Gallus_gallus Locus NP_001007480.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001007480.1
Gallus_gallus
NP_001007480.1
10
SNORD16, SNORD18, SNORD16, SNORD18, SNORD18
1911..2012, 2806..2877, 3303..3402, 4492..4559, 4807..4877
7321
CGAGAGACAGGGCACCCGTCAAAAACATCTTTTAGTCACTTCATCTCTGTGTTTCTCTC
GAGAGCTGCGTTTGCAGACACCGCATAACTCACAGCCGTGGCTGAGGGTGAAGGAATCCC
ACCGTTTGCCCGGCCGCCTCTCGCTGCCCCTCCTGAGGGGCGTTACCTGAGGCGCCTTTT
CCCGCCCACGCGCCGTTCCCGCCGCCCCCCCGAGCAACGCTCTGAGCACAGAATGGGGCC
GTCAGGCGTTATTCCCGCCCGCAGCTTTACCTCAAAGAGATACGGGCGTTCAGGAACGCT
TTTCTTCCCCTCTTCATATATTCTGCAAAAACAATGAATATTAAGGCGTAGCAGTTGCGT
TTTGTCGGTGCTTTTTTCCTCGCCGAACGCTCCTTTTTTCTGCGTAACCCCCAAAGCACC
GCTCCAAACGCAGACCCCCCTCAGCGCCGTGCCCACACGACCGAACCCCGCTCCCTCCGC
TGCCCCCGCCCCGCCCCGCACCGCAGCAGCGTGAGGTACAGCCCAACCGCCGCCTCGCGC
CGCCGCTCCGTGCCCATCGCCGCGCGCCTCCAGCGCTGCCGGAACTACATCCACCGATAG
GGGCGTAATCTTTTTCTTTTTTCTCAGTTTTTTCTTTTTTTCCCGCGCCTAGCAGTGGGT
TTTATTCGGTTTTATTCCCTCCGCGCTCAACCCCGTTAAAAAAAATAATAATAAATAAAT
AAATAAAAACTCTCTTAAAAACTTGATTTTGGTGACGGAACGGCCGTCACGCCGAATCCC
TCCGCCAGAAAAGAGTCCCTCAGAGCGGGGGGTGGCGGCGGCCCCACGGGGTGGGGAGGG
AGGGATTGAGGAGGGGAACGCGGAGCAGCGCAGCGCGGGTGCGGGGTGTGGGGGCTGCCG
AGGCGACGCGTGAGGGCGGCGGGGCGCGAGAGGGGCGGGACGGGGTGGGGCGCGGAGGGA
CACCACAGCGCTGGTAGCGGCAGCGCCGCGACGAGATCTTCCTTTTCCGGTTGGGCAGCG
GCGAGGCAGGCGGGAGCACGCGGGGTCCGCGCTGCCGTCATGGTGAGGCGCGGCCCGGTG
GGGCGCGGGGGGCACCAGGCGGTGCGGGCGTTGATCGGGACGCGGGGTAGAGCAGAGGCC
AGGGGAGCCGGGCCTGGCGGGCGGAGCAGCGCCGCGTGCAGCGCTGGGGCAGCGGGTGCG
GGGGGGGGGGGCGTCCGCCATCTTGGGGCCGCGTGGAGCCGCTGAGCGGAGCCGGGAGGA
GGGGAGCGGCCTGAGGGGATCCCGGCGGGTCCGTTTTCGCGGTGTTCCCCAGTGCATCCC
CTAAGCCGAGCGACAGGAGCTGCACCGAGTTGAAAGAATGATTTCTTTAGCTGATGTTCC
TTATAGCTGTGGGGGTTTGATTGTTTTTTATTAACGTACCTGTTTTTATCCTGAAATAAA
CTAGAAAAGGCTTCGGTCTGATGCGCTTCAGATCGTGATCCAGTTCCTTCCACCGACCAT
GCGGTGTGCGTTTGTCTTTGGGCTTCACAGGCTGAGCTGAACTTGTGCGGGCCTCTGGGA
GCGGGGCGGCTGCAGTGCGGGGTTCTGAGGCACGCAGAGCTGCTCGGTGGGCACACTCAC
AGTGCACAGTGCACATTGGCTGTGATCATTGCAAGAATTAGAGTGGTTGGTTCTGGCAGG
CCAGCTTTTATTCATAACCCAAATCTCGAGGCTTTGAGAAACTGATAAACACAGATGGGT
TTTGTAGGGGTAGTTGTTCTTAGCAGCAGAAGGGCAGCTGTTTAGAAGGCCTGGAGCTGC
AGCTCTAGGCTAACCTTGTCCCTGTGTCTCTGCCATCTCCTGGACTCAAACCTTAGGTGT
AGCGTTCAGAACAAGGAACGTGCAGGGAGCTCCACTGTCAGTGTTGGATATTGCTGTGAT
GATGTAATTTGCGTCTTATCCAGTGTTCAGCGACAGTTGCCTGCTGTTACCATGTTGGCA
CTGTTGAGCTGCAGACACATTTAATTCTGAGCAATAGCAGAGGGGTTTGAATGATAGCAA
TTTAATTTACTGGTGCTTAAGAGCTTTTCCTTTTCTTTTTTAGGCTTGCGCTCGACCGTT
GATATCTGTCTACTCTGAAAAGGGGGAAGCATCCGGCAAGAATGTCACCCTGCCGGCGGT
GTTCAAGGCGCCCATTCGCCCTGATGTGGTGAACTTCGTTCACACCAACCTGCGCAAGAA
CAACAGGCAGCCCTATGCCGTCAGCGAGCTCGCAGGTATGGTTTGTCTCCAGAATGGATG
GAAATGCTGCGGTAGTTGTTTGTTTTAATGCAGCTGAGCTGAAAGGGAAAGAAATTCAGA
GTCGAAATAAGAGAAGCACCGTTCAGGTAGATTTTGAAGAGAGTGCAGGGAAACTATTCT
GATCCTGAGCAGTCTGATTTTAAGTTGTATGAAACGTAACCTTATCAGGCAAAAAACTTC
ACTGAAATGCTGCGTTTTTTTAGTCCCCTGCTCCATGCTGACTATGTAAGACTTTCATCT
TTGGCATTTACTTAAAATAAATCTATGCAAATGGCTGTTAGCTAGAGTTGCCTCAGAAGC
TAGTAGCTGCAAATATCTACTGCTTGCAAAGGAATTTGTGTGTGTGTTTTCAAATTTAAT
TCTGATGGCAATTCACAAACATCTTAATCTACTGAGAACAGCAGTGCCAATATAGATCTC
CATGTTAAAGATCAAATTGAGAAGTGTTGTGTTACCATACTTGATTCTGACCTAACTAGA
TTCTTAGTACTGTAAGAGCTGTTCTACCTGATCAGGATTTGTTTTGCTGAAATGATGAGA
TTCCACTTCAATGGTCCGTGTTTCTGAACCATATGATAACAGTGGAAGTTCTGATGCTTG
GTCCCAAGCTCAACATGTCTGTGGCTTTGGGGAAACAGCAGTGTTGTCACTCTCTGCATT
GAACTCTTCTCTTTTGCAGGTCATCAGACCAGTGCCGAGTCTTGGGGTACTGGGAGAGCT
GTTGCTCGTATTCCTCGAGTACGAGGTGGTGGAACTCACCGCTCTGGCCAGGGTGCCTTT
GGAAATGTATCCTTTGATATCTGTTGTTTGCATCAGGTGTAAATCTCAACTCATCCAGGG
CAAATTATTTTTAATTATCTTAATATGAAATTGAATCCTTGAGGTAATGGCCATCCAAAA
ACTCTGTGTCCAGATCACTTCTCTGCAAATTCAGACTTGCTTTAATGAACAGCATGATTT
CTTCTATCTTTTTTTCACTGCAGAAGCGGTGGGTATGTTGAGTCTCGTGATGCAAACTTG
TCTTGCCATGATGTCGTAATTTGCGTCTTACTCTGTGCTCAGTGACAGTTGCCTGCTGTC
AGTGAACTGGTACAGATGGTTGACGAACAGTTAATGCTGAGCAAGTGTTAAAGAGGCACA
TTGGAAAACGTAGTTCTGAAAGGTTGTTCTTAACTGTAGATACTTAGATGTGTCGTGGAG
GCCGCATGTTTGCCCCAACCAAGACTTGGCGACGCTGGCACCGCAGAGTGAACGTAACTC
AGAAACGTTATGCCATCTGTTCTGCCTTGGCAGCATCAGCTCTTCCAGCCCTGGTCATGT
CTAAAGGTGGGAATTCTGAGAATGTTTGCATGGCCTGAGCGGTAGCGGTTACTCTGAGAT
TACTTGAAATGTTTCTTGTGGGTAATAAATTCCCTTTCAAATTAAGGGTGCGGTACCCTC
TTTCAGTACATTGAGTGTTTTTATGTACAAATGGGGATGGTAATTTGAGGGTTTCACTGT
GATGGAAGTTAGGCACACAGAGGTAGCTCAGCATTGTGTTGCTGACATCTATCTTGTCCT
AACAAATTATGGAAAATTGGGTTGAATTTTGAAATAAATGGCAGTTTGGTTAGAGTTCTG
TTCATAGAAGCCACAGATCATGCTTAATTTACTTGAGTATTTTTTGAGGCAGGTCAATAA
GACTGCACTGAAACTTCTCTGCTGTTTTTAGGACACGTGCACATTACATTTCCATTTTTT
TTACCTTGTATTGTTTCTGAATGCACAAGGCAATACCTTGAAATGTGTGCATATGACCAG
GGTCAGTGGGTAACTTAATGTCATGTAAAACCCCCGTTAGGTCACCGCATTGAGGAGATC
CCAGAACTTCCTCTGGTTGTTGAAGACAAAGTTGAGAGTTACAAGAAAACAAAGGAAGCT
GTTCTCCTCCTTAAGAAGCTTAAAGCTTGGAATGACATAAAAAAGGTGAGTTGCTACAGG
TATGTTCCTGAGAGCACTCATCATTAGGTTCTGCCATAGTTAAATTAAGAATTGCAGATT
GTTCTGTATTGGTTTGATGCCATGAAAAAATTTTTGGTAACAGTTGTAGAAAAGAAAGTT
TAAGTAGTCACAGTCAGTTTCTTCCTTTGTTGCTTTGCTCTTTGTACTTGGTCTCTTCAT
TTCAGTGCTGAGTAACAACACTAACAGCTCAGTCTGCGTCTCTTTCGAGTCTTAAGAATG
ATGAACTTCTCACTGGTCCGTGTTTCAGATTATCAGTGATGATTGTGAAGTTCTGACTGA
AGTGTCTTTGTCTTACTACTGTAATTTGGACTTCTTCAAATACTCACAGATTTCTTTTTT
ATAGGTTTATGCCTCTCAGCGCATGAGGGCTGGGAAGGGTAAGATGAGGAATCGCCGTCG
CATCCAGCGCAGGGGGCCTTGCATCATCTACAATGAGGACAATGGCATCATTAGAGCTTT
CCGGAATATCCCGGGTAATTTTAACTTGGGTCTTATTTATTCTTTTTTTTCTTTTTTGGA
AGACAGCCCAGAATGATGAGATTCCACTTCATTGGTCCGTGTTTCTGAAACACATGATTT
TGTGGAAGTTCTGACTTCTAGCTAAAGCAGCTGTAATTTTATTTCCAAGAATCTGGTTTG
GTGATGTTGAGGGATGTTTGTGTGTCTTTTACCATCCATAAACTGCCTTTCAGACTGTGA
AGATGAGGCTTTTAAGTTTGTTGCTAGAGAAGGCTGGCTTTTTACCTTATTTATACATAG
GTTGATATAACTTTGTAGTGTAACAGCTAATAAGACCTTAGCAGTTTCTGTTCGTCTCAG
TCCCATGTTGCTTGCTTTTCATTATAACTGAAGAGGTGTGTCTGTTTTTCTGTAGGAATT
ACTCTCCTTGATGTGAACAAGCTGAACCTGCTGAGACTCGCTCCTGGTGGCCACGTTGGG
CGTTTCTGCATTTGGACTGAAAGCGCCTTCCGCAAACTGGATGATCTGTATGGCACCTGG
CGCAAACCCGCCACTCTGAAGAGTGACTACAAGTAAGCATGGTAACACCTGACCCAGCTG
CGTGTGGGGGGTAGCAGAATAACCCAGCAGAGCCACAGATTGTCCAGGTTAGGTGTGGGA
AGTCAGTACTGTTGGTAATTTTCACTAAATGCCATTTTCATCGAATTAGCTGTGTTTTAT
TTTCCAACTTAAGCTCTGAATGTTTGGTTTGCAGCCTGCCGATGCACAAGATGACCAATA
CAGACCTTGGAAGAATCCTGAGAAGCCAGGAGATCCAGAAGGCGCTGCGTGCTCCAAAGT
AAGAATTTTTAACTAATGCCTACCAAGCTCAATCTGTTCTTAATCATTGCCAAGTGCAAC
GCTTCACATTGAGAACAGAAATCCCTGTGCCTTGAGATGTCAGATAACGCTGGGATTTCT
TTGGTTCCTGGCTGTAAATACTAGGAATTATGATCCCTTAAATGAGATTTTAGGAAGGTT
TGACATGCTGTGAGCTGTGAAGGGAATGAGATACATCTCTCTTCTTTCCAGGAAGAAGAT
TCACCGCAGAGTCCTGAAAAAGAACCCGCTGAAGAATCTGAGAGTCATGATAAAGCTGAA
CCCATACGCCAAAACAATGCGACGCAACACCATTCTGCGCCATGCCCAGAATGTGAGGAC
AAAGCCTATCATACAGTCTGAGGCATTGAAGCTGGTTCTATAGACGATAATGGTTGTGTT
TTCTCTTCTTTCTGTTGTAGCAAAAACTCAAGGAGGAGAAGAAAGCCAAAGCCAAGGCCA
GTGTCACGTCCAAGGCCAAGCTGTCGGCTAAGGCGCAGACCAAGGCCAAGCCTGCAAGCA
AGACTGCAGGGAAGGCTGCAGCAAAGGGCCCGGCCAAAGCGCCAGCCAAAGCACCAGCAA
AATCTGCAGCGAAGGCCCCAGCAAAATCCCCAGCAAAGGCCCCAGCGAAGGGCAAGGCTG
AAGCATGAGCGGGGGCAGCACTTGGAACACCTGAGCTCAGAAAATCGTGGATCTGCAGCG
AATAAATTCTATTGGAACAGTGAGGTGCTTTTGTGGTCTGACACAGCGGTGCATGTTGGG
GTGAGGAGCGCGGTTCAAGGTTCATGGTGACAGACTGATGGGCCTTTGGGGGCACTGTGA
GCACAGGGGGGAGAGAAGCACACGGGGGAGAGAAGCGTGTTGTGGTGCTGTCCTGTCCAG
GGGAGGTGGAATCCAGCAGCAGCAGTGAGCCTTAATGTGAAATCACAGGCTGCTGTTCTA
ATGGATTGTGTTCTAAAGGGTTTGGAGGGAGCTTTGTGTAAAGGTTCTGATTCCTCTGCA
AGTGCAGGAATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTCTAATGGATTGTGT
TCTATGGGCTTTGGAGGGAGCTTTGTGTAAAGGTTCTGAATTCCTCTTGCAAGTGCATGT
CTGAGTTTGGGGCTGGGAAACGTTCAGTGGTGTGCGCCCTGCGGCGCCCATTCAAATGGA
ATCGTAGGAGAAGGGGCGGTGCAGAGCTCCTTAACCCCGGGGCGGAGCTCTCAGGTTGCG
CCCTTCACGCTGTGCTACGTAGCTCAAGCGGCCCTATTGCTGCCAGTCCGCCTGTAGGGA
CGTACCGGAGCGGCAGCTCCGCTCTCCTGCCGCGCGGGGGCGGCCGCAGTGCGGTACGGA
GC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1061, 2083..2254, 2959..3065, 3467..3605, 4120..4244, 4624..4753, 5155..5311, 5494..5577, 5811..5931, 6020..6321
1059..1061, 2083..2254, 2959..3065, 3467..3605, 4120..4244, 4624..4753, 5155..5311, 5494..5577, 5811..5931, 6020..6244
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved