Gallus_gallus Locus ENSGALG00000002157
snOPY snoRNA Orthological Gene Database
Gallus_gallus ENSGALG00000002157
Gallus_gallus
ENSGALG00000002157
10
SNORA71
2467..2598
4788
CTCATTGTAGTATATGCAGGCAAGACTGCACTCTCCTACAGACGCGTGGAGTAAGCTGT
GGTGTAGTTTTTGGCACATAATAAACACGTTGCAGCAAAAAGCCCTCTGTGCTCCCTTCT
TTCAGCCTGCACACACCTTGTGCATGGGCTCTCTGCCCCTGGGTTAGAGCTGTTCTCATC
TCTTATAGGGGAAGATGAGATAACTGGTATGGTGGGTGATGTGGGTACTGGAGCAGGGCC
TGGGACATGCTGTTTCAGGGTTCCAGCTGGAGCTTGCTTCTCAATGCGGCTCATGGGATG
CTGAAGGCATGCTCTGTAGGGGCTCCCAGGTTCCTGATATGAGGGCGGCCAGTGCCCCTA
GAGGGGAGGTGGGCCTGTGTTCCTTACGTGTGTTTCTCCTCATGGTTGAATGTAGGGGGC
TGATGCACGTTAGCTCCGTAGTTTTCCCCCCGGCTCTGCCTCTGGGCTGCAGAGCGGGAT
GGGAGCCCTGTGGCTGCTCGAGGGCTGGGCCGTGTCGCACCCTTTAGTGCCCCGAGGAGG
CTTGCAGCGCTGAAACGGGGCCTTGGGGCCGCAAGGCTCAGCGACAAGGCCGTGCCGGCT
GTCTTCACGCGGCACGGCCTCCGGGGGCCGCTGTCACTGCTCGACGAGGACACGGGAGTG
GGTGCTGGGCGCCAGGCCACGCCCCCTCCGAGCCTTTACGGCCCCCCGCGTCCTCCTGCC
CGCCAGGGGGCGCTGTGCGCGCCGCGCGCTTCCGGCGTCCCCTCGCGCTTCCGGCCCTCC
TCTGCGCTCTCTTTCTCCGCGGCCGCCGCAGCCATGGTGACTCCCGTCCTCCTCTTACTC
GTCCATCGGCCGCCGGGGCCGATCCCCGGGGAGCTCCGGGGCGCGGAGCGGGTTGACGGG
GGGCGGTGAGCCCGTAGGGGCGGAGGCTGGCCGGTAACCAGCGTTGCGTGTCCCCGCACC
AACGCGGTGATGCTAATACGGTGAAGTAAACTGCCTGGGGTATCATCGAAAAGTACTACA
CCCGTCTGGACAACCACTTCCACACCGACAAGCGCGTGTGCGACGATATCGGCCATCATC
CCCCAGCAAGAAAGTTGAGCATCCAGATCCGCGGGGTGATGGTCCGGGCGGGGCGTGACC
CTCCACCTTGCTCGGCCCCGTGCTTCCTGCAGCGCCCCCCGGGGGTTCANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGTGTGTGTGTGTGTGTGTGACCCCCCGTCACGCCGCCTGTCCCGCAGGTA
TGTCACCCACTTGATGAAGCGCATCCAGCGGGGCCCCGTCCGGGGTATCTCCATTAAGCT
GCAGGAGGAGGAGAGGGAGCGCCGGGACAACTACGTGCCCGAGGTGCGGCCGGCCGCGCT
CACGTGGGGTCGGGGCTCGGGGCTCGGCCGGTGGCACGGGGCTGTTTCATGGGGAGCGGT
GCTTTCCGGGCGCCGGGCTGCGGAGCGCGTCCCCGAGGAGGGGCTGCGGAGGGGCCGGGT
GTGGGGCACGCGTGGGACGCACCGTAGCCCAGCGCGGCGTTCCCACGGGCGCTGCCGGTT
CCGTGTAGTCGGCACTGTTGCCGGCCGGGGGGCTCCGTCCTCCTCCTTCCTCGCTAAAAA
TGAGCTCGGTGATAACTCCTCGGCACACAGCGCGGCCCGAAGCCGCCGTGCAGCAGATGT
CGCTGAAGGGCAGCCGTGGTGCGGTCCCGCGGCACACCCACCCCGCGGGGACCCCCGCGC
TCCCTGAACCTGCATTCGAAAGTGATCGTGGTCTGCTGCGTGGCCCGGTCATTGATAGTG
CAGGGAGAGGAACACGAAGGCGTTTCCCGTGTTTGGTTGGGTCTGTGCTATCCCTCCCAA
ACCCTGTAGCGTTCGGACATCGGCCTTGCACCCCTCCTCTCGATCTCCTGTAACGCTGTT
AGCTGCTGTGCCGCACAAAAACAGCGTTGGGGGTGTGATTATTTGTGCTTCTCAGCTCTC
CCAGTTGGCTGGTGCTTGGGTTGCTTATTTTAAATCTGGGAAAGCAGACAGTTCTGTAGG
CCGGGACGGGGTGATGAGCCCGGTGCCTGGGCTTGGTGCGATTCCTCACTCGTGGTGTGT
GGAAAGGAGCAGCTCTGCAGGTGCTCTCAGAGCCCTGGGGTGTCAGCTGTGACCGCTGCA
GGGGGCTGTGCTCAGCTGCAGGTCACCGTGGAAGCTCAGAGCTCCTGAGCAGGGAAGGAG
CTGCAGGCTGAACCTACTTGTTTCTTGCTGGTGCAGTGTAGCCTATAGTGGAAGGGAGCG
CACAGAGATCGAGGTCTGGGTCTGGGAAGGGGAGTTGTGAGGTGTTCTGACAGGGTTCCT
CCTGGCTTGCTCCGGTGGGGGCACTGGATCAGCTCCCCCCACGGCACAGCCAAACCTCTG
CTGTCTCGCTTCTGTCCCCAGGTCTCTGCTCTCGATCAGGAGATCATTGAAGTGGACCCG
GACACCAAGGAAATGCTGAAGCTCCTGGTGAGTAGCTCAGGCCACCCTGCTGCCTGGTGG
AACCCAGCCCGGGTGGCGACCGTATCCCCAGCAGTGCTCCCGGGGCTACTGACGGCCTGG
AACGCTCTGTCCCCGTGGCTGGGAGGGCTCTGCCTCCTCCCTTGGTGGGGTCTGGGCACA
CCGCTGACCCCGAGCTCTTTTCCAGGACTTCGGCAGCCTGTCCAACCTGCAGGTCACGCA
GCCCACCGTGGGGATGAACTTCAAAACGCCGCGAGGCGCTCTCTGAGCCGCTCGTTATGT
TGCTTTTACAATAAACGTGGGAAACCAACTCGGCCTGCTTGTTCTTTCAAAGCCCACGGC
GGGGAGGAGCGGAGGGCTGCATCTCCCTGGGTTCTGCGTCTGAGGTGTCACTGTGAGGAG
GACTTAACACCTTCCTGTTTGTTCGGGATGTGAGGTGCAGAGCTGTTGCTTGGCAGTGTC
CTTAATGATGTTAGGGTGGTGGCGCACGGCTCTGAGAGGGCAAACATGGAGTGCCCTCGG
AGCCTCCCAGCTTTGAGTGGGAAGCTCACAAGGTCGTGCGGTGCCAGAATAAAAGCTGTC
TTTCTGACCAGATCTCTCAGTGCTTAGATGGAAGAGGAAAAGTTTCTCTGTGTTTATTTC
TACAAGGGGAATGAACAGCTGAGCAACCTGCTGTCTGAGGGTGGAAGCCCATACGGGAGA
CAGGCCTTGAAGCCTCCAGGTGGACCCCCCATCTCCTACCATTGTCCCCGGGGAGAGCTG
CATTCACCCCGCGACTCCCATCCTGCTGTACAGAGGACCTACCAGTCCCTGCCGTGCTCT
TGGGTTCCTCCAGCAGAAAAGGGTTCTTAATCCATTTCCTTCCCTATTTTTTGCATGATC
AGTGTCAGCACTTGTGCTCAGGACTGTGGTTTATGTGGGTTTTGCTAAGGAGAAGACTGG
GGCCCATGCTCAGAACCCATTCAAACCCACAGGGCTCCTTGGAGGCCCTGAGCCAAAGGC
TCTCCTGACTGTTGGCAGCCATGGGACACGTGTTAACTACCCCATACAAATAAAAAGGCA
GAGGATTTGCTCTTTGGGGGATACACTTGTATTTATGCTTGCTGTGGAATTTGCTTTCAG
TAGTAAGGAGAAAAATGTTTGCAACAAATTCAGGCAGGTATGTAAAGTGTACTGAGCTGT
CACCAGGATAAACCAAACACGAGTGGCTGAGAGCCCTCAAACACTGCAGGGATTTAACTC
AGAATTTGCAGCTCAGTACCACCGATCTCCAGTATGTAACTAAAATGCAGTGAGAACAAA
GGCTGCCCACTGGAATAACGATCAATCTGCCAGAAGGCAGGGAAGGCAGCCTTACTTGGG
GGCAACCACAGGATGCTGGTTAACAGAACTGAACTGCCATACCTGGCTGATGGTGTTTGG
CAGCGCTCCGTTAAGGTTTTGCTGAGAACAGCTGCCTGTTACTTAGAATTTTGTTAGTTT
TCACATCAGGGTGAAGGCTGATTTCATTACGAACCCAGTAGGCGGTGTAACCTGCGGTGC
CAGGAATGAAGTCGTGTAGCTCTCCGATGTATTTCCTCATGTCACGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1116, 1977..2082, 3141..3206, 3385..3788
1001..1116, 1977..2082, 3141..3206, 3385..3462
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved