Gallus_gallus Locus NP_001026004.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001026004.1
Gallus_gallus
NP_001026004.1
1
SNORD35
2075..2165
4543
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCAAGGAGGTACGGCCCGGCTGTGCTGCTGCGGGCGCTGAG
CCCGTCAGTATTTCATGGGCCCGTCGGGTGGGGAGGTTGGAAAGGACCTCAGAGGTCATT
CAGTTCCAACCCCCGGGCTCTATGTCCCGTTGCTCAGGGCCTGTCGCTGTCTGCCTACGT
ACAAAGTTGCCCCCCCTCCTGCTTATGGGCTCCCTTTAAGTACTGGAAGGCAGCAGTGAG
GTCTCCTCAGAGCATTCCTTTCTCCAGGCCGAACACCCTCATGTCCCTCAGTCTGTCTCC
ATACAGAGGTGCTCCATCCTCTGAGCATCCCCGTGTCCTTCTCTGGACCCGCAGCCCCAC
ATCCCTCCTGTGCTGGGGACCCCAGGCCTGGACTCAGTGCTCCACGTGGGGCCTCACAAG
GGCAGACAGGGGGATATTCCCTTCCCTGCCCACTGCCCCTCTGTTGGTGCTGCCTGGGAG
GCTGATGGCCTTCTGGGCTTGCGAGTGCACACTTTTCCACAGGGCTGCTCTCAGTGACTT
ACTCTCTCAGCCTGTACTCATCTCCCCCTCTTCTACAAAAGAAGTGCAACACTTTGCGGT
GGGGGAGAAAAAAAAACATTAGCTTCGTGTGGGCCCTTGTCCAGGTCCCTTTGGATCTCT
TGCTTTTGTTGTATCAGCTGCAGCACTCACAACTCCTCAGCATGATCACTGGGCCTCTGT
GCTGCCAGGGCTGTCAGCCCAGACACTGACTCTGGTTCTGGGCAGGCTGCTCTGGTGGTT
GGCGACCCTGCACACAGCAGGGAGGTTGAAACAAGATGACCATTGTGGTCCTTTTCAACC
CAGGCCATTCTATGATTCTGTGACCATCGCTTCTCTTGTAGGCTATCGAGGGCACCTACA
TTTAAGAGAAGTGCCCCTACCCTGGTTATGTCTCCATCCGGGGGCCGAATCCTCTCAGCT
GAGTTGTGCCCCCCTTCCAGCATTAGAACAGCCCATAAGTGTTGATCTTGGAGTTGCTGG
TAAGCGCGCCAGCGTTGCTTGAGCTGGGACATGACGCAATTCTCACGATGGAGGGTCCAA
GCGTCACGGGGGAGGGCGGCTGTGACCGACAACGCCACATGGCTTTTGCTGAGACCTGGG
TACAAGGGACCTGGCGGGGGAACATTTCTCTGCAGAGCGGGTGGCTGCTTTCAGCGCAGT
TGCAACCCCAGCTTTCTGTCTCCGAGGCAGGTCTTCCTGCTAGATAAGGGGCCATCTGCC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCT
GGAGCTGCTGGGAAGCGCAGCAGCTTTCCTTGAGCTGCACATGATGCCATTCTCACGATG
GTCTTCCAAGCCTCACGGTGAAGGGGCTGTGACGACAACGCCACATGGCTTTGCTGATGC
CTGGTACAAGGACCTGTTGGTGACATTTCTCTGCAGTGTGGGTGCTGGTTCAGTGCAGTG
CAGGCAGCATTGGCTCTAGGAAGTTACTGGAATTAAGGGGCACTGCCTTCACGTGTTAAA
TACTATGCACTGCTGATCTGGGGTGCCTCTGAAAGTCTCCATTCTCCAGTAGTTAGAAAC
AGATCCCCAGCATGTTTTGCTGACGGCCACTGAATGCTTACACCCATCATCACCTTCTGT
CTGCTCTCATCCCCAGGTGTGGTCACCAAGATGAAGATGCAGCGCACCATTGTGATCCGC
CGGGACTACCTGCACTACATCCGCAAGTACAACCGCTTCGAGAAGCGCCATAAGAACATG
TCTGTGCATCTCTCCCCCTGCTTCAGGTGTGTGCCAGCAGCCCCGCTGCCCCACAGCAGC
AGGACAGAGCTCTGGTCCTCACGGTGCAGGGCTACAGAAGTGCTGCGTGTGCTCGTGTGT
CTGACAGGCGTGTCTAATCTGTGTGGTGCTCAGCTCAGATTGTGCTGGAGTGAGTGAGCA
CGTCAGGGTGGAAGGTACAGTGTTATTACTGCTGCTGAGCTGGAACTTGTTTGCTGGTGG
TGATGTCTGAACTCACGATGGTCTTCAGAGTCCCTGTTGGTGAGGGGACTGCTGACAATG
CCAGTGGCAACTGCTGAACCATCAGACACGTTCCAGTCCGTCTCCCTGTTGTGTCTGTAG
AACCATGCAGTTCTGTAGTTCTTGAGAAAAGTTAAAATAGAGGGGGAAAGAAAAAAAAGA
AAGCTCAGACTGATGTTTCCAAAGGAAATGCTGAGGACAGAGGGCGCAGGTTCAGAGGCT
GGCATTGCCATCTCCTGTGTTTTTCTGAAGCATGTACCTGCAGTAGCCCAAATGCCAGCC
CAGCTGTGCTGGCTTAAGGAATGCTTCAGGTCTGGAAGGGAAACTCGTGATGGCTGAAGG
GTTTCCCTTCGGGTGCTCAGCGCTCCTCCTGCTCCTGTGGGATGCTCACATTTCATGTCC
TGAGTGTGATGCTCACGTGGAGTGACAGACTCTGGTGGCAGCTCAGGGGATGACCGCTTC
TATTTCAGCACAGTCATCTCTGCAGCACTTCAGATTGCACCTCCTCGTTCTGCAGCTCTG
ATTATGCAAGGTCACTTCTAGTGTGGTTACACAGCAGCATTTTCGACATCGTGTGCTGCA
CACATCTGTGTTGCAGAGCAGGAAACTGCTAATTCACAACCACTGCTCTTGCTTTCTTTG
CAGGGATGTGCAGATCGGAGACATTGTCACTGTGGGAGAGTGTCGGCCCCTCAGCAAGAC
TGTCAGGTTCAATGTCCTCAAAGTCACAAAGGCTGCTGGCACCAAGAAGCAGTTCCAGAA
GTTTTAAAACCAACATATGGAGCGTAATTGGGAAGAATAAACCTTTTTCTAAATCTTCCT
TGGGTGTGTGATGTGAAATAAACAGCATAGAAATGCAGCAGCACATGTAAACACACTGAA
CTGTGGAAATGGATGAGTTTCTCGAGGAAATGCAATGGTTTTGGGCAGACACTGTTCTCA
TATTCCAGGTTTACTGCTCAGGAGAAATGGAGGTTTGGTGTGGGTGAGGGTCAGGGAGTG
AGCGTTGTCCCTCTGCCAGTACATGGGGCAGTTTATGTATTTAATGAGAAAGGTTCCACG
TGGTGTTTCCACACACAGAGGTCTGAACACATTTTGACAAGGATGTGGGAATTAATGCTC
AAGAAAATGCTTTTCCTATAGATGTGCTTAGAGGTGACACAGCTCAAGTAGTTACAGGCA
GTGTTATTCTGAGAACTGAATGAGCCCTTCTGTAGGACGCATTTGGGGGAGGTGGGGGTC
AGTGGCTCTGTGCTCGGGTGGAGGCAGTGATCAGTGGTGTCCCACAGGGCTCTGTGTTGG
CACCAGTGCTCTTTCAATGTCATCAGTGACAGGGATGATTGGCTCAGGTGCACCCTCAGT
GAGTTTGCTGATGACGCCACACTGAGGGGTGTGGTTGACACAGGGGAAGGAAGGGATGCC
ATCCAGAGGGATCTCAGTCACTACTAAAGGTGGGCCCAGGTGAACCCAATGAGATTCAAC
CTAGCAAAGTGCAAGGTTTGGCACTTGGGTCTGAGTAACCCAAATACATATACAGACTGG
GAGAGGAACTCCTTGAGAGCAGCTCTGCAGAGAAGGAGCTGGGGGTCCTGGTGGATGAGA
AACAACATGAGGCAGCAGTGTGCTCACGCAGCTCAGAAAGCAAATGGGATCCTGGGCTCC
ATCAGCAGAGGGGTGGCAGCAGGGACAGGGAGGGGATTGTGCCTCTCTGCTCTGCCCTCA
TAGGGCCCCATCTGCAGTACTGCGTCCAGGTGTGGAGACCCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1025..1060, 1062..1077, 2416..2545, 3423..3543
1001..1021, 1025..1060, 1062..1077, 2416..2545, 3423..3543
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved