Gallus_gallus Locus ENSGALG00000017100
snOPY snoRNA Orthological Gene Database
Gallus_gallus ENSGALG00000017100
Gallus_gallus
ENSGALG00000017100
1
SNORA27
3741..3873
6560
AACTGACTCTTTGAAATGTTGAGCATCAAAATAAATGTTAGAAATGAGAACAATATTGA
AATTTCAAATAAAGCCACCGTGCCATTTATTCAGGGGGAAAAAAAATGTAGCAAATCCTG
AATGTCTGACTGGATCCCAAGTAAAGCAGAGTTCAATTCAGTTCATAGTTGCTGCTCCTT
TATGAATTACACTTACAAGATCTGTACGCTGAAATCTGTTTCAACATGTGGAGTTTCTTT
CCCATTCTTTCCTGCTCAATGTGGAAATGCACCCTTTATGAAAATCACTGGCAGGAGGAA
GGAGTTCAGCTCACTGAAGATAACGATCTTTCTTTATTCAATAACACCTTAGGATTGGAT
TTAGCCTCCTGTCTTCGCTCTGCTTGATGTCCTTCCTGACATCTCTGTTGCCAATATGTT
TCTTCACCCAAGGGCTGCTCAGCCTTCCTCCAAGCCTGGGGGCATTTCCTGGCACCTGAA
TGCTTATTGAATGATACAGATTTCCCTTGCACAGGTATCAGAGATATCAGGTTGGGCTTT
TTTCATAGCGCGGAGCTGGAATACAGTCTGCGTGTTTCCAACTACAACAGTTTAATGGAT
TTTGTGCACAGACAGGGCCCTTCTGTGTCAGAACATGCTCCGCCAGCTAGTTCTGCAGGC
AGAACCTGACCGCGCACCTCATCCTCCACAACCATTGCGGCCCATGAATATTAAACTCGC
TGTAAACGTTGACAGAAAGGGCTTTTAGGCCTGCGTTTTGCAGGATACACATCAGAATAA
CTGTGAAGTTAGTAAGGGGATCAAATACATTTTTATCTATTATCTTTTATCTATTATCTT
TAAGTAACAACCACTCGCCGCCCTGCGCAGGCAGGCAGCGGGCAGCCCGCCGCACGCTTT
CTGTCAGGCGCAGGGCGGGCAGCCCCGCCGAGGCCCCGCTGTTAAGGGCGGCCGCGGCGC
CGCCTCTCTCCTTTCGGCCCGCGCCGCCATCTTGTGAGTGCTGGGCGAGCCACGCTGAAG
CGTGGTGGCCGCTTTCAGGTGGCTCCGCGGCTCCGGGGAGGGGACGGGAAAGCGGCTGGA
GGGGCCGTGGTGGTGGTGGTGGGGTGGTTGGCTCGGCCTGGGGACGGCAAAGCCCTACGG
CGGGGGATCGCTGGGGGAGCAGGGAGGCCGCGGCCTGCACGGCGCGGTGTGAGGCGGCGG
GCCGGGCCGGGAGGCGCGGAGGGGAAGGAGTGTTAGAAGGGCTATGGGAAGGAAGCGGAT
AGACTCTATTCAACAGGGCCTGTTGCGATGGGAAGAGGGGAAATGGTTTCAAACTAAAAT
ATGAGAGCTTTGGGTTCGGTGTAAGAAAAAAGTTTTTACTACAAGAATGGTGAGGCGCTG
GGGTTGCCCAGAGAGGTGGTGGGTGCCTCTTCTCTGGAGACACTCAAGGTCAGGCTGGAC
GGGGCTCTGAGCACCTGATGGAGCTGTAGGTGTCCCTGTTCAGTGCAGGGAGTTGGACTA
AGTGGCCTTTAAGGCTCCCTTCTAATTCAGTTGATATTAGGGCAAGTGGTGTAAATCAGA
ATGGGAGCAGTTCCAGCTGGATGCAGGGGGACACGTTTCTGTCATCAGATCAGGCCTCCA
AACAAGCTGAGCAGGGAGGCTGTGCTGCATTTTCCCTTCATCCCTAAAGAGTTTCAAAAG
GACCAGGCAAAGCCCTGAGCAATGTCTGCTGTTAGTTTTGAGAAGAAGGCAGGGCTAGAT
GACTAGCTAACATCCCATGTAACCTCTGTTATAATCTTAAATAGATACTATATATTTTTT
CCTTTCAGTGTCTAGTAACATGTGTTTTGACCCTGCAATTTGGAAGTGGTATCCTTCTGA
TCGGGCCTAAGCTTTTCATTTTTCATTGGGCATGTTTTTAGTGAACAAACTGGTCGTCCT
GATTAATTTGCATTCATTTTTACAGTAATCAGCCAAAATGACGAACACAAAGGGAAAGAG
GAGGGGAACTCGTTATATGTTCTCGAGGCCCTTTCGCAAACATGGTGAGTATACGTTGTA
GTGAGAGCACTGTTTTCAGTTACTGACCTGTTGGGTGTCAGCGGTCCCCAGGTAGTAATA
GAACTGCCAGATTCTGTCAAAAGGTATCTGGCAATTTAGACCAAAACCTACAGGAAGGTA
TGTGGGTAAACTTGCAGCTCTTACAGCTTATGTATTAGCATTCTGAGGGCAAGCAGTCAT
TCAGTCATCAGTTGAAAATGAATTTGAAGGTGAAGAAAATAGCTAAAAACTCATTTTTAC
TTCAAATGTACAGTTTGCCTCTTAGCAGTGAGCAGTGATAACAGCTATCTTCAGTGATGT
AGTAAATAGATGTAAAGCTATAGTTTTTATTCAGCTTGATTTTTAATTTTTTTTTCAATG
TGAAGTGTATGAAGAGGTAACTACTGCTTAAAAGAAGTTTGGTTTCTGTTTTACTTTCTT
TGAGATTTAATTTTGAAATTGAGCTTTTTAAAAATGAAATATTTTAAAATGTGGGATCTG
TTTTCTCCTCTCCTGTTTTTATATGGGTGTGAAATGTGAGCATCGTAGTATCCATGTTTG
TATCTCTCAACAGGAGTTGTCCCTCTGGCTACCTATATGCGCATCTACAAGAAAGGCGAT
ATAGTTGATATCAAGGTACTTTCTGAGATGGAGTGTAACTGAAAATACCTGGAGCAGTGT
CATCACTTCCCATTTCTAGTTTTTTGTGGTAGTCTTTCCGTTATTTGTGTCATGTGTGTC
AATACAAATACCCTCTTTTGAAATAGTAGTGCAACAACAATGCTATCGAGCCAATATTAA
TGCTTCAACGTCACATATTTTTGTACGTGTAATATATATTAGACTATGAACTGTCAGTTC
AGATGAAAAAAGGTGAGTGAAATATGCCATGTCTAATACTTGGGTTGTTGCATTTTGCCT
ACTGGCACTGCTTGTACAGCTGTCATTCTAGTAGTTATTCAGTTTTGCCTAATTTGCACG
TGCTGTTGAAAAGAGCCATAGTTTATGCTGCATAATTTATGCAGTATCATTTCCCATTAA
TTATTTTCTAGGTGATTTTAAATGATATGCCCTATACTTTCAGAAGTATGCTGTGTTAGC
TCTGAAAGTGTTTTGCTGAGAAATCCTGCACTGTTGAATCCTTGAGTTTCAGTTTGAGAC
ACCAAGTTATTAAAACAGCCACAGAGAAGTTGGCATGTAGTTTATGGGGTTGACTTACGC
AGAACTATGCCATTCAAAATTACTGCTTCTTGACATTCTGGAGCTTGATGATGATTGTCT
CCTATGATTGCTTGCTGAAAGCAAAGTGATCAAATCATTTCACCGGCACTGAAAGCGACT
GGAATGATCACAGAACTATTTAATAGTTTCTAGGTATAACGTGTAGCTATAAATTCAAAG
GTATAAGCAAAAAAGGAGCACTTTTAAGTAAGTCTTAAATAATTTGATATTTCTGTTATA
AATAAGCTGTGAAAGTCCCCTGGCATTGCTTTAATGTCTTCAAGTTAAAGCTTGTAAAGC
TCTGCCTTCATCCTTGTTTTAACAGGGTATGGGTACAGTTCAACAAGGTATGCCTCACAA
GTGTTACCATGGCAAGACTGGAAGGGTGTATAATGTTACTCAACACGCTGTGGGTGTTAT
TGTTAACAAGAAGGTTAAGTAAGTATCAAAAATTCATAGTATAAAAACTTTTGTTTTGGG
GGGGGAGTTGATGTGTAATGACACCCTCCTTTCACTTTGCCAGTTAGACACTTTTTTGTC
TTGATTGGTCATTCAAGGTGGGTAAAGTATACATCCTTTTAAAACCCAAGCAAATGGTGG
TCATTTGTCTTGGATCCTGTCAGAGGAAACAGGTCTTTATTCTTCTGAGCAGCACTTAAT
GACGGTACATAACGAGGATTGTCACCTGACTCGCATTTACACTGAAGACTGTTGTAACTG
CTGTTATGTGGCCATATCCAGCTGTATTCATCTGATTTTCACAGTTTCGTCAGAAAAAGA
TATTTTTTTGTTCCAAGAGTGGGACTGAAGTACAGTGGTAATAGTGAACTCGTTTGTATA
GTATAAGGTTAAGGTTACTTCTTCTCCAGCAACTTAATCCTAAATTGTCAGCATGTTGTT
GTATATTGATAAGCTTTCACTTACATAAATACTACCCAATTTGCATCCGCAGCAGTGTAT
TCTGAGTGATTGCCATTTGATGAATAATGATCTGTAGTTGAGCTTATAGGATTACTTCCA
TAAATGCCATACAACTGGCTTTGAAATGGCTGTTCTTCAAGTGCAGTAAATTAAAAACGG
ATACTTTTCTCTTAGGGGTAAGATTCTTGCCAAGAGAATTAATGTGCGTATTGAGCATAT
TAAACATTCCAAGAGCAGAGACAGCTTTTTGCAGCGTGTGAAGGAGAATGAAAAGAAGAA
AAAGGAAGCAAAAGAAAAAGGCATTTGGGTTCAACTGAAACGTCAGGTAATATTTTTAAT
CTAGTTGATAACATTTTTGCTGCAACTGGCTAAAAAGAAACAAGGAAAAGAAAGCATGAA
ACCTAAAAAACCACCTAGAACCAAATCAATTAACTAAAATGTTCTCTTCCAAAACAACGA
AGCATTGTGCTGTAAACAGAACTTTTTGTCTGCTTAAAAAAAAAAAGCCACCACCAACAA
AACACGTTAATGGAGCTGAAATCCAGGTCTATGACAGATGGTGTTGGAGGTGTCTGTAAC
CACCCTCGTTTGTTTCTATTCCTTTTGTAGGAGGTTCCTCCTTCTTTTAGAGTAGAGTGA
CAGCCTGCAGTGTGTCTCCATCTGAGCTGTCTGATATGCTTGTTGGCTGAATAGAACTGT
GCTGTTCCTGGCTGAAAATGATGCCCTTGGCTGTGAGCAAAGGGACAGCTGCTTCCTGTT
CAGGCATCACAGCTAGAGGGTTGCTCATCAGCAGCAGAAGCTGTGGCCAATTTCTAGAAG
TGATGTTGTGTTTGGTTGAGTTGAATTTAGCTGCAATAGAAACTGTTAAAACTGAGTAAC
TATAGACTTCAGAGGGAAGGTAATAGCTATTGCTTATGGAACTAGAGGGTACTTTTTGTT
GACTTGGATTAGTAACTCAGAGGCTGAATTGTAGTTGTCTCCATTCAACAGTAAAAGCCA
AATCTTACAGCAGATTCCTTTTCTTACAGCTGATCTTCAAAGCAGATTTTAGAGAGACTA
GCAATGATAAAATTGCTGTGATGTTTGTATGATAATACATTAAATTTGGTTGACATGAAT
TCTGTGTAAGGTTTCCTTTGAGCTTTTGTGCCCTGAATTCTTTCTGTCTCTGTTTACAGC
CTGCTCCACCAAGAGAAGCACACTTTGTGAGGACTAACGGGAAGGATCCGGAGCTGCTGG
AGCCAATTCCCTATGAATTCATGGCGTAATGCACGTTTGAATAATAAATTAAAGATCTGC
TTTTGGATGAGTGTATGTGATTGTGGCTCATTCCTTTGGAGGCTTTTTTTTAAACAGATT
CTAAGAAAACTTTTTCTGGGCTTATTTCTTTAGCTTGCATTACATAGTGCTCGGTTGTTA
AAAACATAGGTGCCTTTTGCTCAGCAGTTTAGTCATTTACATAGACCAGAAACCTTGGGG
ATGCTGATATTTGCTATTGCTCAATGATGATCATCCTCCTTTGATTACCTGGTGAGGTAA
TATGAGAGGACATGGAATAATTTCACCGGCGAACTGAGAGCAAATAGCAAGAACTGTATG
GTGTCTCTTCAAGGTTTAATTTTTGTAGTGGGAAAACATAGTTGGTTTCAGATATCATCA
ATAGAAGCTTTTGGCTAAAGGGCCTCAGTTTAACACCAAGGAAAAATTGGGGAAGCAGTT
TTTTCAGAGCACTTCTGGAGAAATGGCGATGGGAACACAGTTGTCTCACCGCTGTAGCCA
CTAAGAGAAGGATTTCTAGAACATCCCAGGCCAATATGCATTCTTAAGAAATAGTTATGA
AACAAAGCCTTAATTTCAAAACACTGAGCCTTTGTCATTTGTTTCTTATTTCTACACTTG
GCACATTTTGTTTATTGCACATATTTTTGTGGGTTTTGCTTGAAACAGTGGTAAAGCTCA
CTGAAGAATCTGCTTAGAATGCCTTGATGAAGATGGAGCAGCTCTTACCCGTTCATGTGC
TGACAAAGGATGGCAGTGTTTTTACTTTGACGTTGCGTTTTAGACATGGAGTGCACTGCC
ATCACTGGCAGGAAGCAGGCTGACTGTTCCTAACTTGCTGCTGCTTTATGCACTTCAGCT
TTTATGAACAAATGCATTTGTCTTTGAGCAGTTGGATGTATATACTAAACTGTAGACCGT
TACCAGCTTATTTGGCTTGGGAGCTTCCACAGCCATCTAAAATAAATGTTTGACTTGTAA
GGTGGGCATTTTCCATTAGGCTTTGTGTCTATAAGAGTTAAATGGGATGCATAAATGGGA
ATGCTCCTTGGGGATGATATATCCATCTGTTTTCCCCCTGATGCATGCTTGTGCAAGTTA
TTTTATGCTTTATTGTCAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1945..2023, 2593..2654, 3565..3677, 4335..4485, 5339..5560
1948..2023, 2593..2654, 3565..3677, 4335..4485, 5339..5425
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved