Gallus_gallus Locus NP_001026007.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001026007.1
Gallus_gallus
NP_001026007.1
1
SNORD15, SNORD15
5135..5279, 6523..6670
9177
ATGGGAAATGGTTTCCAACAAAAAGAAGGGAGATTTAGACTGCATATAAGGAAGGAGTT
GTTTGCAATGAGGGCGGTGAGGCACTGGTGGAGGTTGCCCATCCCTGCAGATATCCGAGG
TCAGGGGATGGGGCTGTGAGTGCTTATGGAGCTGTGGGTATCCCTGTGCATTGCAGGGTG
TAGGGCCAGATGGCCTTTAGGGGTCCCTTCCAACTCCAACCATCCTGTGGTTCTGTGATT
CTATAGCGTCTTTTCACCCTTATGCCCATTTCTCCCGGCTCCCTTCAGGGAGCTCAGCAA
GGCAGAACATCCCTTTGCTGACTCCTCCCATACAGTCCGTATTTCCCCGCTAATTCCTAT
GTACACTCACGTGCCAATTCTACTCATTATTATCATTTCCCATTTACCCACCACAACCAA
AAGCCACTCATAGAAGGTTGGAGAAGACTGCCCAGATCTCCAACCCCAGCCCACCCCCTC
CCCCCCATGCCCACTGACTGTGTCCCTCAGTGCCACATCCCCATGGCTCTGGAACACCTC
CAGGGTTGGTGACCCCACCACCTCCCTGGGCAGCTCTTGCCATTTGCAGGCATTGGGACT
GCCTAAAGATAGGTAAAATAAAGGTTTAGAAGGACGGTCAGTGAGGGGCTCCCGCCGCTC
CCCTCACGCGCCGCTCCCCTCACAGAGGGGCTGTCCCTGAGGAGAAGGCCTCTGTGCCGC
CAGAGCTGACCTCTGTGTCGCACATCTGGGTGAGTTAGCATCCTGTCAGCGCCTGAGTGC
ATTAACATCGGCTTTGTAGCCATTTTAATGCCGATTGAGGGCGCTCACAGCAGCCTGGCA
GGGCGGCAAAACGCGCTGGCAGGGGAAGGGTTAATCCTCCCCAACATGGCGGCGCCGGGA
AGACTATCTTTCCCGTCGATCCCAGCGTCACGACCCACGTGATCGCACCGAGCCAATGCG
GAGCGGCAGAAGGCTGATATAGTCCTCCCCCCGGAAGTAGGCCCTCTTTCCGCCGGGTGG
CGCGGCTCAAGATGGCGGTGCAGATCTCCAAGAAGCGCAAGGTAAGGGCGGCCTCCCTCC
GCTCCGCGGCCTCGGGGCACTTCCATATCGGCGGGGACCCGCCGGGGTCGGCCTCGGGCC
TCATCGGGGTGGGGTGGCAAAGCGGGGGTGGCGGCGGATGCAGAAGGATGGCGGCGGATG
CGGCTTCGAGGCCCGGCGGGGAACATGGCGGCGGCGGGAGCGTGCGGCGGGGCCTGGACG
GGGAGCGGGGAGCCGTGAATTGCTTTTAGGGATCGCGTGTGGGGCGCACACGGGGCGCTT
CTGTGCGCTGTGCTGAGGGGCGCAGGGCAGGGCTGGAAGGTGATTTTTTTGTTGTTTTAT
AACGCGGAGTTCGTGTTTAATGGCACTGTGCTTGTGTGCACAGGGTGAAGGTTGTGGTTG
CGTTGTCCTGGAGTCATTAGAATGGTTGGGAGGAACCTTCAAACCCTCCCAGCGCAGCCC
CAACCGCTGCCATAGGTTGGTTGTCCCCCACCAGACCAGGCTGCCCAAGGCCCCATCCAA
GCTGGCCTCCAGACGTGGGGCACCCACAGCCTCTCTGGGAAGCACCTCACCACCCTCTGA
GTCAAGGATTCTCTCCTAACATCTACCCTAAATCTTCCAGTTTTTAGTTTATTGCCATTC
TCCCTTGTCCTGCCCCTGTCAGACCATGTAAGAAGTCATTTTCCGTCCTGCTTAAAAACT
CTGCACAGGTATTGGAAGGCCTCAGTGAGGTCTCCCCACAGCATTGCCTTCTCCAGGCTG
AACGCCCTCAGCTCCCTCAGCCTGTCTCCATACAGAGGTGCTCCATCCTATGAGCATCCC
CATGCCCTCTGGGTCTGAACCCACAGCCCCACATCCCTCCTGTGCTGGGGGCCCCAGGCC
TGAATGCAGTGCTCCAGACAGGGCCTCGTGAGGGCAGACAGAGGGGGACAGACCCCTTCC
TGCCCACTGCCCCCTCTGTTGGCCTTCCAGGCTGTGAGTGCTCACTGCTGGCTCCTGTCC
TGCTTTTCATCCACCAGAACCCCCAGGCCCTTCTTGAGAGGGCTGCTCTCGAGGTGTCCT
CCTCACAGTGTGTGCTCTTATCTGATACTGCCCCAATTCAACACCCTGCACTTGGCCTTG
TCAAACCTTCAGTTCACGTGTGCCCACTTTACCAGCTAGTCCAGGTCTGTCTATTTGCCA
TCCCTCCCTTCTGCTGTGTCAGCCACAGCACTTAGCTTGGTGCCATTATCAAACTTGCTT
AGGGCACACTTCAGGAGAATTAGCAAGGTTTGAGGTACCTGTGGGGCTGCTAAGGGGATA
CGAGTTCTGCAGTGAGTTCATGCAAACTCACATTTCATCACAATACCTCTACAAGACATA
GAAATGAGATATTTCACTGTTTGGCCTGAACTGTGGCTGTTCTGGGGCATGAATCAGGCT
TTGGTGTTGGCTTTTTACTGGTGGTGGTGATTTATTTCTGGGAGCTTTAGGAGAGATGCT
TTTATTTCATCTCCACTTCTGTTTCCTCTGTTGGGGGGAGAGAAGCTGTCAGTCTGCAGG
ACAGGCCGGGGACCCAGACTTAAAATGTCAAATTCTTTTCTTTTTTGAGAGGGACAAAGT
ACTTACACAGTCTTGGTCTGTTTCTTCCATAGTTTGTCGCTGATGGCATCTTCAAAGCTG
AACTGAATGAGTTTCTGACTCGTGAACTGGCTGAAGATGGGTACTCTGGAGTAGAAGTCC
GGGTCACTCCAACCAGGACTGAGATTATCATACTTGCCACCAGGTAACCAAGACACTGCT
TTCCACTTAAGAACGCTGTGTAAGTCTTTAAGGGGTGTTGCTGAAGTTTGGTAAACATTA
TTAGGGTGAGGTATTTGGGAAGGAGATGCTGAAGTGATCTTCAGTAAAACAGCAGTGTTA
CAACCCCTGCTAATCACCCGCCTGAGCGAGGTTAGGCACTCAGTCTGGAAGCTCCTTGGG
GTGGTTGCAGGCTCTGACGTGGTGACACTCCCTCAATCATATTGTTGTTTGTTTTTTCCA
GAACCCAGAATGTGCTGGGTGAAAAGGGACGCCGCATCCGGGAGCTGACGGCTGTTGTGC
AGAAGAGGTTTGGCTTCCCTGAGGGAAGTGTCGAGGTAAAACTGCCTCAGTTAAAACAGT
TCTGTGTGGGCTGTGTGTGCTGTCTGGATGGCTTCAGCTGAGAGGCGATTTCACTTGGAG
ATAACTCAGGGCACGTTTTACCTGTTCTCACAAAACAGTGTTGTACTGAAAGAGGAATAT
CGCTTTGCTGTCAGCTGTTTTGAGTGCGCTCAGTTTGTCTGGTTTTCTTTGCTTTCCCAG
CAAATAGGAGCACAGAAGCAGGTAAAACTTGTTGCATTTCTCTAAAAATGTTTTGTAAGG
AGTATTTCTGTGCCAGTGTTGAGGTGAGAAGGTCAGTCTTATAGCATATTTTTCACTATT
GATGCATTGCCATTACCCTTATTAAATTCTTAATGCTTTTGCCCATCTAAAGAGGCTGTT
CAAGTGCAGAACTATCTTTGAGACTTTTGTATGATACTGCAATTAATTAGAATGTAGAGA
CAACAGTATTTCCCTGATGCCTTTTTAATGGTTGAAGTCTGGTGGCCTTGCTAGTAGTTC
CCTCCAAAATAATTTATCAGAGGGGGGATGTGTGGTTTGGGGTGCCCTTCACCCCATTTT
TATTCAGATAAATCTCAGTGTTGCTGGATCACGTTATACAATTGCTGGTTATCTCCAGAA
ACTATTAAAACTTAATAACTCCTCAAGCATTTGTTTCATTAGCTCTGGTGGTATTGTGTA
TGTAATTTCTGAATATCTCCTTCTCAGGTATCAGATTTTGGCTATTAGGGACATTAGCTT
AAGTGCACTTTGTTGTCCCAACTCTCTGGTTCTTAGGTTCTCTGCCTTCCTGTTGGGTAA
TGCCATCTGTTTTGTTCTTGGGAACATTGTTGCCTACAGCAGAACTGCATATCCCATGCC
TTGTTTTAAAAACTGAATTGTGAACATAGTTCTTGGAGCTGCCTGGATGCCTCTCTCCAT
TGTTACTTAATGTTTTGGGGCTATTTGGAAGCAGCAGCTCTTGGAGACTGCACCATCCCA
GTTCTCAAAGTGCTCCTGGTGTGTCTCTCAGCCCTGCCAAGAGCAGGCAACAGGTGCTAA
GGGAGCTTAATGTCTGAAGATACAGCTTCTGCTTGTAAGCATGGGTCTGAGGGATGGGGC
GTGGAATGGTATGAAACTCCTGACTTCCATTTAATGAAAATCATCTGGAAATAAAAGCAT
TTCTGAGTTTGCTACTTATTTTTTCAGCTCTATGCCGAGAAGGTGGCCACCAGAGGTCTG
TGTGCCATCGCCCAGGCAGAGTCCCTGAGGTACAAGCTTCTGGGAGGCTTAGCAGTGCGT
CGGTGAGTAGAGCATGTTGGATGTGATGCCCCAGTGAGGCTTTGTAGGACTCCAGTAGTG
CTTCAGGATAGTGCTCACCAACTTGAGATGTCTTGAATTTGGAAATCTAACCTACTAATG
CTCTGCTCACAGAGGGCAGTTAGCATTTGTGATAGATAGAAGCTTTTCATTTAGTATACA
GTTACCTTTGGTAGTAATTGCTAGACACCGTATTCCAAAATGTTGAAGTCCTGGATTAGA
TCATAGAATCACAGAATGGCTCGGGTTGGAAGGGACCTCAAGGATCATGAAGCTCCAACC
CTCCTGCTGCAGGCAGGGCCACCAACCTCCACATTTCAGACCAGCCCAGGCTGCCCAGGG
CCCCATCCAACCTGGCCTTCAACACCTCCAGGGATGGACGGGGCATCCACAGCCTCTCTG
GGCAGCTGTTTCAGCACCTCCCCACTCTCTCTGTCAACAACTTCCCCCTCACATCCAACC
TCAGTCTGCCCTCCTTCAACTTAAAACCATTTCCCCTTGTCCTGCAGTTATCTACCCTTT
GAAAGAGTCGATCATATCAGATTAGAAGTTGTGTGACTGATGTGCATGAAGTTCACATGG
TTTGTGAATGAATGGTGGATGGAAGAGTGAAACACAATTTCAGTCCTCGTGGCTGAATCG
TAGTTCAGTTGACAGTGGCTTTGCTTCTTGGATCCCTTCAGTGATGATAAGATGACGAGT
CAGAAGGGATGGCTCCTGCTGAGTGGTGCCCCTGCAGTGTCACGTTCTGTGCTGCTGCAT
GTGGTTCTTCAGCAGGAGCATCCCGTCGCTGAATGATTTAGAGGCATTTGTCTGAGAAGG
GATAGAGGCTGCACTTGTGATGTGGGTGGGTTGGCCGCCAGAGAACTTGTGCTCATCACT
GTGTCCGCAACTTCACAAGGTCCATACATAATTCACAGTACTCCTGTAAGGCTCCATTTG
ATAGTGCTAAAACAGTATGTAGTTCTCTGCTGCTTTGTCCAGCACTGACAGTGCTTGTGT
TGCACGACTGTAGCTTTGAAAAAGGCAGATGTTAAAATGTGATTGTCTAGTTTTGAAATT
GCTGCAAAATGCCATTGGATTTGGCAGAGATGTCCCAAACCGATGGGACTAACACAGTGG
CTGTTTCTGTTCCCTGCCTGCAGGGCCTGCTACGGTGTCCTCCGCTTCATCATGGAGAGC
GGTGCCAAGGGCTGTGAGGTGGTTGTGTCTGGCAAACTCAGGGGTCAGCGTGCCAAGTCC
ATGAAGTTTGTGGATGGTTTGATGATCCACAGTGGAGACCCAGTGAATTACTACGTCGAC
ACAGCTGTGCGTCACGTCCTGCTCCGGCAAGGTGAGTGGCTGGGATGCAGATCCCTTTGC
AGCTCTGTTGGCCTCTTGTATCAGTGCTTTGGAGCCAGCAGCTCTCAATCGCTGGCTCTC
TTTGCCTGCAGGCTGGAGAGTTCACTCATCTGTGAGGTGGTAGCTTGCATGGGTTCAGTG
CACCTCTGATCTTGTAGAGTATTTCAATTGTGCTGTCCCTGGGTGTTCTGACTCAGAAAA
TCTGTTTTCTCCGGTTCCTGCAACCAAATTCTCACCAGTGGAGCTTGCACGTTAGATCTG
AAGGAGACCTTTATTTGCATTTGTTATGTGGATGGTAAATGGTGAAAAGTCCTTCAGCAG
ACAGCAGGATTTTGTGTGCTCACTGTGGGTAATCTGCTTTTGCTGCTAGTGGGGATTGAA
GTTTCCATTTGGTAACGTGCAGATTTTCCAGATACTCAGTTGTATTCCGTGGCTTCAGAG
CCTGGTAGCAGAACACCTTACAAGTACACTTAGGGTCTGTATTCAAGAGCTGCTGGACTG
TGTCTCTTGGCTCACAGGGAAATCAGACCCACAAAAAAGCAAGCATCACTGACAGCTTTC
CCACCATAGCTGCACTCTTTCAAGTCTTCCAGCTAAACCAGCCAAGCCAGCTTTCATCCC
CTTGTCCTTTCCCAGTAACACACAAGTGGCTTCTGCATCTTAACAGGCATTTCAGAGCAC
CAGGTGTAGAGAGATTAGCATAAGCAAAGTTGTTTTGTCCTCCCTTCAGTGATGATAAGA
TGACGAGTCAGAAGGGATGTCCTTGTGCCAGCACAGCCTGGTCAGTGCCATGTTCTGTGG
TGCTGTACTAAGGCTGCCTTGGGCAGGATGTCCTCCTCATTGGTTGATTCAGAGGCATTT
GTCTGAGAAGGGATACCTGAACGTGGTGGAATTGGCCAGCTGAGCTATCCCAGGAAAAAC
AAGGTTTATAATCAGGATATAGAATGTCATCATCATAGTCATCCCAGGCTGTGAGTTTAA
TGGAGGCAAACACACTGATGTAAATTTACACTAAGTACATTTTTAAGCTTTATCACTTTT
AACTAGCTTCCATCAGTTCAGAGTTGTTGGGAGATGGTTTTGGTCCAGGCAGCTTACTTT
TGTGTCCAATGAGCATATCTTTAATGTTCTGTCCCTTTTTGCAGGTGTACTTGGAATCAA
AGTAAAAATTATGTTGCCATGGGACCCAAGTGGAAAGATTGGCCCCAAAAAGCCTCTTCC
AGATCATGTCAGCATTGTGGAACCCAAAGAAGAGATCTTGCCCACCACCCCCATTTCAGA
GCAGAAGGGTGGCAAACCAGAACAGCCAGCCATGCCGCAGCCAGTTCCCACTGCCTGAGA
GGTGAGTGCCTGTGAGCAGCAGGAGTGAGCTGTTCATGCAGACACAGTTTAACTGCACAC
TGAGCATGCCCTTCCATGAAGATGTGATGACGAGTCTGAAAGGGAATATCCTTGCCCAAG
TGCCCTGCTTCTTGCTGTGTTCTACAGCATGGATCTGGGGGCCTTGGGTCAGAATTTGAG
TGACCTAGAGGCATTTGTCTGAGAAGGGCTCAGTGCCTTAGGTGTTTTAATGCTGTTTTT
CAAGCAGTGGTTGTACTGGTGGATACTGGTATCCAGTTGAGATTTGACTCTTAGAAGCCA
GTACATCAAGTATGATGTTAGGCTAGTTTCATGAGTAAATCATCGAGTTTTGAACTCCTG
TCTTTCCTAATGAGTTGCTTCTATAATAAACTAATAGATAGAAATTCTCTGGGTTGTCCC
ATGATGAAAATGTGCAGCTTGGTGCTTTTAAAAGTTCTGCCTGTTTCCTCTGAGGAGGGC
AGCAGGGGGCACAGGGCCTAAAGCCTCTCCTAGAGGGCTTCTTTAGCTGTTAGTGAAAGC
CAACCTGGGTTGTGCTTTGACTGAAACTCTTCACGTGAACAAGAAGGGTTCAGGGGGTGT
GCAGGGCTACAGTGAAACAAGGGGATCTGACTAGAAAGACTTGCTCATGTAGGGGGAGGT
CATTGGCTAAAATGTAGGAAGGGAGAGATGTAATTGGAACACTTGGAGTGAGTTGCCTTG
TTCAGCATTTTGGGTGGGAAAATAGCTATAGGAAGTGATTTGCCACCATCTCACTCAGTA
TTTTTGTTTGTTTGTTTTTGTTGTTGTAGGGTTTACAACATCTGCAACCAGAAGCTTGGC
TGTCCTGAAAACATCTCTTAATAAAATCACAAAAGACAGTGTTTGTGGAGGTGCTTTTTT
TTGCAAGGTATATTCAGGAAGAGCCTGAATCTTTGGTATGGAAGGAATTTCTTTGCATTT
CTTTCAGCTTGTGTTACCTTTTGAAGTGAACTTAGCAGATCCTAATCTAAACAGAGCGGG
GACAAGATGCTGATTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 2672..2802, 3061..3154, 4347..4441, 5603..5790, 6944..7140, 7949..8177
1031..1060, 2672..2802, 3061..3154, 4347..4441, 5603..5790, 6944..7134
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved