Gallus_gallus Locus NP_001026004.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001026004.1
Gallus_gallus
NP_001026004.1
1
SNORD35
1340..1431
3132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCTGGAGCTGCTGGGAAGCGCAGCAGCTTTCCTTGAG
CTGCACATGATGCCATTCTCACGATGGTCTTCCAAGCCTCACGGTGAAGGGGCTGTGACG
ACAACGCCACATGGCTTTGCTGATGCCTGGTACAAGGACCTGTTGGTGACATTTCTCTGC
AGTGTGGGTGCTGGTTCAGTGCAGTGCAGGCAGCATTGGCTCTAGGAAGTTACTGGAATT
AAGGGGCACTGCCTTCACGTGTTAAATACTATGCACTGCTGATCTGGGGTGCCTCTGAAA
GTCTCCATTCTCCAGTAGTTAGAAACAGATCCCCAGCATGTTTTGCTGACGGCCACTGAA
TGCTTACACCCATCATCACCTTCTGTCTGCTCTCATCCCCAGGTGTGGTCACCAAGATGA
AGATGCAGCGCACCATTGTGATCCGCCGGGACTACCTGCACTACATCCGCAAGTACAACC
GCTTCGAGAAGCGCCATAAGAACATGTCTGTGCATCTCTCCCCCTGCTTCAGGTGTGTGC
CAGCAGCCCCGCTGCCCCACAGCAGCAGGACAGAGCTCTGGTCCTCACGGTGCAGGGCTA
CAGAAGTGCTGCGTGTGCTCGTGTGTCTGACAGGCGTGTCTAATCTGTGTGGTGCTCAGC
TCAGATTGTGCTGGAGTGAGTGAGCACGTCAGGGTGGAAGGTACAGTGTTATTACTGCTG
CTGAGCTGGAACTTGTTTGCTGGTGGTGATGTCTGAACTCACGATGGTCTTCAGAGTCCC
TGTTGGTGAGGGGACTGCTGACAATGCCAGTGGCAACTGCTGAACCATCAGACACGTTCC
AGTCCGTCTCCCTGTTGTGTCTGTAGAACCATGCAGTTCTGTAGTTCTTGAGAAAAGTTA
AAATAGAGGGGGAAAGAAAAAAAAGAAAGCTCAGACTGATGTTTCCAAAGGAAATGCTGA
GGACAGAGGGCGCAGGTTCAGAGGCTGGCATTGCCATCTCCTGTGTTTTTCTGAAGCATG
TACCTGCAGTAGCCCAAATGCCAGCCCAGCTGTGCTGGCTTAAGGAATGCTTCAGGTCTG
GAAGGGAAACTCGTGATGGCTGAAGGGTTTCCCTTCGGGTGCTCAGCGCTCCTCCTGCTC
CTGTGGGATGCTCACATTTCATGTCCTGAGTGTGATGCTCACGTGGAGTGACAGACTCTG
GTGGCAGCTCAGGGGATGACCGCTTCTATTTCAGCACAGTCATCTCTGCAGCACTTCAGA
TTGCACCTCCTCGTTCTGCAGCTCTGATTATGCAAGGTCACTTCTAGTGTGGTTACACAG
CAGCATTTTCGACATCGTGTGCTGCACACATCTGTGTTGCAGAGCAGGAAACTGCTAATT
CACAACCACTGCTCTTGCTTTCTTTGCAGGGATGTGCAGATCGGAGACATTGTCACTGTG
GGAGAGTGTCGGCCCCTCAGCAAGACTGTCAGGTTCAATGTCCTCAAAGTCACAAAGGCT
GCTGGCACCAAGAAGCAGTTCCAGAAGTTTTAAAACCAACATATGGAGCGTAATTGGGAA
GAATAAACCTTTTTCTAAATCTTCCTTGGGTGTGTGATGTGAAATAAACAGCATAGAAAT
GCAGCAGCACATGTAAACACACTGAACTGTGGAAATGGATGAGTTTCTCGAGGAAATGCA
ATGGTTTTGGGCAGACACTGTTCTCATATTCCAGGTTTACTGCTCAGGAGAAATGGAGGT
TTGGTGTGGGTGAGGGTCAGGGAGTGAGCGTTGTCCCTCTGCCAGTACATGGGGCAGTTT
ATGTATTTAATGAGAAAGGTTCCACGTGGTGTTTCCACACACAGAGGTCTGAACACATTT
TGACAAGGATGTGGGAATTAATGCTCAAGAAAATGCTTTTCCTATAGATGTGCTTAGAGG
TGACACAGCTCAAGTAGTTACAGGCAGTGTTATTCTGAGAACTGAATGAGCCCTTCTGTA
GGACGCATTTGGGGGAGGTGGGGGTCAGTGGCTCTGTGCTCGGGTGGAGGCAGTGATCAG
TGGTGTCCCACAGGGCTCTGTGTTGGCACCAGTGCTCTTTCAATGTCATCAGTGACAGGG
ATGATTGGCTCAGGTGCACCCTCAGTGAGTTTGCTGATGACGCCACACTGAGGGGTGTGG
TTGACACAGGGGAAGGAAGGGATGCCATCCAGAGGGATCTCAGTCACTACTAAAGGTGGG
CCCAGGTGAACCCAATGAGATTCAACCTAGCAAAGTGCAAGGTTTGGCACTTGGGTCTGA
GTAACCCAAATACATATACAGACTGGGAGAGGAACTCCTTGAGAGCAGCTCTGCAGAGAA
GGAGCTGGGGGTCCTGGTGGATGAGAAACAACATGAGGCAGCAGTGTGCTCACGCAGCTC
AGAAAGCAAATGGGATCCTGGGCTCCATCAGCAGAGGGGTGGCAGCAGGGACAGGGAGGG
GATTGTGCCTCTCTGCTCTGCCCTCATAGGGCCCCATCTGCAGTACTGCGTCCAGGTGTG
GAGACCCCAATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1131, 2009..2132
1001..1131, 2009..2129
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved