Gallus_gallus Locus JOSD3
snOPY snoRNA Orthological Gene Database
Gallus_gallus JOSD3
Gallus_gallus
JOSD3
1
SNORA18
8267..8398
9493
CCGGAATCCCACAGCGAGCGGGAACGGCAGGGAAAGCCCAGCAACTGCGCCCGCTTCGG
GTTACAGCGCACGGAACCGCCCCGATCCCGCCCCGCCTCTCCCCGCTCTCCTCACGGCGC
GCCCCGCCTCCGCGCGACCAACAGGGCCCTTCCCCCGCCCGCTCTCGCGAGAGCCGAGCG
CTATTTAAGTTCGGGGGCGGCCATTGCGCGCCCTTTGCGGAGGCGAAGCGTGAGGTGAGT
AGAGAGGGCTCTGCGCAGCATCTGCTGCCATCCGTGGCGGGGGAACCCGATGTGGGGCTG
AGGCGGAACGAAAACCCGTCTATCCGCCGAGTGCTTCTCTGAGGGAGCGTGAGGAAGGCC
CTGTAGCGGGCGGGCTGCGGGGAGCGGGCTTCTCATGGCGGCACGGGGCTGTGGTATTGC
GGCGGGAACCGCGCAAAATGTCCGCCCCGGGATGCTGGGCGTGCAGGGCGCTCCTGAGAG
GAGCCGGAACGGCATCGAGCCGTCGGCCTGGCGTGGGCGGGCTTTCCTTCCGTGCGGATT
GGAGCTCGGCAGCGGCCATGTGTGGAGGCAGCGCAGGGGTGGAACAACTCCTGGCCTTCC
TCAGAGTTAGGGCCCCTTTAGGTATACATCCCTGGGCGTTAGAAGGAGTGCGCTGGATTG
CAGATCCAGCTGAAAGCGAATGTTTTCTTGTGAGACTGATCTGTGCTGATGACTGGAGAG
TAAAATGTTGGTAAGCCGTTAGAGTTGTTCTCTTAGGGCTGTGTAGTTAGCAAAAGAGCA
AGAAAATGAGGTTCTTAATGCCCAGATCCCTAGCTTAAAATGACTATAAATTACAGTGAA
GTAAGTATTTTTGTGTGACTTAGAACTGCAGCATCTCTACAAGCATGTTGGCTTACATGC
ACGTGTGCTTATATATGAAAAACCTTGCCTGGGGTAAAACATACTTTATTTTTTTTTTTA
GGGCAGATTAAAACATGACTGATACAGATGAAGCCCACGCTTCTGGTTCTGATTATCCTC
ATGCCCAAGATCTCATATCCACTCGGAGGAAAAAAAGGTCTAAAATACCTGAGTGTGCAG
CAAATGCACGGAAGGAACCCTTGTGCTCAAGGCAGGAGGATGCCACTCCTGAGGAGTCTT
CAGATGAGCTGAGTAGCACCTATACATCTTCAGCTGAGGTGGATAGCAGTGATTCAGAAA
TGTGAGTTATCTCTCATTCCTTAGAATTGCTCCTGAACAGAACTTGTGATACATTGTAAC
TGTATGTGTTCTGTTGAATGTGCACGTTTCTTTTTCAGTGATGTTCCAGCTGCTAGTGGC
AGCAAGCACCATAGGAAGTGCTCTGATGCACCTTCAAAGCAAAAGAGGAGATCGCAGCCT
TCAAGGCCACAAGCAGAAGCTGATGCAGGAGTGCCTGACAGTGAGAGTTCTGATTCTTCT
CTGCCTCCTCAGAGCCCAGTGAGGCCATTTGAAGCCTCCCAAGAGAAGAAATCTAAGCTC
AATTTGAAAGCCATCTTTGCCTATCACTTCAGAGGAAGGAAGTTTAAAGCTGCTGCACAC
CGAAAATACAGGAGCAGTGGTTCACAAAAGACAAAGAAACCCTCTGAGCACTCACGGAGG
CGGGGTGGGAAGCAGCCCATGACAGCCTCACCTCAGGAGCGAAGGAAAAGGCTTAAGGAT
CGAGGCTTTCAGTTCCCTTTTGTTGAAAAACATTACGGGAGAAAGCATATTCCCTTGAAC
ATGGTCCTTAGCTATGAGGTGAGCCCTCTGTTCTGTGGGAGAGAAGTTGTGATTTTACAT
TTATTTTAAGGAACAGTGAATGCAGGTTGGTATGTTGTGCTTCTACCCGACATGCCACAG
TGAAATGAATCCACTTTTATTTTGTTATATAGGATGACTGTTGCTTTCCATTCATTACCT
TAACAAGTTAAACCAGCTGACCTAAGGCTGTCATTTAATATTACAGTTCAGTTGTTTATA
CAAATGCTTCATTTCTTTTGTAGTGGTATTTAAAATCTCATTCTTTCCTTCAGCAAGCAG
CTGCCAAGGGCTATTTCCAGTACGTTGAAATGCTCAAATATGAGGAACACCTCAAAAAGG
CTTTGAAAGCCCTTGAAGCCAGTGAAGACTTAGAAAGAGAATGCCTGGCAGTGCGGAAAC
ACAAATATTTAGATGATGAAGGCCCCATTTCTCCTATCCAGGAGACAAAGTAAGTTCATC
TTAAGTAGTACAAAAGTTGCTGTTTTGTTCTCAGCTTAAATATAAGTTTGTGCATGCAGC
ATTGCTGTCTTTATTGTCTGGTATGTGCATTATATTCATTGGTGAAATACCTCTTAGGTT
TTTCTGTAACTCAGTCATGGATTTGCTTTGTGCTCCCTTCCCATCCTCAGAAGAGCAGAG
AGAAAATAAATAGCAGCTCATGGCTTGTGATAAGGACAGGGGTGGTTGCTGGTGGCTGGT
GGTGCCAGTTACTGTCACGGGCAGAACAGGCTCAGCACAGGGAGGTAAATGTAATTTCTT
ATGTTATTTCTAGCAGGTGAAAGTAGAACTAAAAGCAAACCACAAACAATTTCCCCCAGA
TCTCCTCCTTCCCCCAAGCAGTGCAGTGGGGGCTGTGCTCATTCCGTAATGCTTTGCCTC
TGCTGCTCTACCCCTGCTGCACGTGGAGTCCCTCCCAGGGGATGCTGTCCTTCCCCAGCT
GACGCCAGGTGGGATCCCCGCTATCAAAACCTTTCCACTTCAGTCCTATATGCACATGCA
GAGGTTGGCTCCAGCCAGCACCTGAGCACCTGTATTCACTCTCCAGTAGGAGAAAAGAGA
AACCTGTGGGTTGTGGTGGAAATGGTTCTGCCAGTTTCAGTAGCTGGGATCTAATTCCAG
AAACTCAGAGCAGCCTTATGAAGGAGCAGGAGCATCTTTGACCTATAAGATGTAGCACTT
CCATATGCATTATGAGAAAGTGCTGCATTAGGAGAATAGCTAATATATGCTGTGCTGCTG
CAAAAGTACAGATTTGATTTGAGTTCTATGTATTTCAGTGATGATGATGATGGTGATAAC
AACTGCTTGGGCTCTGATAATCCAGAAGACTTCGATGTCAGAGTAGTGGTGAGTAAATAC
TCCTTAATTTGAAAAATACTGTAACCTTTTTTCTCTTTTGAGTTGTTAAAGAAGTAATAA
GTGACGTTTTGAGTACTTAATTCTTGAGCTTGGATCTGGGATTAACTGATACGTGTGGTT
CTGATGTGCAGTACAAGAGGAAGTTGGTTTGAGAGAAGTCTGCTCTCTTTGGAATTACGT
TGGAATGTTTGGAAATTGTGGCTTTCTCTGAAACATTCCTAAATCTTGGGAAATTAGTAA
TAAATTGTTACTGAAGTGTCAATTCACAACCAGACTTGTGAATATTGCTTTTTCATTCTT
AGGACAACAGCAGTTTCATCATAAGCAGTAAAATTCCCAACAAGAGGAAATCGAAGGCCA
GAACAAAGCGAGTGAAGTCAGCTGGAGTGGTTGAAGTAAAGAAGAGTGCTGCCGATAAGT
GAATGTTTGTGTGGTTCTCTTTGAGTGAACAGAGCACGAGTCAAGAAGGTGGCAGCGGTC
ACTTCTCAGAGACCTTATTAAGGTCCTCTTGGCTTAAAATGTTGGTCTGAAGTCAGCACT
GAGCTGTCAGCCAAGCAGCCTCATCAGAATGGCTTTAAGGTGAGTTTGTGTCTGAGACTG
TTAGAAGTGTGGCCCGTCTTTTTGCTAAGCACGTGTCTTCTGTGCTGTATGAAGTGTGTG
TACAAGCAATTGAGTGGCTGGTAATCGTGCTGAAATACCTGCTTCTGCAGCTTGATTTCT
GTAATCAACAGGTCGTAGAGCTACAGAACTAAAAGTTCCAGCTCTTGCAATTAAGCAGTG
TAGTACAGAAATGTCTATGAGCACATTCATACACATAAGTGCAGTCATGCTACAAAGGAG
AACTTAGACCCACTTTTCTCGTGGCTTTGTGAAGGAAGCTTGAGCTTTCCTTATTGTAGC
TTGGAGGGAAGTAAGGCTTTTTAAGAATGATACTTAAGGGATGTTTTTTTCATAAAATTC
TTGCAAAATCCCTTTGATACATTTGAAATGATGAAATAATTGCTTATGGTTAAGGCTGTC
TGTCCATCAGTGTGGAATAACACTTCAGAAAACTAATTCTCCTAAATCCAGTAGAATAAT
CTAAAGTTGCTTTATAACAACTAGCAGTGTGATGGAAAGTTCTTTTCCCTTCTTCCCCTC
CTCGGTCTAGAATGGGGTCTTAAGGTGACTGGGCAGAAGATGGGAGCCCTTCAGAGCCCT
TCAGCACCATAGGGACTATCTGCTGATCTCATAGCATGAAGGGGAACTTGCTGCAGTTGC
TCAGTCTAAAAAGAGTTGAAGTTCTAAACCTTTGCAAAAGAAGCTTGAGATTTCCCTGTT
GCAGCTTGCTAGCTCTGGGGAGTGAGACTGCGAAAATCCTACTCTTTGCTAGTTAAAGAC
CAAATTGAATAATGGTCCAGAATTAATGGCTAAATACAACTCTTTTAGGCACCTACCTGA
GAAATACTGCGTGGCTTGAAAGACTCATCCTAGAACTAGGAGTGGGGTTCTGGCAGGGTA
AGGCATAGTGAAGTGGGTGTGGAGTCCTGCTCATTCTGCAGTTCATGTGATGAATATTTC
TGTTCAACTGCTGAGTGACTCAGAAATGAACTAAATTTCAATTCTGATTAGAACTGGATG
TACACATCTGAAAAGTGAGTGCATTACGACTGTCAAGTTTATTGCTGAAAAGTAACTTTT
GCCTTTTACGAATCTCAGTTTATTTGACCATAATTGATTTTTATTCCTTTCATTTTTTTT
TCCAGTGTGTTGCTTTTGGATGATGAATATCGATCAAGTGCTGTGTGAGGTAAGCTGTTA
CTTGGTGTGCAGTTCTTTCTCCAGGTAGCTTGTTTGCTTTACCTCACAACTCCTATCAGC
CCAGCCTGTAGCCTATGTTAGAACAGAAACTAAATATCACTTCTTTAACATCTGTATATT
AAAAGCAGTTTGTGTTAGCAGTGATAGACAGCAATACTTGTTTCAGCTGGTGTTGAATGC
TGCAGGGCATTCATGATTCAAGATGAACCAACTGTGGTTGATGTTGGGTGCTCCCTGGAG
CCTTGTGCTCCTAGTGGAGATGTCAGTACTGATGGCTCAGGCAGTTGCAGCATCTGATCA
ACTGCCCTGTGGTAAAACTGCAGGAGGAAGGAATGTCAGGAGGTGGTCTTGGATGTTACT
GCTAAAGCTGTGGAGCTTCTCACAAAGGGATGATCTGTGTGTTATCAGATGTTATCAGAC
CTTCCGGAGGGTCTAGGAAATAGGGTAGAAGAAAAACTTCAGGGTTACTTTTTAACAGGG
GGAGCCAAGAGGTACAGCTACACCAGTAATGAAAATAAGCATGTTTCCTTGTAAGAGGAT
CAAACTGGGGCATCTGCTTTCAGCTTTTGTTGCAGTAAAGCTACTGGAGTAGATGATGTG
TCAACTCAACACAGTGTATATTGTTCTTACAACAGTATCTGATAGTCATACTGAGCTTGT
TGTGCCTGTTACCATAGCCCAAATCATACCTGTCTCTTAAAAACAGGAGGCCCAGTAATG
GATGGTGACAGTTATGGAGTAAGTATATAGTTGACTGAGAAATACCTTTACTTCTGTGTG
CTCTTCAAATACTGTTTCAAAAACAGTGAAAAATAAGAGGGAAGCAGATGCATTCTGTTT
CAGCACGTGTTCAGTTTTTGTCTGGTGCTGTAGACAAAAACCTGGAACCTGGTGCTTAGA
AAAACACCTTCTTTCGCAACCCACAGCTGATGCATGTATTGGCTGTGTTACTTATATGAA
GGGACAGTGCTTATATTTATTCAAGCAGTAATTAATTCAAAGGGCTCATTTCTTATTGCA
TGTGCAGAAATGTAGGAAGGAAACAATGCAACTGGACTACATCTTTTCTAGCTCTGCAGC
AATGAGCTATTGTAACCGTTTTGATCTGTTTGAATTCTTCCAGCTGGTGCACAGATCTGT
TACTTCCATGCGCTCCTGTGGAATACACTGGTTAAGGAGGTATGCTTTGTTTCTGCTGAG
TTTTGGTATGAGAGAACTTGGGTCTGTGCCTTCTCAGAGAGGCTTTGGTGGAGCTTGACA
AACACAGCAGGGGGAACTGTTGGACAAGTGATGTGATAAAAGTGCAATTAAGTTGATGTT
GTTCTTTAATGTTTCTTGAAGTGGAGGAATATCTGAGGAAGTTTTTTTCCTATGGGGTGG
TTGTTGTGTGAGGACTGTAAGCTGAAGGTTTAGCTGTTCTGTGGTTTTTTTCCCCAAAGA
AATATTTCATGTGGAAGGACAAAGCCAGTTCCCAGAAGGCAGTTAGTGATGTGTCCATGT
TAGAGATGATTGGCTGGGCTTTACTACAAGCTGTTCTGCAGGTGTAGTGAAGAGTTAATT
GTTACGCCTTGTTATTCAGCAGGTAGACACAACTCCATGTGTGTCTCAATTGAAGAACGG
GGCTAGAAGAGCAACAGGTTGTGCTTTCCTCACTGTAACACCCATTGCAGTGGTGACAAT
GAGACCTGTGACAGGTTTATGTAGTGAGAGAATTGTGCAAACGTGGTTCCAAATGTAGTT
ACTCTTTAAAGTCTGAAGGATTGGCATGTTTGGCGTTGTGAATTCGTGAATTCATAGAAT
CACAAGGTTGGAAAGGACCCACAACCTTTCAGTCCAACCATCCTATCACCATTACTATCC
ACTAAGCTACTAAACCATATCTTGCAGCATTCTGCATCCTGCTGGCTGTGGGAAGTAGAA
GAAAAACACACAGTGCTGAATTCTGTAAATAGTTCATCAAAGCACACTTAGAAGCTGTCT
TAAGGTGCTGTCTTACAGTTTCTTTACACCACAGTGCCAGCTGATGTAGGTAACACTCTC
ATGTGCACCATCTGTGCCATAGCGCTTTGATTTCTGCAGTGTGGGTGGATTTGGTTGATA
GTTCTGTGACAGACTGATCCTGAAAGAAGTGCTGCTTATTCAATGTTGAGAGTACTTGAA
ATTACTAAAATGCTGAAGAAACTTAAAACTGTTAATCAGATACTGTGATCTACTCTTCTT
TTCAGCAAGCCCACGTGACAGTGCAGACCAGAGGAGTGCCTTAGTGAGTTTGATACCAGA
TTAATGTAACCACTCTTAGTGTGTTAGATGTTTTGCTTCAACTTTCTGAGCTGGCGTATG
GCTGTTCTTACTGAGTCCTGCTGCATCAGAAAAACTGGCTTTTAAGCTTGAGACTGTCTG
AGGAATTTGTTGTGATGATTGGCAAAATGTTCAACTGCTCTGAAGAGAGTGAGTGAGAAT
GGCCTTTCTGAACAAATGTACTGCCTGACTTCATACTGTGTATCCGTGCTGAGGATGGAA
CATGCAGAATGTTGTCAGTGAATAAAGACTAACTTTTTAGTTAATAAAACTGTCAAATAA
CATTTTTAATGTTCATTGTAGTACCTTGAAGTGTGATTGCAGTGGGAGAAGTCCACAGAA
ATGCCTGTGATGATTAGAAATGACTTCTGAAGGTTCTAGAATTCACTGCTGTAGGTTCTA
CCTGTATGCGCATGCATGTCATTTTGTAACCCTGCAGTGATGTTGCTTTTTCAGGTGGCA
GGTGATGAGGAAATGAGAGAAGAAATGCAGAAAGCCACTTGACAGAGACAGGAGCTCCCT
TATAGGTTAGTATGCCATCTGAGCTTCTGCAAATGCATTGGTGTTTGAGGGGCTCTGGTT
TTCAGTGGCTGGAGCTGTTCACCTGATGAAGCTCAGTGCCTTTGGGAGTGTTACAGGGAC
AGAGCTCAATGTTATGTCAGTATATTTTAAGGTAGTGTTCCCTTTCAGTCTGTAAGTCTT
TAACTTTGATATATCCCAAGAAAGATCTCACAGTCTGAAATGATGAGCTTAACTTGCCAA
ACTTGGGCTTTACTTTAAAAGTAAATGAGTACTTAGAGAAGTTAGTGTTTGAATAAACAT
TGTAGTTAATTCTCTCAGTTTTATATTGTTCATGTAATGTTAGCTTTTAACATGAAACTG
TTGCTGATGTGGAGTTACTGCTGCATCTTCCAAATGAAATGGTAGTGTAACATTTCCCTC
CCTTTTCCCCCAAAAGTCATGACAGAAGAAGGAACTTTATAGGAACTGTATGAGATGCTT
TTCCAGTCTGCTTGATTTTTGTTGCATTAGTTTATGGTCACAGAAATGTTGAGGTCTATC
CCGATAGGATCTCTTCTGTAGGTTCATGTCGTTGGAAACGCCTCACAGAACAAACTTGTG
GTTTAGTTTTACCCTTGGAGCTACCTGTTAGCTCTGTGGGATAGAACTACAAGACAAATC
TTCATGTCCCATTTCAGGAATGGAAGTAACATGTCATGTTCTCCCTCAGGTACTGGCTCA
TGCATTTGATATAAATGGAAAAAAAAAGATTCAAATGGAAAAGCTTGGTAAGAGTGAAAA
AGAGCATGTTCTGAGATTTAAAATGTAACTAACATGTTTAATTGTGTGGGTTGAACTTGC
TCTTCAGCCAGATGTCTGTGAAGGTACCAGACCTCTTAGTGGCTTTTTTTTTTCCTGGTT
GGCTTGAAGCAGACTCTTCCCACTTCAATCTGAAAGTGACTTTCTGTTCCTTGTGGTGGC
TATAGGTTTAAATTAAGAAGTCCAGCCCTCTGATGTCTGTCCAGTCTTAAAGTAATTCAA
TGAGCCTGCCGGATTTTTGCTCTATGTAATTCAGCAATACTGCTTTTCTCCTGCTAAGCT
TCAAAGTAGCTGAGCATCTCAGGCAGTTTACTAGTACAGTGTCAGAAGTCCTGGGTTGTA
TGGAGCATTGTGCTATTCTATAGAACATAGCTTAAAGTAAAACGCAGACAATGCTTCTAT
AAGCCCTTTGTGCTGGGAATATAAATACTTGAAAGAATTACGAGGCTGCTGAAATTGATG
GAATTTCTTTTCCCTCTTCGTTGCATGGCAACTTCTGTGAAATTGGTACTTCAGCTTATC
GCTGCCTGGTGTATGGACAGCTTGAACCTTAACGTGCATTTGTTGACTGAGGACTGCTGC
GTCTGTTGCACTGAATGGTATCTGCACCCAGCAGCGTTCTTCTGATGGGGTGTTCAAAAA
CCAGTGCTACAGTAATTCAGCATTTGGCATCGTTGGTTTTCACTCTGCAGTGGTTGTTAA
ACCTGGTATTCTTGCTGATACAGGTGCTGCCCTCTTCAAGGATTTGAGCGCAGTCCTTTT
ATGTCGGGTAGGACTTGTCAGTGTGAGCTGCCCACTGGTTCTCCCTCGTGCTCAGTTTGT
TTCTTTAAAACAGGTGCCTTGGGATACACAACAGTCAGTTGGCTGTGGAAGAGGAAACAA
AGTGTTGGACAGGTAAGCACTGAGTTCTCAGTTCAGAAGGTTTCAGGCAACTTGATGGAA
GCTCGGTTGCTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1200, 1298..1457, 1497..1757, 2033..2208, 3038..3107, 3422..3698, 4865..4908, 6043..6098, 7145..7182, 7674..7744, 8449..8493
1133..1200, 1298..1457, 1497..1757, 2033..2208, 3038..3107, 3422..3538
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved