTAACGTGGGTGCGGCTTGTGAT
TCATTCCATGCTGCTCATTCCCGTGTGTTGTTGTATGTCTGAAGGGTTTTCAGTTTGAGC
AGTTTATTTCTGACTGTGGAACACATCTGTGCATAAGGCACCTTGTTCTGAAAAGCTTCA
CTGCAGGCATTAGTAATGAAGAAGAAACAAAATATTTTTGTAGCTACTCATTCCAAACCT
CCCAGTGCTGCTGGTGTGTGTGATGATTGGGTGGTTAAACACCGGGATAGGCTCCCGAGG
GAGGTGGTTGAGTCACCGTCCATGGATGTGTTTAAGAGCTGTTTGGATGTGGTGCTCAGA
GGTATGATTTAGCAGAAGGTTGTTAGAGTGAGGGTACTACAGTTAGGTTGCGGTTGGACT
CAATGATCTTTGAGATCCTTTCCAACCTGAGTAATTCTATGATTTTTTTTATCACTTCTT
GAGCAGCATTTTTTAATTAGCACAGTGAAACATGAGGGCCGTTTCCTTTCTCTACTAGGC
AAGAGAGAGTTTTGTGTGGTCCCTCTAGTCTATGCAGGAGTTGCTTGGTTTTAGAAAAAC
CAAAAACTAGCTTGCCTTTAATTATGTACCAATACCTGAATCCCTTTGTGCTGTGTAGAT
AACAGAAGGTTTTGCTTGCTAATGTAGCTGTACTATTTCAATTCTTACAAAAAGCTCTCT
TCTGCTTCTATCTTTTGTTTCCTTTAAGGAAACTGCTTTAATTTTTTTCATTCTATAGCA
ATGCATACAATTGTGGAAATGACTGCAGTTGTGGTTTACCCAACTGGCATGAGCGTACCT
GTTTGTTCCTCATGTTCTCAATAAATGATTTTTTATTCTTCAAACACTTCATTCTTTTAT
TCAATTTTGTAGTTGTATACAAGCACACCCAAAGCCTTTCTTAGCCTTTTGATGTGCAGT
TCACATTTACTTTGTGTCACATCAGCTTGTCAGGAAGTGGGCACAATGTGCAGTCAGTAT
CTTCAGCTCTTGCATTTGGTGCTCACCTACCTTTGGAAGAAGTGGTCTGCATTTTGTAAT
GGCCCTTGTTCCCTTCAATCTCCTTCATATGGAAGTTAAACACTATTGATGAAAATCTAA
TGGGTGCTTTGCGAGTGCTTGCACTGTAAATTCTTCAGGAAGAAAGCAAGTCCTGCTTGG
CAGCTGGTCAGATCCATCTGCCTCTTGCTGGAGAGTGTATGGAAGCCTACAAAAGGAGTG
AGCTAGAGTGCTGAGAAATGAGCTGTTTTAGTAGTTTTGGTTTTAATTTAATGTTTGGAA
GGATGTACAGCTACTGGCTGTAGTGCTGGGGGAAGTGCAAACTCATGGACTGGCTTCAAA
CACTAGCTTGCATCGTGTTTAGATAGTTCTACAAACTTTGTTTTAAAAAGAACACAAACT
GTTTTCAACTAAAAGTTGGGTGGATACTAAGCTGGAGTGGAGTTCTTAGAAGCAAGTACT
GAGGATTGTGATGTTTAAGGCTGACTACTCTCCTGTTTTTTGCATACAGAATCCTAGCCT
GGATTTCAAAGTAGTAACGTATGAATTGGACCACCCAGGATTTCAGATTCGTGACAGCAA
AGGCCTGCATATTGTGGTGTTTGGCATCCAGAGAGGGCTAGGCATGGAAGTTTTTCCAGT
TAATGCCATATACAGACCTTGGAAGCATGCAGAGGGCCAGGTAAGCTTACCAGCATTTAG
TCTGTTATAATGCAGCTGAGCCAAGCCCCTGGTTTACCTAGTTAGACAAAAAGGCTGGAG
TTCTGCAAAATGCAGCTGTGAAGGAACATGTAACTCTAGCCTCCTAAACTGCTTTTGGTT
TCTCTTTCTAGCTCTCCTTCATTCAACATTCCCTCATAAACCCGGACATCTTTTGTTTTG
CTGACTACCCTTGTCATGCTGTTACCACAGACATCCTGAAAGCACCACCAGAGGATGACA
ATCGAGAAATTGCTACATGGTAAACCTGCTCTGCCCAAACTGCTTTTCTTACCTAGATTT
AGAGTAAGACAACTTATTTGGTCAGATGTGACTTTATCTTAATGCAGCATGATATCTCCG
TAGCTGTGTGTACATTCCAGTAAATGAGCTGTTACTATTTTCCTGTGTTTGATCAGTGAA
AGTTCTTGTATTAGAACTTCCTGTATATTTCCATAATATCTGAAAATGTATTACTAGTTG
TTTTTATTGTTAGGAGAATTCCTGCAAATGTGTTTTGGTGAATCTTAGGACTGGAGGTGG
TGTGATAGAGGAGTTAGGATCTTAAATCTGTCTTTTGTAAGATAACATTGGAGAAACTTG
CTCCACCTACATGAAATAGCTCTTGGGATTTAAATAGTTCATTTGGGGAGCTATTCATAG
AATCATAGACTGGGGTTGAATAGGGCCACAGAGCTCATTGAGTTCCAACCCCCTGCTGTG
TGCAGGGTTGCCAACCACCAAACCAGGCTGCCTGGAGCCACATCCAGCCTGGCGTTGAGC
CCCTACAGGGATGGGGCATCCACAACCTCCTTGGGCAACCTGTTCCAGTGCATCACCACC
CTCTGGGTGAAAAAGCTCCTCCCAGTATCTAACCTAAACCTCCCCTGTCTCAATTTAAAA
CCATTTCCCCTTGTCCTCTCACTATTCACCCTCATAAACAGCCGTTCCCCCGTCCTGTTT
ATACGCTCCCTTCAGGTACAGTAAGGCCACAATGAGGTCTCCCCAGAGCCTTCCCTTTTC
CAAGCTAAACAAGCCCAGTTCCCTCAACCTTTCTTCACAAAAGAGGTGTTCCTGTCCTCT
GATCGTCCTAGCAGCCGTCCTCTGGACCTGGTCCAAGAGCTCAACATCCTTGCTGTCCTG
GGGGCCCCAGGCTTGTTGAGTTGTTGCACAAAATGGAATTGTATGACTCTGTGAGCTGAT
GGTTACAGCTTCTTTTAATATATCTGTATGGCTGATTTCAGTGCTGGTTGTTTCTGTTCC
CGTTGTGTGGCCTGAAATAAGGAACTGAAGGATGGGGAAGATGGTTAAAGTCAGAGGAGG
TGACAGTAGTTATACCTGTGTGAAATAGAGAAAAATATTCCACAGGTTTCACACGTGGAA
TCTCAGGTGTCACAAAAGAAGCCTATTTCACTTCTGGCAGTGTATTCCAAGTTCAGTTAT
TCCGGTAACACTTCTAGCTGAACTTTTTGACATCTGTGTTCAATTCTCCATCTTCCTGAA
CAGAACAAGAAGAGCTCTTAAGTTCATTTTGGTATATTTTTATCTATTTTTATTTTGTCT
GTTCTTGTTATTCTTCATGGATAAGGTTGCTACTGGAGTCTTAATTATATTCAGTAGGAG
CTGCAATTTCAGGTTGCTTGCACTGGGCACAGTCTTGCAATTGATGCTACAAACTGCATC
CGGGTTACTGTAAGTAAACTGGTTTGTAACCTTTGGGGGGGGGAACTTGTCTGTCTTTTT
TTCTTTCTGTTAGGAAGAGCCTGGATTTGATCGAATCTCTGTTACGGTTGGCAGAAGTGG
GACAGTATGAGCAGGTTAAGCAGCTCTTCAGTTTTCCCATCAAGCATTGCCCAGATATGT
TGGTATTGGCCTTATTGCAGATCAACACTTCCTGGCATACCTTGCGCCATGAACTCATCT
CCACGCTCATGCCAATCTTCCTTGGCAACCATCCCAATTCTGCCATCATTTTGCACTATG
CATGGCATGGGCAGGTAAGTGTTTTCACTGGTGCTAAACCTTTATGATTAAACTAAAGTT
TGATTTATTTCTGAGAGAGAGAAGCTCACACTTAATATGTAGAAATTCTAAGCAGTAAGG
GGAGGAAGTTCAAAACAAATAGCTTCCATCAGTGTGCTTGAGTAAAAGGTGGAGGCTATT
CTTGGTATAAAGAAACTGCATACACGGTGACTTCTATTGAAAGTTTAGAGTGTTTTCTGA
AGGTTTAGGGCTGGCCTTCAAAGAGAACTTCCATGCAAAAGGAGGGCAGATACACGTACA
AACTCCATGCTCTTAATGAACAAACAGTAGGCTTATTTCTATGGTTTTCCCTTTCATCTT
GGCTTTACTTGTGCCTACTGGTAGTTAAGCAAGTACAAATCAAAGGAAAAAAGATGGAAA
GACCCTCTGGGATGAGAGGAGAGTCTGCATTAAAGAATGTTTTATTTTTTAGAGTACAGT
AGAGTCAGTGTGTAACGGGGGGGAAATTAGACCTCTCCAACTGTAGGAAACCTGTAAAGG
ATGTACATTCTCGTCATTCATAGCTGTTCTACATCTTCTGGTTGAGCTCCTGGATAATTT
TGTTACCTTGTGATAAGAGTCCAACTAAGAGACTAAGTTCTGTAGCTGAGTAGCAAATGT
GTTTGTGTTAGGCTTTAAAGGTAAGGTATCATACTAAATGTTCAAATAGTTGATCCTTTT
CCTAGAGACATGAAGTACAATCCTAATTTAATTCTTCTTAGGGTCAGTCTCCTTCGATTC
GCCAGCTTATCATGCATGCAATGGCAGAATGGTACATGAGAGGGGAGCAGTATGACCAGG
CAAAATTGTCACGTATTCTTGATGTGGCGCAAGACTTGAAGGTGAGTTTTGCAAAGCACC
GTTGTTATTTTATGTCTGGTGTCTTATGCAGACTTGCTCATCTTGTAATATAGGCTAGGC
TTAACTTAGATGTGACTCATTTAGTAAGGATTGCTAAGAAGCAGTATAATAAAGCTGCTT
GCTTTGTGCATGTACTGTAAATCCAGGAAGAGCTTCAACTGTTTTAACCTTGAACACATT
GAAATGGGAATTGTCACCTTCAAATGCCTGAAGGATATTTTCTACATCTCTGAGACTGAT
GGAATGGAGGTTTCCTAAGAATACTGCTTTGCAACTATTTACGTGTTCACAAAAGACTGG
AGGTCACCTGATATCTTAGAGGCCTTTATCACTTCCTAAAGTGAGATGCAAAGTAATTGG
GTGTCACAAAGTGCAAGAGCTTCAAGTCAGTTTTGTTGTATTGCTTTCTGTGTTCAGGGA
TGACCACTCAGAACAGATGTATTCAAAGAGGCTCTGAAGTGATTGAGGTCTGTTGGCAGG
GAGATGCTAGGATATTCTGATGGGTTTTTTTTAGTTTCCTTTACAGTATCACTTTGGTAT
TCTTGGCTACTTGCTGGTAGATCTTCATATAGAAGATTTAACTCAGTAAGCACAAGGTCA
CTTCAAGGAAGGTGGTACCATACTTTCAAGAGCTCTTGCTTATTTGTGCCACAAGCACAA
AAATATGTATATGATGCAGATGATTGACTAATAAAGCACAGCAGCCTGTGATAAGAAAAT
TTCTTTGTTAAAAAGTAGATGGAGATTAGAAAGAAAATAAAGGAAAAAGGGTATCCTTAT
GTCTTCACTGGTAGTCTTATTTTTTTTTTCCTCTAGGCCTTGTCAATGCTGCTAAATGGT
ACTCCGTTTGCCTTTGTTATTGACCTTGCTGCACTTGCCTCTCGACGAGAATACCTCAAA
CTTGACAAATGGCTCACAGACAAAATTCGGGAGCATGGGGTAAAGCAGCATTTTCTCATT
TTTTTTTTCTCCCCTGTACTCTATCAGTGACTAATGTAAGTCACTTTCACTTTATAAGTA
GCTTTGAAGTTGTGAAGAGTGTCCATGGTCTGATAGTTCCACTCTTTCATTGAACTATAA
TTTATAACTTTGTGTAATTCTTTCCACGATGCAATTGCCAAGTTTGAAATAGTGGCTTGG
ATGCAGATGGAAGATTGAGATAACTTTATTTTCCACAGGAGCCCTTCATCCAGGCCTGCA
TGACCTTCTTAAAGAGAAGATGTCCATCTATCCTAGGTGGCCTTGCTCCAGAAAAAGATC
AACCCAAAAGTGCTCAGCTTCCTCCAGAAACCTTGGCAACTATGTTGGCATGCCTGCAGG
CTTGTGCTGGGTAAGGGTTATACTGCTTACACCGAATGCATCATGTTCTTGAAACTCATT
TGCTGGCTGTATGTTGCATGTGTTCACAGTTGGTTTGGAGTTTCCTGTGTGTGAGACTAT
ATGATGCTGTATGGCTAGTCTCAGTAGTGTGTTTGCCACTGACACTGAAGCTTCTCTTGT
AGGTTACATGACAGGAAGTTGAAATAGATCTTGTCTTCACCCCACTGTCTGACTATGGTC
TTGGTAATGGTGGGTTGGCTGCTTAGTGAGATACTGGGTTAGTGACTAGATGCAGTGCTG
TCATTTGGATAGAACAACATGGATCATGACTGCAGAGTGTGGCACCATCATTTAAAACTA
TGACAGTATAAAGGATTTTGTGATTGCACTGAATAGATGTCTCCACCTGTGGTTGTTACC
CTGTAGCAGAAAGGATTAATGCAATTTTGCTGTGCAAGAGGAAGGTGGAGGTTGTAATGT
TACAAAACTGAAACTGGAAGTGTAACTTCTGTTGTCTCCTTGAAAATACTGCCTTGAAGT
AGTCAAAGGGTGGGAGGTAGCTGAGTTGGTCTACACATGAGTTTGTTTATCTAAAATTTA
GAAGGAAACTGAGGATCCTAGGGAGCTCTAACGCACCCCTCCTGGAGCAGAGAAAGAAGA
AACAATGGACAGGACAACTTTTAAGTACTCTGTTAATTTTAGGTAGAAATGATGAAACAT
TGCAAAATATTGGTAGGGTCACTTAATACTGTCAGGTCAGGATAGTATTTGACTGCAGCA
ATATTTCACAGGTAACCAGGAGTAGCCCTGTGTGGCCTATGAGCCAGAGAGACTGGAAGC
TGGGGGTGCTGCTGGCTTTGGTGTTAAATGTTGACATCTGAAGATGGTGGTGTGGCCAGA
TGCGTTACCTGATGTAGGGGTTGTATTGTCGTCTGGTGCTATCTTGACAGATACAGGAAA
CATCTGTATGGCTGTCAGAGATGATTCCCAGCTCTCAAGTAAACAGTGGGGAATAAATAC
CAGCACAGATCTGTCACAGTCAGTGCTTAAACTGGCGGGGGATTTCTGAGGTCACGGTAA
AATGTTAGGAGAAAGGATTCTCCTGTCTTCCGTTGGGACCTATGCAATTAAACTTTAATA
ACTACTGAAATACTGTTTCTGAAACGTTAATGTCTAGTCCATCTTTTAGACAGAAAGAAT
GCCTGCTACTTCTCAGCTCAGTGCATCATCTTTTAGGACTGTAAAATTCCACTCCGGCCC
AGCATTTGCCTTATTTACACTGTCCAAATGTGGGGATGTAATAGTTAACCGTAGACTTAA
CTTGCATCTAATGTCACTGTGTCCTGAATCTTAATGTGTTACCAAGTTTTATTTATTCAG
TTAATCCAGAAACTACCAGTTCTCTACTGGCACAATTATCTCAGCTTTTGGGTTCTTTTT
ATAGCAACGTGCATTCCCTTCTATGCAAGAATGTGACCTACTTGCAGTCATTTTCCTTTA
GCTATTCTCTTTGAGTGTGAAAGAGAAAACACCAAGATTTCTTTCGGGAAGGGATTGCTT
TGATTGCTCCAGTCACAAATGGAAGCGGGCATCATAAAGACTGGGAGGTTAAAATTGCAG
TAAACACAAAATGTGTCCAGAAGGGTAGTGCCCTTCACCACCTGAAGTCTGCCACTGTGG
GTAACTGATTTAGGAGCAGTTTTGTTAATTAAACTGTAATTATTAAGCTGTAGTTAACTC
TTCTGTGGTTTTGTGTCTGGGGAGACACTTCTGTTAGCCACTAATCTTAGACCCTTTCTG
TCAGTGCAGCTTGTACAAAAGTGAGCACTGCTGTTGTGGCATGTAGCAGTGATGCTTCAA
AAGGAAATAGCTTTTTTTTTTTTTCCTTATTACTTACTGTTTTTCAGTTGAGGCTCGAGT
GGTTTGGGCAGGGTTGAAAACATGAATTTTTAGGATCTGTTTTGTTTTGCTTGAGAAGCA
TGTCCCCCTACTTACTGTTTCATGTTATCACGTCATTTCCTTCAGATGCAACTTTGTGAA
AATCCAGTTTTGTACCATTTAAAAAACACTGTGGTATCTATCTTGATATGCAGCGGAATC
TGACACAAATATGTTAATTTTCCATCTGTGTAGATGGCAGGACTAGAAGTTAGTGACTTG
TTCCAAGGCATAAATGGCTTTAACTGGTCACCATAGGAATCAAACTTGGGATTGTAAGCC
CATCTTAAACTGTATTGTGGGCTACCATATGGTCAGTGGCCTCTAGCAGTTTGGAATCTG
TTTTACTAAAGCATGCTGTGATATTTAGGTGGAAACATAGCAGGCATGCTGCTGCCAAAA
AAAAAAAAAAAGCAGGGCAAAGGATGGAGAGTGGTAACTCTGAGTGACCTGTGCTCATCA
GCCCTGCTCCTGTTCCCTGGTTAAATAGGATCATACAGTGCTACAGATATCTCCTGCATG
AAGAAAACTCTACTTCCATGCCTGCAATTGGTCATAAGTGCCTGGAAATTTAGAGACTTG
TGTGGTTTCAGGGAATTGGGGTGTAGGCAAACTCATACCGTGTGTGCTGAGTGTCCATGC
TGTGCTCAGAGCTCTGCTTTCTGGTCTGGTCGCACTTGAATGAAACAGAGAAACGGAAAT
CCCCTCTGTGCCAGGATGGCATTTCCCCCACACTGTGGTAGAGCACTGGCTTTGGAGAGC
AACCTGCATAGTCTGTAATGGGACAGCTGGCAAAGCTGAAGGCTGGCCTGCCTCGATTAA
ATTAGAACTTTGTTTTCCTGCCTTATTTATCACAGTTGTTCCTCATTCTTTTCATCCCCA
TCCCAACATCTGTGCAATAGAAATTGTGTGAAAATCTGTTGGAAACAAGGAATCTCTGGA
GGCACTGGACATAGCTGCATCATTGCAAGAAGGAATGTGCTGCTTTAGTTGTACGTGCTA
TATAAAGGTCAAAGTAAAGGTCAGGAAAGCCATAAATAGTTGGTTGTGTGTTCTGGAGTG
AGATGTTGGAGTTGTGTGAGCATGCTTGTGGTTAGGTGTGTCAGCAACAGAGCTCTTTGG
AAACCTGGCAGCCAGACCTGGAACACTTTGAAAGAGGAGCTGACTGCCCTCAGTTGTGCA
ATGACTTCAGGCCTAAGCTTGAGTTTTCTGTTGGGTTTTGATGCAAGTTCTTTGAATAGT
TGAAGAGTTCTTGTCAATGTTGAACAATTATTAATGGTTAAATGAAGTTTACCTGTTAGC
TCATATACAGAAAAATTGTGGGGGTATTAACTCGATCCATCTGTATGCTTGTCTGTAGTC
CAGCCTTCTTAGGCGTGTTGGAACTGTTGGAGAGTCTGTGTGTATTTTGAAACTTCAACT
GGAAATGATTGAGTGACAAAGCCTGGGAATGGGGGAGCCTTTAGGGGCTGATTTGACCAA
GGGATTACAGCATAAGGAGTGTCTGAATTCATGAAGCTATGCTGTACATAGTCTATATCT
GCAGCCTTCTTTGCCTGTTTTTAGGGCTGTTGGAGCCATGCAGACAGATACACATCCTGT
CTTTCAATAAGCCATTACTTTCAGAAATAACAGCATAGCACAGGATTGGGGCTCTTAAAA
ATGGAGGAATGTGTTGAAGGTGGATTTTTTTTTTTTAGAACTGCAGTTGAAATTATTCAT
CTAAAAATACAGCTGTTTCTCTCGGGGGAAAGGGGAACTAATGCAATTGCTGCAAAATTC
ATACATAGTTTTTCCTGGGTTTGTTTTGCCACTTATGTTTGTGAAATGTGGCCCCATCTT
TTGAAGGAAAATGATCAATTAGAGGCCTGGATTTTGTGAACGTTGTGTGTCTCACTGTCC
TGCTCTTCTGCTCTAGGAGTGTTTCTCAGGAGCTGTCGGAGACCATCCTCACCATGGTAG
CCAACTGCAGTAATGTCATGAACAAGGCCAGACAGCCACCACCTGGAGTCATGCCCAAAG
GCCGCCCGCCCAGCGCGAGCAGCCTGGATGCCATCTCTCCTGTGCAGGTAGATAAAAAAA
GAACATGCTGCGTCTTCAGAGACAGCTGACTGGCATTAATTTTGGTGTGCTTGTTGAGCT
CTTGCAGCTAAGTAATACGTTATCTGGCTCCTTTAGTTTTTGTTCTTGCCTGAGGGTTGT
AGGTCAGAACTGTCTCACTTCATGGGTGTCTATAAGAAACCAAAGTATAGCAGAATGGGA
ATAACAACAAGTGATTGAGGTTTGGTGTATTTTAAAATAACAGAGGGTTTTTGAATGTCT
TCGTAAATTTTAGCACTTGAACTAAGCACTGCCTTTGAACCTGATGTGTCTTGTTTGTAG
CTTCATGGGCCAAGCAGCAGTGCTAGAGCATAAGGACTTGTTATAACTGGGGCTCTTCAG
CTCTCAACTGAACTGCTCTTTTAAAAACAAGGTACACTTAAGTTACTCCCTGCCACTCAT
CATCCCTTCCTCCTCTGGAAGCGATGCACTGCAGACACGCTTTGCTTCTAGCAGCTGCAT
TCAGCAGCAGATTTCAAAATGGGAAGAACCTTTTGACATGAAGTAGTGGCAATTCAACAC
TGAAGAATGTCTGAAACATCAGCAAACTATGTAAACTCAACGCAGAGATCAGTTTCCTTA
TAAATTGTTACTTTATTGAAGTCGCTCATCCAATGTACCAAGCACCATGGCAACCTGCTG
CAAATAACTGATGTGAAGAAGTGGATCAGCAGATGTTAGCCTTAGTCATGTTATCTTTTG
GGTAGATAATCTAGCATCCTATAGGCAGATGGCTCTTCTGGGGTAGTCTGATTTCAGATT
TAAAGTGACCGTGCAGGCGGACTCTTTTCAGGAATGTTTTTGGTATGAAGCTATCTTCAG
AGAAAACGTGTGAAGAGTGAGCTTGGTTTTAGCACATGGCTGTTTGTTTATAATCTTTTA
TTTTTCATTCAGATTGACTCGCTTGCAGGAATGGCATCTCTGAGTTTAGGTGGCTCGGCT
GCTCCTCACACCCAGAGCATGCAAGGCTTCCCTCCAAACTTGGGCTCTGCGTTCAGTACT
CCTCAGTCACCAGCAAAAGCGTTTCCCCCTCTTTCCACCCAAAACCAGACAACAGGTTTC
AGTGGCATTGGAGGACTCTCTTCACAGCTTCCAGGTACTGCTATCTGGCCTGGAGAATTT
TGTATTTTTGATACATCAGAGTTAAGACACTGTCATTATTTACTGTGATTGGATGTACTG
GGCAGACAGCTATCTGTTGTGGGAGGGAATTATCCATCCTTGTTCCTAGGTCACTGCTGA
TAACAACGCTTTCATATATTGTGACTGCAGTAGATAGAACATGTGAGAGTCCAGAGGCTG
TGTGTTTTTGGCAGATTTTTAGCAGCACTATTTTAAGCTGGGAATGAGACGAGGAACTGC
TGAGATAAAGCTGCTTGACACTGGATAGTTATGAAGCTCTATAGCTCTGATAATTAATTG
GAAACAGTAAGGTGATGCAAGTGATACATGCATAATGTGAAGGGTGCAGCTGAGATGAGG
TACTTTGTTTACTTTCCAGTAGGTGGTCTTACTACGGGTAGCCTGACTGGCATAGGAACT
GGAGCCCTGGGCCTTCCTGCAGTGAACAATGACCCATTCGTGCAAAGGAAGCTGAGCACA
TCTGGACTGAGCCAGCCTACGTTCCAGCAGAGTAAGATGAAACCTTGTAAGTGGTAGTGT
TGTCTGTGACTGTGAAGTGTGACTGTGGTTAATCTGCATTTCCTTCAGGGGTGGCTTTGT
TCTGGAGGTGATAAGTAATAGAAATGTGGCTCTTGTAATGTACTGTTAGCCTGAAAAAGG
TGCTTCTCAATTTCTATACTAGCAGCTTGCCAAGTAACTGGGGGTGGGATTGAAAAAAAA
TAGTAAATACAACACAATAAGTAATTGCATGAACAGCATGCTTTTGTCCTTTTTTCTAAT
TGTGCTATATTTTGAACAGAAGTCTTATCCTACTCTTCAGCGAGTTGTTTGTGTTGTAAA
AGGGGTGGGATGTGGTTTTTTGTAAGGTGGCTAATCATAGCTAGCTGGGTTAAGTCCAGC
TGCAGCACAGCAGTGAAGCAGCCTGCAGTGTTGGAAAAGAAATACAACTAACGTGAGTTG
GTGGGAAGGTGCTGGGGTGTTTTTTTTCCTCAAAAGAATGGTTTAATCCTCAAAATGGAG
CCATTATTGTTAGCTCCTTTATAACTCTTTAAGTATGCTCACATGTTTAAGCAAACAAAC
ATTGCTGTTAAGAAGCCTGCCCGTATGCTAAATTTTCCACCTGACTGTTGTCACCTATCT
GTAAAAAAGCAAAGTAATAGGTGTCTATAGACAGACAGCGGAGGCAGCTTTAGTGACCAT
TCTGTTTGTTTTTTTTCTTCTGGGGCTTGAGCATTCAGTAAAAACATGCTTGAAGCTCAC
TGGCTGGCCTGAAAGTCTGTGTGAAAGTTTGTCTGCATGTTAGTGTTGTGTTGTGCTTTA
TCCTAGTTTGTTTGCATTCATTTGGTTTAGGTGCCAGCTGAGGATAGCTTGGGTTGTAGT
GGGTTCCAGGAATGCAACACTAAGAGACTAATTCAGTTCTCTTGTACAAATGTATTGAAA
ACAGATCTTTAAGAATTTCTGAGTCTTCCTAGTAGACGGTAACCCGATTTTTAAGATAAA
CTAGCAGATTATTTACAGATTTCTGAAGAGGTGAAGAGATATTGACTGTCTGAAGTTGAT
GGTAACCTGTTGCCTTTTCTTAACAGCTGACTTATCTCAGGTGTGGCCAGAGGCTAATCA
GAACTTTAGCAAAGAAATAGATGATGAGGCAAACAGCTACTTCCAGCGTATCTATAACCA
TCCACCACATCCAACCATGTCTGTAGATGAGGTGAGTTCCTTTCTGTAATGGTTGTCACC
TGCCTCGAGATAGAGACAGCAGCAGGACTTCAGCTCGAGTAGAAGCCTGAATATTCAAAA
TAAGTTCTAGTGTGCCTTTAAATAATCTATTAAAATTATACTGTATCTTGAATGTATTTG
TTTTTAAAGTATCTGAAAATGACTGCAACTTCTAAATGTATGCACTGAAGCTCTTGTTTT
AGTTAGACTCTGAGAGTAATCCTACATATGTGATATATTTGCTCTTTAAATTACTACTAA
TTTAGTTTAATGTATTTGTGTGGTTATAAATTATGGGAGACACAGAACATTAATTTGTGT
AGTTTTGAAGTACTGGACTTGGAGGCAGCAGGAAGTTTTACCTGAAGGTAGTTACCTAAA
AAAAAAAAAAAGGAGAGAGAATTCAAGTCTGAAGGTGCTGTAGTACCTACTAGCCAAAAT
ATGTTTTAGTGGAAATGCTGGCTCTGCAGTCTGGCTTGTAGTGCACCCACCTACTCTGGT
TATAGGCATACTTGAAACTCATAGATGCAGAAGAGCTGAAATAAAACATCTGTTGGTTAA
GATTTCTGCTTTCTTTGCTTGCAGGTCTTGGAAATGCTGCAGAGGTTTAAGGACTCCAAT
ATTAAACGGGAACGAGAAGTGTTTAACTGTATGCTGAGGAACTTGTTTGAGGAATACCGT
TTCTTTCCCCAGTACCCAGACAAAGAGCTGCACATAACAGCCTGCCTCTTTGGTGGGATA
ATAGAGAAAGGACTGGTTACTTACATGGCTTTGGGCCTGGCCCTTCGCTACGTTCTTGAA
GCCTTACGAAAGCCTTTTGCGTCCAAAATGTACTATTTTGGTATTGCTGCACTAGATAGA
TTTAAAAATAGGTGAGTGTGGTTTTCTGGTAATAAACAGTGCATGTAATGTCTCGTTAAC
CTTGAACCAATTATAATTCTGCAGTAAATGATGACTTATGTGTGAGAAATTTACATATGT
CAGTGTTAGGATTACTTTACAACATGCTGAACTGAAACAGAATGCCTTAATGTGCTAACA
AAAGGGTGACTTTTGAAATCAACATGTGAAACGCAGTACCTGTGTAAATGTGGGACAAAC
TGAGATGCTGAAAATACTTGGTGGCCTTTGTGTGTGAAAATAATTCAGGGAAGTGTTGAG
TTGGTTGAAGTTGTCAACTTGTTATGTTGAATGTAACTATTAAAAGGTGCACTTTATTAG
AGTGCCATTTGCATTACTCAGTAATAAAAGTCTGGCTAGAACCTAAGCTCTAGGAGTTTG
GTTTGAATTTGAATCTCCAGTATGGCATCTGAGTCATCTTTTGCTCAGAATATTCTGCTT
TAACGTTGTGCAAGATTATGAAGAATATTACTGTAGTGTTTTTAATGTTAGGGGCACTCT
GATTTGCTGTTTAAGATGGTGAGCCCTTCTGCAAATCACTTCTCCAATAATCTTATTGTT
AACACTGAATATAAATGCAATAGTGTGTTCAGTCAGAAGTATGGGGATTAAGCTGGGTTA
CTGTGAATTAACCTTGTGTTTTGCTCTTGAATGAATTCATTTAGGATGGCTTTCACTACA
ACAGCAGCTTTGTAGAAAATGTTTTGTTTACAGCACAGCTGCTGTGAGCAAGGCAGAAGT
AATTCTGATGTAGTATGTGGATGACGTACCAGTGTTATATCTGTATTGCTTTGTAATACT
GTTTTTGATCTAGGCTTATGCTTCTGACTAACGTGTTTTTGGTTTTCTTTCTGGCAGATT
GAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATTAGTCACTTTATACAGTTCCC
TCATCACTTGCAGGAGGTGAGTGTGCTCATTAGCTTTCTGTGGTTTTTAAAGTCTTTTGA
GCAGCTTGCTGTTTTCTATTGGGAAAATGGTCTGAGCTGTCTCACGTTTAGCCAGAGTGT
TTAGTTTCCTGGATGTGTACTTTCTTAAATGTTTTACAAAACTTGTGGTTGTAGGTGGTT
GGTAATCTGTTCCTGTACACCTGTTTGGTTAGCTCACAGTGAAATAGCTACCTGCATGAT
CAACCAGGGCACATGGCCATGTACGTGGGTTTTTAAGTGCTTCCAAGGAATCACACTTCA
GTCTTTTGAGGATTTGAGCTTTCCCTGGGAAACAGGATATTCAGCTGTGTTTGTAGAGTA
GCATACTCAGGCTTAGTAACATAATTCAGAAAAAGGCAATAAAACCTTCTTTCCTGAAGG
TAGAAACACGCTGTAGTCAAGCAGTGCTGATCATAAGGTGTCTGTCTTGAAGGCTGGTAG
GAGAGATAAGAAAAAGTTAATCCCTGTTGCAGAGCTTGAGAGCATAATCTGAATAAGGAG
AAATGTTCAGCTCTAGCACTGAGAATTCATCTACCCAATGCTGTGAAGTCCAGTCACAGC
CTTAATTTCCCTGACAGGTTTCAGTCTTTGTCCCTCAACTGACTGTGTATCATCTGGCAT
TACAAATATCTAGGTTAAGTGTATTAAAACAAGAGGTTTGTCTTCTATCGTTAGATTTTT
TTTAAACTTCTAATCTAAAACTGGACAGTTCACAATGAATAAGCAAAGAACAGTTTTGAA
CTTTAGACTTATTTAGCTGTAGGAGTCCTTGTGGGGGAATACTTCTTCCCTGCTTTGTGG
CAGGCTTTTTAGTCCCCCCCACTTTTGATCTGCTAACCCTGACCTGCAGGGATGGGAATT
TCTGGCTCTGCAAAATGTCTTACAGATGATAAATCTGTTGATACTGAATATCTACTTGTG
AGGTTAGAGTTAGAGCTGGTGGTTCTTCTCTGGATAGAAGGGAGGTACATAATGATGAGG
TGTATGCTTAATAAGCTGTTTGATTGTATTTTGCAGATTCTCTTAATGGCTTTAATGTTA
AGAATTAAAGATTGTCAGCAAATGTTTATACTGCTTGTGCTAGAAGTCATTCCCTAGTTA
CACTGCTTTCTGTGAATTTCTGTATATGCTTCTTTGCTCTGTTCTAGTACATAGAATACG
GACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGTTCAATCACCACCCCTGGAAGTA
TTGCACTTGCCCAGGCTCAGGCCCAGGCCCAGGTTCCAGCAAAGGCTCCTCTTGCTGGCC
AAGTCAGCACTATAGTAACCACCTCAACCACCACCACTGTTGCAAAAACCATCACGATCA
CTCGACCAACTGGAGTCAGCTTCAAGAAAGATGTGCCGGTAAGCATCCTGTGACCCAGGG
CCCTAGCTGGAGAAGTAAAGGAGTTAAGCTGCGGATACAGATTGAGGATGTGAGAATAGA
GGCCTGCTAAATTTCTGTACTGACAGTTTTTAAGCTGTAACCCTATTACTTCATGTTTTT
ATCTAATCCATAAGATCCATGCCTTTTTTCATTATGAAGCTGTGGAATTACTATGGTGTT
ATAGGAGGGCCTTTCTTTTAGGTTTTAAATGTTAACATGACTACAGAATTAGGTGTTTAT
GTTTAATTCTAAACTTGAGTTAGGATTACTGTAGCAGACTATCTCTTGGGGCATACCAGA
TGCTGAAGCCCTTAAATTCAGACCTTCAGCTGTAGGGGCACAGGTCCCATTTCATTGGCT
TATTCTGTTGTCATGCTGTCGATTTGTCTCAGATGAAGCTGTCGAATTATCTCCAGTTTA
GTGTTGAGGTGCTTTTGGAGACTTAATGTTGTACCAAGGGCTGCTCACTGCTGCACTGTT
GCTTCTCCAGGCTAATGCTGTGTACTAGCTGTTAGTTAATGGACATATGAATGCAAATGT
GAGGGGATGGTTTCTGTACAGTAGCATTCTTTTGCTCGGTATTGACCACTGTTTGTAGTG
TGAAATCTCTTCCCTTGAGCACTGGTAGAAGTGCATCAGTGGCAGTAGTTGTGATCTCAT
AAAGCTCGGTTCTTTTTAGCTTGACAAAATGAATTTATTTGGTTATTGCCCTTAGGTGTA
TGATCTGTTCTTAACTACTTGGTCTCCCTACAGCCTTCCATTAATACTACCAACATTGAT
ACACTGTTAGTAGCAACGGATCAAACTGAGAGAATTGTGGAACCTCCAGAGAACGTCCAG
GAAAAAATTGCTTTCATCTTCAATAATCTGTCTCAGTCAAACATGACACAGAAGGCAAGT
ATGAAAGAACACCAGTAAAGTGATTTTTAACTATTTCTAAAATTGCATTCTAAATTGGTA
AGTGATGGTGTATCTACAAACAGTGCTAACTGGTAAAATAAAAAATGGAGAGGGAAAAAC
ATTCTCTAAGGAAATAGCAGTTTCCATCACTTGCTGCTTGAACCTTCAGAGAGATGAGTT
TTCAGGGAGTAGAGAGAAGTGAAAGATAGCTATCCTTAATCTTGCTTTTTCCTACAAATT
GCTTTATTTCACGATAGCCAAATCCCTTGTGCTCAAGTGTTGTAGATCTGTCTTCAGGAG
AGCACTTGTACTAGATACATGGAATAATTGTACTTTGTGATGTTTTTGTCACTTGTAGGG
ATTGTAAAATACTATTTCAAATTTGTGTTGATATTTTTCATAGACTTGTGCAGACATTCA
CGTAAGTGGGCTGGGTACCATTTGGTACTGCATGGTTCAGTTGCTAGGCTCTTGCATTTC
TATCTGAAGTTATGTTAGCTTTTCTGAGCTAGTAGAAATCTGCTGCCACCTGCAATTTCT
GTCTTGTGGATAGACTGCTTTACCACAAGGTGCTGACAGTCCTGGGTGTTTTGAAGGTAC
ATGTTTAGAAAGCTGAGAAGTGGAGAGAAAATATTGTGCCTCACTCATTTTCTCATTTAA
ATCCTTGTTGGCTGACCAGATCTTTAGATAGAGAAATCCACTGATTTCAGAGCCATTTAA
AAACAAAACCACCAACCATAGTGCTAAAAGCAGTTGCGTTTGTGGTTGTTGTCTTATGTT
CTTTTTTGTGGTGTGCTTTTTCTTTCCTATGGATACAGGTTGAAGAACTGAAGGAAACAG
TGAAAGAAGAGTTCATGCCTTGGGTATCGCAGTATCTCGTGATGAAGAGAGTCAGCATTG
AGCCAAATTTTCACAGCTTATATTCAAACTTCCTTGACACCCTTAAGAATCCAGAGTTTA
ATAAAATGGTTCTGAATGAAACTTACAGAAATATCAAGGTGAGTAGCACAAGTTCTAATA
CTTGGGTAGGTTTCAAGATTTAGAGGTGTGATGTGCTCAGGCCATTTGCTTCCTCTGCTG
CTGATCTTCAAGAAATGGAGTATATGGGAAAAGTCTACTTCAGCTTAAGCTAACAGCTTA
CTGTATGAATACTGGGATTCTTCTGTTTTCAGTCAGAAATAATTAAGAGGGTACATCTGC
ATTTAAATTCTTTTTTTTTAGATTCTAAACCTGTGTGAGGCCTGCAAATTACAGCAGGGA
AAATTTCTTTGTGGTCTAGTTAGTTTGGGTGGGGGAGTATCAGGATGAGAACCACACTGC
TGTTTCAGTCAAAGAATAAAGAGGATAGGGAGCTAGAGAAAGCAGAGGTGTAACAACTAA
AAATCATTGTAGAACTAAATGAACATGAATGTGAAGAAATAGCCCTGATGATGTGTGAGT
GAGTCAAGTTTGTCAAGGAAGCACTATTTTTAAACCTGTTGGTGGATTTTCCTGGCCATC
ATGGGTTACGCTGTAGTGCAAAAGAATCTCCTGGCTCTTCAGAGTATAGTTGGCCTTCTG
TTTGGCTGATGCTGCTCTGAAGCTAAGGGACAGAGCTAATAGTAGAATGCTGGAGCATGC
TTTAGGTCTTGAAGTAGGAATTAAATCATTTCCCAGGAAATGCCTTCAGGTCTGCAATGA
AAGTGTTAAGAAGCATTGCCTTCCCAAGTTACATTTTGCTGGGTAGTTGTAGCAGCCTTA
GCAGTAACTGGGAAGCTCTGGAATGGCGTAATCCTTTCTGATCCTCTTCAAGTAAAGGAA
TTTTGAAGTCATTACAAGGCAGATTGGTGGGGTGCTATCTTGAGGTAAAGACTGCTCTTG
ACTATCTCTGTAATGGGACTGGAGCTCAGAACTTAGCATTCTAAAGCTTTGCTTTGGGTC
AGAGCAGCTGTTTGATTTGGTGTTGAGTCTGATTATCTTCCAGTTGTTGCTTGAGTTGTT
TTTTTCATTAGGTGCTACTGACATCAGATAAGGCTGCAGCCAACTTCTCCGACCGTTCCT
TGTTAAAGAACCTTGGTCACTGGCTGGGAATGATTACCCTGGCTAAAAATAAACCCATCT
TGCACACGGTAAGCTTCTGTCTTCACAGACTTGCTTGATGCAAACTGCTGTGGTGTTATT
CAGCAGCATAGGCTGTTTTGGAAATGCTATCACCAAAATGAAGGAGGTAATCTTACATCA
AAATGTCTATCTGTGAATCTCTGTTCAAACGGAAGATCACTCTTTAGCAATCTGTAAAAT
TCAAGGACTGTCTTGACTTCAATTTTGCCACTATATCCTATAAGAAAATAATATGTAAAT
GGAATTTCTGCAGTGTTCTTAATGTTTCTCTCTGCCTTCCTATCCTTTTTAATGGTTGAT
GGTGTTTTTCAGGATTTGGATGTGAAGTCACTACTACTGGAAGCGTATGTGAAGGGACAG
CAGGAATTGCTTTATGTAGTACCATTTGTTGCCAAAGTCTTAGAATCCAGTGTCAGGAGT
GTGGTAAGTGACTATGCTGGGGCTTATTGCTCAAGTGGCAATACAAGCATTGCAGAAATT
AAGTAGTGCTTCTCATTAAACCAGATTAATTTCATGTGCAGTGGGGTGTTAAGCGATATC
AGGGCTTAAAGTGAGTTCCATTTTGAGGGAAAGGATGTGTCTTGTCTGTTTTTTTGGTGG
TTTTGGGGGGATTTTTTTCAGCCTGAACAGAGTCTGTTGGCTGAACTGTACTGTAGTATC
CCCAGACACAGACCTCTGTTGAGAAACGAAAGGATGTCACTGAAGGGATTCTATGATCTG
TTTCTCATTTGGGTGGATTTATTTCCTTCCACCCTCAACATGCCTCTTTTGTCTCTGAGC
TCTTTATAGTTCTGCTTGCCTGAACAGCTGATCTCTCAGAAGGACCTAGTCATTGTGTTT
CCAGTTCAGTGTTCAGCTTGCTTGTTCATCTGGTTCCTCTCAATGCTAAAAGCAGCTCTG
CCTGCAACTGTGCAAATTTCAGTTTCCCATGTCTGTATGTGCACATAATGGTTCAGTTTC
AAAACGTAACAGTCTTAAGTTAACTAAACCATTCCAGAACATTGTGTAATGCTGCTCTCC
ATTTTCTCTTGCAGGTCTTCAGGCCTCCAAACCCATGGACAATGGCCATTATGAATGTTT
TAGCTGAGCTGCATCAAGAACATGATCTAAAAGTAAATTTTCTGCTTTGTTTGTACCTAT
TGAGCTTGAGGTTTTCTTGACACACCAGTCAGAAAGGTGTTGTGAAGGACCAAATTTCAT
TTCTCGCTTTATCGTGTGAGGAACTGGGCATTGCTAGCTTAGTAAGAACATGGATGAATC
TTGATTTCTGTGAGATAATGTGCAAGTTGTTTGTCTAATCATCACTTGTTTATGTGTGTC
TTCAAAAAAAAACAAACCAAAGAAAACATGAGACAAAGCTTGGGATTTGAGCAGCCAGTA
AATGTTTGGGGCTTTTTCCTCGTGACATAACCTAAACTAAAATTGTTGTGCAGTTGAATC
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAAC
CTGGCAGTCTCCTGAAAGATAAGGATCGTCTGAAAAATCTGGATGAGCAGCTGTCTGCTC
CAAAGAAGGATGTGAAGCAGCCAGAAGAGCTACCACCCATCACAACAACCAGTAAGTATG
CTTCAGATCCAACTCAGAACAGTGCTGTATGAAGTTTATTAAGACAGGCTATGCTATTGC
AGAGAAGAGTGTGAAGCCACCTGCACTGCTCTAACATTACTAAAAGCTTAGAACCACTAG
AATAGTTTTGTAATGAAAGGATGTTAACAGAATTAGGAAGATGGGAGAGGAGTGGAAGCT
CTCCTGAGGACTTAATTCTGCACGTGCTGCATGTAACTGCTCTTTAGAAGAGAGTGAATC
TGAGAGATAAGTGAGATTGTAGCAGGATTCAAACCCCACTGTAACAAACAACTGCCGAAA
TGCACTGAAGATAAAATGGTGCCAGACACTGTAGAGGTAGAAAAAATGCTAGGTACCTGT
AGGAAGTGTTATGATCAGAATTTTATCACTTACTAGTTTAAATGATGTACGTGCTCTGCT
TTATAAAAACTTGTTTTTTCCCTAATATTGCAAAATAAACATTTTTCTATTCTTACAGCC
GCTTCTACAACTCCAGCTACCAGCACCACTTGTACAGCCACAGTTCCTCCACAGCCCCAG
TACAGTTATCATGACATCAATGTCTATTCATTAGGAGGACTGGCTCCACACATTACCTTA
AATCCAACGGTAAGTACTGATTTGGTTTGCTAAAAGCATTCCTACCACTGACACTGCCAC
AGATCTTAGCTCGTGGGGTTCGGCATTTTAGAATTTGAAGCTCTTCTTGGAGAGTCACTC
CTCAAAAGTAGCGGGGAGGGTGAGTGCTAACAAATAGCCAGAGGGAGAATTTGGGAAGTT
ACTAGTGATTATATCAGCTAGCAGGCTCTCAAATCATCTTGCACTGTAGCACGTGCATTA
ATATCTACATTAATTCAGGCAATAGGTGTCAGCTGGGACAGTTGCCAGGGCTTTCTTGCT
CCTTCTGACCAGTCAGTGACTTGCTCTTAATTCAGTCCTTGCTCTGTGATCAGCTGCAAC
TTTGGAAGAAACCTGTCCCATGCATCTGTTTCAGAATGATCAAATAGATGCTGTAATACC
TTCATGAGAAACACTGTATGCAAGCTGTGAGGGCATACTTAAAAATGTTTGGAAAATGTG
AATGCCTAGGGTAGATGGAACCAGTAATAAGCCAGAATACTAACATAACTTTCCTAATGC
TCCTCCAGATCCCGCTGTTTCAGGCCCACCCCCAGCTGAAGCAGTGTGTGCGGCAGGCTA
TAGAGCGAGCGGTGCAGGAGCTCGTCCATCCCGTGGTCGATCGGTCCATTAAGATTGCCA
TGACTACTTGTGAGCAGATAGTCAGGAAGGACTTTGCACTGGATTCGGAGGAGTCACGAA
TGCGTGTGGCTGCACACCATATGATGCGGAACTTGACTGCTGGGATGGCCATGATCACCT
GCAGGGAACCTTTGCTCATGAGCATAGCTACCAACTTGAAGAACAGTTTTGCTACTGCGC
TGAGGGTAAGAGTTGCATCATCAGAAACTTCTTTCTGACTTCACAAATATCTAGCTCTAC
ACGGTAGACATTATTAATACTGCACAGGTTACACAGCTTATCCAGTGCGGAGATGAACTG
TGCTGAAATAACAGCTCACGTTGTGTAGCCTTAAGCCTGTAAGGTGGGCATGGCTACATT
GCGCTTGAGCTTCCTGAGCTGTTTGTCCCTGTGTGCTGTCGAGTTTGATCACATCATGGA
AGCTTTGGAGTGCTTATCTGTCTGTGGCTTTTCAGGTAGATAAGCAAGGGTGGGCAGGAT
TGAATTGGTTCTGGGATTTTCTGGTGATAGATTATCACAGTATGCATGTAAGCTTTGGGC
GGATTTCATTCAGTCGTGGTGTTAGCAGATAAGTAGTTAAGACTTCTGAACAGCTTTTCC
ACTCGCTGGCTTCTTTAGAGGATATTTTAAAGTCTTTTTTTCTAACAAGCAAAGTTTGAG
CTTCAAGTCCTAGTTTTTCCCTCTTGGCTAAATGTAATACAGTTCATGAACTGCTAGTCA
GAACAGCAGCTGCTACCCAGAAGTCTTGCTGTGCTTGCCATTGGTGTTGCAAGAGGCACA
GATCTCGGAAAGATTGAGACATTTTATTACCTGGAAGGTTAGCAAGGTTGAAAAGCTACC
TACCTCTTAATGGCATGTTGCTATTGCCTATCTGGTAGGGAGTGGCACTGTGAAGGCTGT
TTTGCAATACAGTTGCTCTCTGCTCAAGGGGGCAGATTGTAAAGGTCTGAAGGGAATACA
AAGCCTTAGTAAGGCTCCCATGCCCAGGTATGGGCTGAATGATTTGTGATGTAACTTACA
TGCTTCAAGCCATGTGGACCCTCTGTTCAGACCTTCAAGTAACCTGATTGCCAAGATCAG
AAGCTGGTTGCTTTCTCTGCAGTAGCAAGTCTGGGCTTACAGATGGTGTAGCAGAAATGT
ATGAGTCCTGTCCCATCAATCTTAAATACAAGCTAAGGATGGGAGTAAACAGTACTGCTT
TGTTAAAGTGGGAACTTAGCCCGTGATTGCTGTTAGCACCTTTTGCTTATTCCTCAGAGC
TTGGGTGTCAAGGTAGTAACCATAAAAAAGCAAAGAAACAAAAAACCACTAAACCTCTGT
CAAGAGAGGGACAAATACTTTTGCTGTGACTCACTGGATGTGACTGCAGTTCAGACAGGG
AAGCAGCTGAAGGAATGCTTGTTATCTCTTGGGTGGCATGAGATGGCGGAGATGAGGCAG
GGTGAATGCAAGCCAGTGGTGTTACAGCTGTATCTGCCAGGTTCCTACATGCATAGGAAG
AAGTAATTTATGCTTTATGAAAGACTTCGTGCTAATATATTCTGTATTTGCAAAATGTCA
TGAATTTATTGATGTAGGTTCAATGGTAATCCAGGGAAGCTTTTTGATGGCATAATTGCA
CAATGTTGTGCTGCAGGAGATGCTGCTGCACAGGATGTTTCCAAAATCTGCCTTACTAAT
GAAGTGGGTTAACAAGGCAAGGGTTTGTTTTGTCTGAAAGAAGCAGTATAATTTTCAGAG
AATTAGGGAATTCAGAGAAGTAGGGGTAGAACTTAATGGGCAAAGAAGCCCAAGGAGATT
GAACTGTTTGCCTTTATATGCCTATTCCAGTGGAATAGGCTGCTTTTCACCCTGGTACGG
AGGTCCCTCTGTTCGGTTTTCTCTTAAAGCAGACTCTGAAGGGAAGGAAAAAAAACTGTA
TGAGAAAGGGAAACCACTGCAGAAATGCTTAGCACCTCAGCTTTGCATTGAGTGAGGCAC
TCATTTCTGATTGCAGCCTAGGTGGTGGAAAAACCCTCAAGCCATGACAGATGGGTTTCT
TTTCCTTCATTAGCATCTATTGTGAGTTCAGTTGTGCTCTAGAGATAAGCTGAGGGGGGG
AAGGAGGGAAATGTCCTGCTGTTCTGTTCCTTGTTGAAAGTTTTTACTGTCTTCTTGCTT
ATGTTTTATTCAAAGCTGTGCAAAAAGTAAATTTATTATTGTGTATTCTATGCAAAGACT
GTGCATTCCTAAGAAGATTTCTTTATTATTGCTGGTGTTGAGTACAGCAGTGTGGCTATA
TTCAAGGAAAGTGCCTTCACCGATTGTCCTGGTTTTCAATAGGCAGCCTCCCCACAACAG
AGGGACATGATGGAGCAAGCAGCTGCCCAGCTGGCGCAGGATAACTGTGAGCTGGCGTGC
TGCTTTATCCAGAAGACAGCTGTGGAAAAAGCAGGCCCTGAAATGGACAAGAGGCTGGCG
ACTGTAAGTATGGGACTGCTGCCTCTTCAAAGGTTTGTGTTCTCGTATACATCCAGACTC
TGCATCTAAGATGCGATGTATTTTGGCTCTGTTCACCAGGAATTTGAGCTCAGAAAACAT
GCTAGACAAGAGGGTCGTCGGTACTGTGATCCTGTTGTGTTAACTTACCAAGCTGAACGG
ATGCCAGAACAGATCAGGTTAAAGGTGAGGGTATTAAGTGAGCTATTTTCTGATGCTATG
CTTCCCCTTCTAATAACGAAGAGAGCCACACTGCTTCAAGTAACCAGTTCTGCATGTTGT
TAGTCATGTCTTACATTGAAACTGCTATTAGCTTGATTGGCAACGGAAACACATTAATAC
GTTGTTTCAGAATGTATTCATATCATTTTCTTCAACTGCTTGAGGAATTTAAGTTCTTTC
TCTTGTTCTCCTCTGCTCTACCTTTCCCTAAAAGAAAAGTCTGTTGCATTGTTTCACATT
CATCCCTTTAAAAGGCATTCTCTTGTGCCTCTGAGAAGCATAGGGCCGGTATTCAATTCT
TTGAGTAAGTTGCTGTGATCCAGCTAAATCCTCATGTTAGGAGGTCTGGCAGGAAGGATA
TGGCCTCAGCACAGAGCAGCAGAATCTTACTTCTTAATATTAGGTCACTCTGTGTATGAA
AGTGAGTGAGCAGCTACCTGTCATACAAACTGCCCTCATTCCTTGCTGCCATGGTGCAGT
TGATGGAAGTGGCCCAAACTACAAAGCAGTGATTGACCGTGCTCACGGAGGTCCCAATTT
CATGATGCATTCTGGAATTCCCCTAGCCTCTGAGTATGATGATCCACCAGGTCTGAGGGA
GAAGGCAGAATACATGCTGAGGGAGTGGGTTAATGCATTTTCTTCTTTATTGCAAAGGTT
GGAGGTGTGGACCCAAAACAGCTGGCTGTTTACGAAGAGTTCGCACGTAACGTCCCCGGC
TTCTTGCCTACCAATGACTTAACTCAGCCTACAGGATTCTTGGCTCAACCTATGAAGGTA
GAGATTTCTAATTGTCTTAAGTAGCCCTTTTGAGTGTTGCAGTGCTTGTGTCCTCTGATG
GAAGGCTAGTAAGAATCAGACATTTGTATTGCTTGGGAATACCGATTGAAAGGTTCATCT
TAAATTGTCTTAAAGTCCAACTGATGGCAACATGAAGCTATTCTTGAAGGCAGTTTGAGG
TTTTTGTAGCATAGATTGGAGCCAGATGTACGAATTAGGATTACTACGTGTATTCTTAAT
AGCACTGAAAAGGTTACTTTTGGGGAAGGTTGTGTATAGCAAGCACTCATTTTGAGATAA
TGAATGGGTTCTTGAATGCATTCTTCATCTTAAGGACTGCTAAAATTGTTGCTAGTTATT
TTTACAGCTCAATGTGATCATATTTGTGTGTTTGAAATGCAGTTAAAATTAATGAAACTA
CTGTAGAGGACTACGTTCTGGGTGCTATGAGTTCTGAAGCAGAAGAACCAATCAGTATGA
CTTTCACAGATGTGGTCCTTGTGAAAAATGACTAATTCCCACTTTCTCTTAAGCAGCAAG
CTTGGGCCACAGATGATGTAGCACAAATCTATGACAAATGCATGACAGAACTGGAGCAGC
ACCTACAGTCCATTCCCCATACTCTGGCCATGAATCCTCAAGCTCAAGCATTACGCAGCC
TCCTGGAGGCTGTGGTGGTCGCTCGGAACTCCCGTGATGCCATCGCTGCGCTTGGACTGC
TGCAGAAGGTGTTAACAATTCTGCCCCAACTGGCCTCAAGTTTATTGCTTGTTAGGCTTG
TCAGTTGTCTTGTGGTGACTTCATATCTTCGTGCATCCTGTGGAGCTTGCTTGGTGAATG
ATACTGAACAAGTGCTGTCTTTGGAGATGTAGTAAATAACGCTGGAGAAGGGCTCTGTTC
GCTTGGTATGGTGCATGCTGTGGTTGGGCTGCTGCAGGAAGAAGTGGGTAGAGAAGTAGA
GAGCTGTTGCAACTGGGAGTAGTTGCTGATTTGAAGATGGTTTGGAGGCTAGTAAGACGT
TTGAACTGCCCTTGTAAATGGGTGGCACTGGGCTTTGTGCTGAATTTACAGCAGCACAGA
TTTGCTTCGTTTTTAGTGGTAACTGACAAATACGCCCTCATCTGCCCATTCACTCCCCTC
TCCTGCGGGACAGGGGGAAGATAGAAGGCAAAATGCAGTGAGATGATGACGACTTAACGA
GAAGGAAAAGCTGTGTGCACAAACAAAGCAAAAATGAAAAAACTAAAACTAAATAGAACT
GCATCCCATCAGCAGGCAGATGGTGAGCCGCTTCCTGGAAATGAGCCTCAGCGAGCATAA
CAGCAGCTTGGGAAGACAAACATCACAGTGACTGCCTTCCCCTAATCATCCTTTCCCTAA
GCTTTTAGCGCAGAGCATGATGTCACACAGCATGGAATATTCCTGTGATCACTTTGTGCC
AGCTGTGCTGGCCCTGCACCCTCCCGGTCTGTTGTGTACTACCAGCCTTCTCACTGTGGG
GGAGGCAGAATGGGACAGAGAAAACCTTAAAGCATTGTACAGACTGTTCAGCAGCTGCCC
AGATATTGTTGTCAACACTGTTTCAGCAGCAAATCTTTAAACTTAGCATCATATGAGCTG
CTATGAAGAGAATTAACCCTATCGCAGCCACACCTAGTGAGCTGTACCAGGTTGGGAGTG
TTGTGGTGAGCTCTGTGACGTGAGCTGGCATCATTGCCTGTGTAGTAACTTCCATTTCAT
ACGGATTACTACAGACTCATCGGAGTGCAGCAGCTCCTTGCCTAAAGAATCTGGAAGGTG
TTCTCTATCAGGCTATGCACATCTTCCATCACATGGTTTCCCATGCAACATAACACTGAA
TTGCTTCTTAGGAGGCTTTGACTTGTGCAGAAGCTGTAGCAGAAACTGACAGTGACTAAA
CTAGTTATTTGCATGACTGCTGAATCTGCTGAGTGGTCACTGCAGCTATGTGGTTTATGT
AAGATTTGGAAGAGGGCTTGTTTTTTCCTCTGCTAACAGGTTGCATCTATTCTAGGCTGT
AGAGGGCTTACTGGATGCCACCAGTGGGGCAGATGCTGACCTTCTGCTTCGCTATCGTGA
GTGTCACCTGCTGGTGCTGAAGGCTCTGCAGGACGGCCGTGCGTATGGATCTCCGTGGTG
TAACAAGCAGATTACCAGGTCAGTTGTGACACAGCAGGGGTATGGTGTAGCCTTTCCCAT
CTTTTGGGAGTTACTGTTATTCTGAATCTCTTGCTTGTTAGTGCTTTCATTTGCCTCAAT
TTCAGCACAAAAAAAAGTCTTTTTTGATGTTAAAAGTCACTAGAGCTTCTGTTAATACAG
ATTCATCCTAGAACGTGATAGGAATCTGTCATGCAGTGAAGCACTGGAGATGCTTCATTG
GAGATGCTCTGCTTTTTCCCATTTTGTAGAGACTCCACATGCTGTCACAAATGAGGTGAC
ATAGTATATGCCTGCAGCAGAAGCACTTGTGCTTCAGCTAGACAGCTATGCCACTTTGTG
CTCAGAAGAGGGGCTTTTCGTGTTGAATAAACTGAAGCTCTTGCTGGGCTGTTGTGGCCA
GTAGTGCAGGGCAACAAATGCTTGACCCAAAGCACTACCTCCCAGAATGCTCCAGAAGAG
ACTTCTTCTGGGGCAAGTAATGAGTTGCAGTGGATTGCAGGGGCTCTCCAATATTTATTA
GAGTTGATCTGCTTCACTTAAACTGTGTAGTTTAAGTACACTTCTGAAAAGAAATGGAAT
TCTTTTAGGTGCCTGATTGAGTGTAGAGATGAGTACAAGTACAACGTGGAAGCTGTGGAG
CTGCTAATCCGCAATCACCTGGTTAACATGCAGCAGTATGATCTTCACCTGGCACAGGTA
AAGAGAACCTGCTTTTTTGGAGGGGGAAGTTACAGTCAGCCTTAAGAGCAGTGCTCAGCC
GTAAGGCGAATGGTTGAACTTCATGATCATAGTGCCTTTTTAATTTTGGCAGTCAATGGA
GAACGGCTTGAACTATATGGCTGTGGCATTTGCCATGCAGTTGGTAAAGATCCTTCTTGT
GGATGAGAGAAGTGTTGCCCATGTAACAGAGGCAGATCTGTTCCACACCATCGAGACGCT
CATGAGGATTAATGCTCATTCCAGAGGGAATGCCCCAGAAGGGTGAGCCTGAAATACCAT
GCAGTATATTATTTCTGTTGTGCTCATTTATCATTTGAGATGTTACGTGGTTGGTGTTTC
TATATCGGTAAATCACAGAGCTTTAAACTTCTGTGGCTGCAATCCCATGTTAGTTTAAAG
TGTTGTTTTTATGTAATTGCTCTGATTTTTCTCAAAAGAGAGGCAGTTGCAGCATGACTT
CAAATTGAATGCTTGTGCAGCAAAATTAGTGTGCTGTGCTGCTAAGTACCATGGTACTGT
GAGATACCCCCTCGAATTCCTACTTTCTCAAATCTAGGCAGTGTTGTCACCTTGAATATT
TAACTCTCTTATATATTAATGTGTTAATCACAAGATATTAATCAAATTATACTAACTCCA
GTGCTTCAGCCTTCAACCTTTAGCATTGGCATATCAGAGTCTCAGCCCTTTAGGGCTTTC
CACGTCCCCAAAAGTAAAGCTGTTTGTAGTGCATGTGGTGCTTCCCTGCAATACATTGTT
TCATGGATTGGTGTAACCTCAGAGTTTGCATGATGTCAGTGTTCTTTGCTTTTTGTCTTT
CCTCATAAATGCATCTGCTTTCAGGACTTATTACTGCTGGTGAAGAAGATAAAAAGATTG
TATGTACGTGGAATTGGCTTTCTTTTAACTATATTTGTGGAGCTTCCAGTTCGCATACCT
TCTTGGGGTTGGGAGAAAGAAATCTAACCCAGCTCTTGCTCTCATCTGTTGCATTAGGTT
ACCCCAGTTGATGGAAGTGGTCCGATCAAACTACGAAGCAATGATTGACCGTGCTCACGG
AGGTCCCAATTTCATGATGCATTCTGGAATTTCCCAAGCCTCTGAGTATGATGATCCACC
AGGTCTGAGGGAGAAGGCAGAATACCTGCTGAGGGAGTGGGTCAACCTCTACCATTCTGC
TGCAGCGGGCCGCGACAGTACCAAAGCGTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTT
GGAAAGAAAGGTGCTTTTTATTCAACATAAGTAGGGTGTGATGCCCTCCATTTTAAAGCA
GTTATAATCAATGTTAGACATCTTCTTTGAAACTTGTAGGTGTATGACAGTTTTGTCAAA
ATTCTGCCTTCCTTTGAAGTTTTGTAGAAATCTCTGTCCTTTGGCTGATGGTGTTCTTCA
CATATTCTAGTGCTAAGCTGTCCATTCAGACCCAGGGTTTTGATACAAGTCCAGTGGGGT
AAGAAATTCTAGTGAGGTAGCTGTTGGCAGTAGTTCTTGCATACTCTCTAATGAAGCTTG
ACTAGTGTTGCTCCTTGTAAGTAGCAGTAAAAGCTCTTGACAGTCAACGGAATAAATTAC
CTGTAGAGATGCAGCTGAATTGCTCACATGATCTGAAACAAGGACATCTTTTCTAACTGG
AATCATTAGGGAGGAGAAATGTGAAACTTCATTAGCTAAGGTGGAATCCAAATCTAAACA
GCCAACCCCTTCAGCAGTTCACTCTGGGGCATCCTGATAGATGGGATGAGCTGTGCATTT
AGATGTGACTAAGAGGAGATGCACTCAGTAAACCAAAATGTAGGGCTACAACTCCCTGTG
CACCTGCAGTCATTATCCTAAAACTGTATTCCTAGTCACTGCGTGAGTGCAGCCACAAGG
AAGCCCCTGATCTGTTGGTGTTTTATTTTTAAAATTGAGTGCTAATATTACAGAAATTTT
TTTTTTTTGCTGCCAGTCTTAGCAGTTCAAGCTTGGAAATATGCATAAAGACCTTGACTG
CTGCAGTGTTTTTTTTTCTTAGTTGCCTTACATGGCTTGTAGCCACCTTTGTTACTCTGG
TTTCATGCTGCAGAACACCTCTAAATGTTTTGTGTTAAACTGGCTTCTTTAAAAAGAGAT
TTTACCCCTTAGTCCCATCTCATGTGGCCCTGTTTTATACCATAACAGTATACTTATGCA
CTATACTGTACTACAGCGTACTTCTAATTCTCAGTGCACTTCTGTCATTCTTCCCTGTTT
GATAACACTTGTTTGCTTACCTGTTAAATATTTGATCAGATATGAAATAGCAATCTAAAT
ACATGGAACTGGAGATTCGTACATATTTTTTTCCTTCCAGGCATCAGATGTGGTTTTAAA
AGAAGTATTTTGTAATAAATGCATTAAAGTTTTGATTTAAATTACCTTAATCTGGTTACT
TGGAGAGATGAGGCTTCCTTTGCATTAGGTGTCAGGGCAAGAAGAAGCGTACATCTATGA
AGGCAGATATGAATTTCCTTTTATTATAAAAAAAAAGAACTTTTCCAGAAGTGTTAGAAG
TTCTAAGATTGTGATTGTGCTGTTTTTCTAGCTTCATTATTGTGCAGTAGGAGTTCAGTC
AGTAAAGCATCTTACTTCTGAAAACATTGGGGTTCCCTTAAACTTTGGTTTAAGTTCGAT
TTCTTTAATACTGTGGGTAACAAAGAGGTCCCTTGATGTGTATATTATTAAATAATGATT
TCCCCAGAAGGAGGGAAAAACTGAAACCCACATCCAACCTATCTCTGCATGCTATGTTCC
TGTAAGGAAAGCTTGTTATGCACGTGCAGTTTGTACAGGGTATTGCCACAAAGTAGTGAC
AGTTCCTGAGCTGGTGGCTGAATTCTGCCCTTCCCACAGCTTGTGCTGCCCTACGTGGGC
TCTTGAAGGCCCAACAGACCAAGCTGCTGCTGCCTTTAGTGCCCTTCATGCAAGGTTGGG
TGCTGGTAGCAGAACTGATACGAAAAAGGCTTCTCAACTCTGCTGATGGTTGAAAGGTTT
TTAAGATGAAAGACTATGTGGGAGCAAATGACCTTAGTAAATTTTGGTGCCACCATCAAG
TTGCATTGAAAACGTTCACCTCAGGGGAGAATAGTGGAGGAATAATGCTTGTTAAAAGTG
TTTGAAATAAGTTGTAGGGTGAATTTCTTGTGTTTACAGTTCTGAGGGTTTTTCCTTCCC
ATGACAGATGCACCAGCAAGGGATCCTGAAAACAGATGACCTGATCACCCGCTTTTTCCG
GCTTTGCACTGAAATGTGTGTTGAAATCAGCTATCGTGCTCAGGCTGAGCAACAGCACAA
CCCTGCTGCCAACCCCACGATGATCCGGGCCAAGTGCTACCACAATCTGGATGCCTTTGT
GCGGCTTATTGCACTGCTTGTGAAGCACTCTGGAGAAGCAACCAACACCGTTACGAAGAT
CAACCTCCTGAACAAGGTTGTGAACTGTCTTTGTAGTCCTTGCACTTAACGTGATCAATG
GTGTGTGCTTTGACTGCCATACTTACATTGAGCTTAATGTGGGTTACCGCTAAACTATCA
GATGAGGACTTAAAGGTGTTGGTCATTGAACCAAGAAATTGAGTGGAATATCAGGGTACC
AATGGCCTTCTCTCAAAGATTTCTCTCTGACCTGCACAGTTATTCTTGCTGTCATCACTG
AATTACGTTGCTCTCTTTAGGTTCTTGGTATTGTGGTGGGAGTTCTTCTGCAAGACCATG
AAGTTCGGCAGGGTGAGTTTCAGCAGCTTCCTTACCATCGCATCTTCATCATGTTGCTGT
TGGAATTAAATGCTCCTGAGCATGTGTTGGAGACCATCAACTTCCAGACGCTCACAGCTT
TCTGGTACGTATTTGATCCCAGTGCTTATCCTTTCCTGATAGGATCACGATTTTAGTTTT
TTCATTTAAAGGCTTATCTGACTGTTCTGTGTAGTGGCTTAATCACATTCAGAGTAACTG
GTTCTCCTTAGACTGTCCACTTGCTTGTTTTAAGGAAGGTCACTGGTAAAATGATGCAGA
AATACCTTGCTTTTTAGGGCTGTGTATGTTTTCGCTCAATGTTATGAAAAGCAGTCTTAT
TGCTGTGCACTTCTAACCTGCTCTAACTTTTCTTTCAGTAACACATTTCACATCCTGAGG
CCTACAAAAGCTCCAGGTTTTGTTTATGCCTGGCTGGAACTGATCTCCCATCGGATATTT
ATTGCAAGAATGCTGGCACATACACCACAGCAGAAGGTGTGGCTGCAGTTCATCTTTTCT
GAAATAAAAGGCTCACCCAGAGGGATGCCTGGTGTGACGCTTTCACCTCTCCTGAAGTGC
ACTAGTAGCATGGCTGTCCTGTTTTTGTCTGCTGTATTCACAGTAACCTAACTGCATGGA
GGAGAAGCTTGATGTCAATCAGCTATTGAGTATAGGGTGGTTGAAATTTAACAAACTCAC
CTTTGCCAAAGTCTGGAAGAGCTGTAGCCTGGGCTGAATGCTGTCATCTCAGTACAGCGT
GTTGAGTGTTCAGGAAAAACCCATAAATTAAAGTGCACAGCTAAGCTTCTTGAAATGAGC
TGTGCTGCTGTCACTGCTAGAGCTAGTAATAGGACTTAAGTTGGGATCCAGGTTTATGTG
AATGCCTACCTAACTATGGCTTTGAACTAAAGGTTGCTGCCCTTCATTGTACACTTACCA
CTTGCTGTTTCGTTTCTTGGCAGGGTTGGCCTATGTATGCCCAGTTACTGATCGATCTTT
TCAAGTACTTGGCTCCTTTTCTCAGAAATGTGGAACTCACCAAACCTATGCAAATTCTTT
ACAAGGTAAATATGTATAGGTACATAATAGGTATTTCCAACTGAAACCTTCTGAAGTAGA
AATGGAGTGGAAAAATATATCCTGGTAGGGAAATAGTATTTACTGTTCTGTCAGGGTTTG
TTTTTTAGTTAGATGCATACTGGGTGAGGGATAGAAACAGGCTACCTTCCTAAATTGATT
TATTTCTGTTAATGCTAACCACACGACATAGAAGGGTGGTTTTGCAAGCTCTCAGGCGGT
TTCAGCAATTTGGAACTTCTTACATTGATATTAAAGCTACTGTATTTTGTTTTGCAGGGC
ACTCTGCGTGTGTTGCTGGTCTTGTTGCATGATTTCCCAGAATTTCTTTGTGACTACCAT
TATGGGTTCTGCGATGTCATCCCACCTAACTGTATTCAGTTAAGGAATTTGATCCTGAGT
GCCTTCCCACGGAACATGAGGCTTCCAGACCCTTTCACCCCCAATCTGAAGGTAGGACTT
CTTGCAGTTGAAAGCATAAAACTTGCCTCTGTTCTGGATTGGCTTTGCTAGCAACAAATC
TTTACCTTGCTTGCAAAACAGGGGCAGATTCAACCTGTAAGGACAGTCTGAGACTTTTAT
GACTTGAGAACTGCATCAATGAGAGCCTACATTTAGCATGGAAAGCCAGAGGGCTTTTCC
AAAGGGCAGCTGATGTTGTGGTGTCCTAGAACTGATCTGTGGTGTTGGAGCAAGGGCATC
TTTGTCATTTCACTAATTGCTCACTGACAGACTACCAAAGTAGTCTTTGTAGCTTTGTTT
GAAAGTTCAGCTAACAGCTGTTGTTAGAATTTTGTTCAGCACATGTTGAGCTGTGCAGAC
ATTTCATGCTCTGCAGGATGTGTGAGGACTCGAGTTCAGTTATGTGATTGTCAGAGAGCT
GGCATGTCAGAGCCCTAAATCAGAATTATTTTTCTTAATGAGAAGTGGACACTGTCCTGT
CTTAAAATAATGAGATAAATTAGCATTCTGAAGCCAGCCTCTTGCATAATGAGGACAGAC
TTTGAGAAGAGCTGATGTAATTAGATGCTTGGGTGTACACCAGTCTCCTAATCATGGAAA
GATTGTGGCTGCACGAGCTTTCTCACTGCTTTGACACTGATCTGCTTTTGTGGTTTGTTC
CTTGACCGATTGCTTGTGGTTTAGCTGACTGGGCTTTCTCTTAACAGGTGGACATGTTGA
GTGAAATTAATATTGCTCCACGAATTCTCACCAATTTCACGGGAGTGATGCCACCTCAGT
TCAAGAAAGACTTGGATTCCTATCTCAAAACCCGATCTCCAGTCACTTTTTTGTCTGACT
TGCGCAGCAACTTACAAGTGAGTGGTTTCTGAGGATGATGGATTTAAGAAGTGTTATGAG
ACATAATCTTGTTGGCTGAGTCACCTGCCTTCCTAGCGGGAATTATGTCAGTGTGTAGCA
ATCATGCGTTCCCAGCAGTAGAAAGGCCCCTGAAAATGCACTTCTCCAAGTACTTAACTC
CCCGGCTAGGGAGAAGAAATAAGTACTTCCATCAAAGAGGAACTTAGGTGGAAAGAGGAA
TGTTGGTTGACTTATTTTTTTAGCAACCCTGGACTGATTTTAATCTAAAAGCAGCTGATT
TTGTCTACCTGAGCTGACAAATGCTTTAAGTGACAAGTAAGGATATCTAAACCTTGGCCT
CTTCTGCTTGCATGTCTCTGGTACAGTATTGCAGACCACAGAGAGAATGTCATCAGAGTT
GGCTGTATCAAGCTCACTGTTGTCCCATACCAGATAAAGGAGTTCTGTGGCTTCCATCAC
ATGATTCCAGCACTATTTGCCCGGGCCTTTGTCTGATATTCAGTGTTTTGAGTATCAGTT
CAAATTTATTGAACTTGATTGCACGTTTTTTTTTTTTTTTAGAATCTAACCTTTAACTGC
AAGTGAATTCATAGTTGGTAGTTCTTGAAGTCTGTGGATCTGCATGCTAATGCTCTGGGG
GAAAGAGTGCACAGGGAGGGGAGGGCAGTTAGCCCTAAAGCCCAGTTCTGAGCTGTTAGC
CAGCTCTACTCATTGAGCACATCACATGGTATAGCTTACAGCGGGATTTAGGACTGAAGT
TGGACTTTCTCTGAGAATTGCTCCAATGTAAGCCTTCACACGAGTGCAGGCTGTTTCAGG
CAGCCCATGGCACAGCTGATGCATTCAGATTGCCTTTACCTGATGTTTTTTCTTCTTTCA
AGTAGGGAGTACAATAGTTGAACATCTTGTCTGTCAGCACTTTACTGGTGCTATGTAGAA
TACAGAATGCCTTGGATTGAAAGGGACCTTAAAGACCATCTAGTTCCAACTCCCGTCATG
GCAGGGACATCTCCCACCAGGGCAGGTGCCCATAGACCCATCCAGCCTGGACCTGAGTAC
CTCCAGGGATGGGGCAACCATTGCATTACAAATGCAATTTGGCGTTTACCCATTTGTGGA
CATTAAGTATGTTGCTTTCTGTATAAACAAAGAGAGATCTAGATGCTGTTGTTGTACATG
TTGTCCCTTAAATTACTGAAGGAACATAGAACGTTAATGCTTTTTATATCTTTCCTATTA
GGTATCAAATGAACCTGGCAACCGCTACAACATCCAGCTGATTAATGCCCTGGTGCTCTA
CGTAGGTACTCAGGCTATTGCGCACATCCACAACAAAGGCAGCACACCCTCCATGAGCAC
CATTACCCACTCAGCACACATGGACATCTTCCAGAATTTGGCAGTGGACCTGGACACCGA
AGGTGAGCTGGTTTGTCATACCTAACTTAAAGCAGATTGAGCTACAAGAAACGCAGATCG
TTCCATGCAGCTGATGGTGAATTCACAGTGAGTAGTGCTACGTTAAATACAGGAGCAATA
TTAAAACCAAATGCTCAAGGGAATGAGAAATCATTTCAATGAAGAATTATTATTACTGCC
CCACCAGCTAGAGTTGGTGAGGCTTTTGCATATCTTCAGTTTCTGTTTCTGGTACCTGGA
TTGGGGTGCACTTAAAAACCTTAATTTTAGGCAATACTATTGGTTTCTTTTTCCCTCTGG
CATTTGGAGCAGGGATCAGGATAGGTACTCACAACTCTTCTTCTGCAGGTCGGTACCTCT
TCCTGAATGCAATTGCCAATCAGCTGCGATACCCCAACAGTCATACCCACTACTTCAGCT
GCACCATGCTTTACCTGTTTGCAGAGGCCAACACTGAGGCTATCCAGGAGCAGATCACAA
GGTGAGAGGGAATGCATTTAACTTACCTGCATTTGGTTTCTTGCTTTCTTTCCTTGTTTT
TTTCAGACCTTTCTGTTCTGTTTTGTTCTTGGACTGCAGGGTTCTCTTGGAACGACTGAT
TGTAAATAGGCCTCATCCCTGGGGTCTCCTCATTACTTTCATCGAGCTGATAAAAAACCC
AGCATTTAAGTTCTGGAACCATGAATTTGTTCACTGCGCTCCAGAAATTGAGAAGTGAGT
ATGAGTATAACTTAGTAACGAAATCACTAAAGCAATATACTTGAAGCTGGTGCTGAGTTG
CACCTTGAGCTGTCCGTGTTTCACAGTAGAAGCAGCATTTCCTGCCATAAGAGGAGGAAA
CACAACCTGAGAGCAGAATGCAGAGTGGTTACTGGATGTCATAGCAGGCTGCTATGAGAG
ATGCTGACTTTTTTTTTCCCCGGTTCTCTGTGTGTGGCTGTTTGTTCCACAGCAAAACAT
TACATTGCAGAGGAGATCGTGGAGATGTTTTTTAAAAAGTAGTGGAGCTGGAAACAGAGC
TACCATCAGAATCATAGAATCCTAGCATGGCCTGGGTTGAAAAGGACCACAATGATCATC
GAGTTTCAACCCCCCTACTATATTCAGGGTCACCAACCAGCAGACCAGGCTGCCCAGAGC
CACATCCAGCCTGGCCTTCAATGCCTGCAGGGATGGGGCATCCACAGCCTCCTTGGGCAA
CCTGTTCAGTGCGTCAGCACCCTCTGGGTGAAAAACCTTCTCTTCATATCCAACCTAAAC
CTCCCCTGTCTCAGTTTAAAACCATTCCCCTTTGTCCTATCACCACTCACCCTTGTAAAC
AGCCGTTCCCTCTCCTGTTTATACGCTCCCTTCAAGTACTGGAAGGTTGCACTTGAAGTC
TCCCCAGAGCCTTCTCTTCTCCAAGCTAAACAAGCCCAGTTCCCTCAGCCTTTCTTCATA
GGAGAATACAGTGCAGTACAGAGGGCTCAGAGCAGCCTGCTACACAGTGCATGTGCTGCT
CAAATGTTACTCTTCTACGTCCTTATGGGGACTGAGCTGAGTGTAGTGCATGTCTGTGAT
GTGGTAGCTCTGCAGACAATCAGATCCTGGCTCCTTTGCCCACAAGTTTGCTAATGCACA
TGTTTGCACCTGTGGTGCCATACACTGTGGTATATTGTGGTATATAGTGTATATATACAA
AGCACACTTAACAACTAATGCTGCTCTGCTTCTGTGTTCAGGTTGTTCCAGTCGGTTGCA
CAGTGCTGCATGGGGCAGAAGCAAGCCCAGCAAGTAATGGAGGGGACTGGTGCCAGTTAG
ATGAGCTGCATCTTGTGTTGTAAATGTGCCAGCCTGGAGGCCCCTGTCCCATCGACCGAC
AGAAGCATCTGTAAGGCTCCTCCTGACCTTCCCAGCTCCCTCGATTGGGTACACGCAACC
GACCTGGGGTGAAAGTCTGTGGGCACGTTCCAAAGTTTGAAACAAATTTGTGACTTTTGG
CCAAAATTCAGAAGATGCTGTGAATATCATTTTGAACTAGTGTAAATACAAGGAACAGAA
ACGTTTGTCTGGACTTCTGGGTTTGTGCAAAGTGTGTAAAAGGCAAGTGGGTAACTGGTG
CCTGTCCAGCTTGTAATAAAGGGGCAGCTGCTGATGCCAAGTGCTTGTCTGGGGCAGACC
TCCTTGTCCTGACATTGCCAGACTCCCAAAGAATATTGAAAAGCCAGTTATATTATTATG
TAACTTATTTTTTTCTTTATGTGGATGGGGGACCTTTAAATCACTAAGTTGTTTTACAGA
AAAAGAAAAGTGGATATGTTTGGAATATGGGAATACTATGGAGTAAGGGAGGGGAGGGCG
AGGGAGGGACTGAAGATTCAGCATTGTTTTCCCCTTTCCTCCCAGTGCTGACGGAGCCGT
GTGGCAGTCAGAACGCCTCCTTTCTGTGGGAGAAGACACGCCTCAGGCCCTTTGGGAGAG
GGTCAGCTGTTTTTAGTAAAGAAACCAGAGACCAGGCCTATAGCTTTTGTTTTTTTCTCC
TGACACTTGTAAATTTTGGAGAAGGGGGGACTAAATCCAGACCTTTCCCTACCCCGTGAC
AGTATAAGTTTGTAAAAAAAACAAAAAACAAAAACAAAACAAAAAAAAAAATCCAACAAA
ATCAAACAAAAAGAAACAAAAAGAAGAAATCAAAATTGAAAAAAAAAAAAGAAACAAAGG
ACCAATACAGCCCATTTTGTAAGGATTTTGAATGTTTTGTAAAGTATTGGTCCATGTGTT
GTATTTTGTAGCCTTTCTAGTTCTTGGGCTTTAGTTCTCCCACTTCTTGTATGTATGCAT
ACTGTAGTTACACATTAAAGTCATGACATGCAGCACGTGCCACTGTGCTTATTCTCTCCA
GTTCCATCCTACCTGGCCAGTCACTGTCTTTGAAAATCTGTTTCCAGCCATCCAAAATGT
GCAGTTTTCCGGTGTATTTTGGATGCTGCCTAGTGAGAACCGTTTGCTTCCAGCACTGAG
GTGAGAGAGAGGACTTGTTATGAACAGATGGAGGCTCGATTCTTAGTGCCAGAAGGAGGA
ACACAGAATAGTTACGTGGAGATGGAACTAGTGGAAGCTCCCAAGCAGAGTGCTAGAAAG
GAGACTGCAGCGGAGGGACGCAGAGCACAGGTAGCAGACCAGCTTTATTTCTAATGATGC
TCTCTGATATAACACTCCCGTCATCGAGTGTCTGTGCAAGCTTGCTGGTTTGCCCAGGTT
AACCTGTAGGGATGAATACTGCAAGCTCCTCTAGCCTTACAATGTAGAAGTAATAGGAAG
AGGGATTCACTGCAAGTTGAAACATTTTGGCTATGGAGCTGAAACTCCAGCTTGCTCTTT
CCTCTTGTAGTGGGTACAGAGAACTAACAGCAACTAGCATTATCCAGTCTGGATTTGGCA
GGGTTTTTCTGCCATTTAACTTCAGCAAGCCAAGCTCTGCATATGAGCTTGTTGACTTGT
CCTACTGGCTCCCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1194, 2676..2844, 3998..4124, 4408..4518, 6229..6399, 6551..6678, 8173..8413, 9161..9280, 10116..10238, 10478..10629, 14476..14626, 15552..15753, 16159..16305, 17366..17490, 18084..18370, 19257..19335, 20507..20737, 21513..21653, 22478..22657, 23651..23767, 24072..24182, 24794..24871, 24932..25000, 25916..26030, 26518..26648, 27188..27484, 29622..29762, 29859..29963, 30657..30776, 31316..31507, 32815..32957, 33548..33656, 33772..33941, 34677..34908, 36907..37155, 37400..37563, 37838..37955, 38423..38524, 38817..38990, 39707..39856, 41101..41281, 41628..41760, 41859..41993, 43001..43776
2786..2844, 3998..4124, 4408..4518, 6229..6399, 6551..6678, 8173..8413, 9161..9280, 10116..10238, 10478..10629, 14476..14626, 15552..15753, 16159..16305, 17366..17490, 18084..18370, 19257..19335, 20507..20737, 21513..21653, 22478..22657, 23651..23767, 24072..24182, 24794..24871, 24932..25000, 25916..26030, 26518..26648, 27188..27484, 29622..29762, 29859..29963, 30657..30776, 31316..31507, 32815..32957, 33548..33656, 33772..33941, 34677..34908, 36907..37155, 37400..37563, 37838..37955, 38423..38524, 38817..38990, 39707..39856, 41101..41281, 41628..41760, 41859..41993, 43001..43076
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved