Gallus_gallus Locus NP_001006236.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001006236.1
Gallus_gallus
NP_001006236.1
1
SNORA53
7384..7624
10195
AGCACTGGAATGGGCTCCCCAGGGAGGTGGTTGAGTCACCGTCCCTGGATGTGTTTAAG
AGCCGTTTGGATGTAGTGCTCAGAGATACGATTTAGCAGAGGGTTGTTAGAGTTAGGGTA
CTATGGTTAGGCTGCGGTTGGACTTGATGATCTTTGAGGTCCTTTCTAACCTGAGTAATT
CTATGATTCTATGAAGATACATTTCTTCTGCATTGCTGAATAGGTGTGCTGTTAGTTGTG
TAACTGCTCTGAGCCCTTTTCTAACATAGGACATTCAGTGCATGCCTTCTGCTTTGCTGT
CTGCTGTGTCTGTGTTACTGAAGGAGGTACAAAGCTGTGCTGCTGAGCGAAGCCTCTTGG
CAAAGAGCAAGTAGCAATGCTATTTAACAAGAGATGCAATTCAGAGCACTACCAATCACT
TCTTCGAACTTCGCCTGAAAGCAGCGCACGCTTAAAAGCAGAAATTGCACTTGGCCTGGA
ACAAGTAGCGCCCGGCCCCAGCCTGCAGGCTGCGGTCACGCAGGTAATGCTTCTGGCGCC
TGTCACGGGCGGAGCTGGGCGTGCCTTTCGGTTGCCATCGCTTGGGGCTGCGTGCAGGCA
CGCGGAGGAGCCCGCAGCCGCGGAGCGGGAAGAGCCGCTCGGCGCACGGCTGAGGGCGGC
GGCGACAGAGGTACGGCTGCTTTCCCACAGGGAGGAACTTTTCCAGGGCAGCGGTCACAC
GCACAGGAGCCACGGCTCTTTTCTCGCCTGTACTTTTTTTTCCAAGTGAGACATACGCAA
CCTCGCGGCGCTCCGTACGAGGCGGGGAACTCCGCCCTCCGCTCAGCGACAGCCGCCCCC
CTCCCCCACGGCGAGAAGGAAGGGCGTTGGCGTGGACCGCGCGTGCGCGGCGGCACCGGC
TCGCGGGGAGCCTCCGCCAATCGCCTCGCGGCTTCTTGGCCCGTGGCTCCGCCCCTTGCG
TCGGCGAAGGACAAAGTCACCGCGCCGGGCCCGCGGTCAGCCTCTGCGCACAGCTGCGGC
CCGAGCAGCGCTGCGCGCCCGCCGCCATCTTAGGAGGTGAGTCGGGGCGCCCGGCCGGCG
GGGCCCGCTACGCGCCTAGGCCGCCAAGTGCGTGCCGTGTACGGGGCCGCCGGGCCGTGC
CGTGCCTGCCGTGAGGCCTCGCCGCCCCATTCCGCTCTTNNNNNNNNNNCACAGTCTCCC
CGGAGAGCCTCCGCCAATCGCCTCGCGATATCTTGACCCCGTTGATCCGCCCCTTGTGTC
GGGGATGGACACAGTTCAACGCGCCCGGGCACTCGTTCAATCTCTGTGCACAGTTTCGGC
GCGGGAAAATAATGAGCGTCCGCATCCATTTTAGGAGGTGAGTCGGAGGCGTCCATCCGA
CGGGGTTCCATTACGCGCCTAGGCCGCCAAGTGCGTGCCGTGTACGGGGCCGCCGGGCCG
TGCCGTGCCTGCCGTGAGGCCTCGCCGCCCCATTCCGCTCTTCTCGCCCGCCTCAGGTCG
CCATGTTCTCGTCCATCGCGCCGCTCGCGCGGCTCAACCCCTTCTACGCGCCGCACTTCC
AGCTGTGCCAGGATGGGCTGAGGAGGCGCGCGGAGCCGGCCGAAGCGCCCACCACGCGGC
GAAGCCTGGCGGCCGCGTCCGCCACCGAAGGTGAGAGCGGGAGGGAAGGTCACGGCGGGG
CCCGCGGCGCCCGCGCTTCTCTGCTGGAGCGGGCCCGTGCCTGTTAGGGCGGGGAGCGGC
CCGCTGCGGGATGCGGGTGGGGACGGGTCGGCGCCGGGCCTACGCGCGGCCGCTTAGAGG
ACGAGGAAGGGCACGCGCGGGGGAGGCGCTGGCGGCCCCTTCCGCTCCCCGGCGGGGCGC
GCCGAACGGCACCGCGCCTCGAGCGCTGCCGGCGAAGGACGCGAGAAGGTCCCGGGTCGG
AGCGGTGGCGGAGGCTCCGCTGATGGCTGCCCTGGGGCTGCCGGATCGCTGCCTCTGGCT
CGGCTGGGCCTATAGGCCCGTGCTTCTGCCTGCGGAGGAGAGCAGCATACAAATCAGCGA
ACACGGGTGGGTCTAAAAGATCCTTTTCGTGTTTGTGTGTTATATTCGCGTCTGGACATC
CACGCACGTTGTAGGAGCCTGCAGCTATTCTGTGTTGTTCTATTGTTTTTTCTTCTCCTT
AGTAGTTCAGTAGATAGAGGTGCACAAGATGGCTGTGAAAAGACACAGTGATGCTCCTTA
GATTTAAGTCCAAGCCCTTCCTGCGCGTTACCTAATCACTGCTGTGACTTTCAAAGGTCA
GACCTTCCAGTAGTGGAAGTAGATGTGAAAGCTCACATTCCTATAAGCTGCCTATAGGAA
AATGTCTGCCTGCTTTTAGTAAAAAATTCCATACTATAAAGGGCTCTGGACAAGATTTCA
CTTGTAATTACTGAAGCTAATTACTACAGCCCTGTAATTACTGAAGTCTGTTAGTGCTGT
TGTATGAATGTCCATGTAGCGTTTGAAAAAAAAAAAACAGAGCTGAGTGTTGGGTTTCAC
TGAATTTAAAAGAACAAACCTTGGCTTTTAGTAGCAGTAGTAATGTTGCTCCTAGCTAAA
TAAAGCCCTAAATTACTGTTCAGCATGTTAAATATATCCTCTATGTGCACTTATTTCTTA
GAAGCATTGTGTTAAATCTTCACCCATTTTGTGGGCAGATGAAGTCAGAGATGATATATA
TGTTTCTTTGTTTGTCCTACTATTTCATTGTTTCACTTACTAATTGGTACTCTTGACCTT
TGTGTTGGGAGAGTAACAAAAGGTATCTGAGCTCACACAGCAAGGTCACATAACGTCATC
AGTAGAACCCACAGGACCTTTCAAGTTCAGCTCAGGGCATCAGCCATGACAGAGCTCTTG
GAATTTGTTCTTATTAATGGTTCAGATCTAAAATAAAGATAACAGCTATGTTACAGCTAG
GATTATTTCACTTAACAGACATGTTTTTGTGCTGTGTATTTATACTTGAGTAGCTTTGGG
GCGTTTGTTGTAAGTCACCATCTAGGTACGTTAGGATGTCTTTCCTGTTATTTCCTCTAC
TGCAATGTTAGCTCATTCTTTTCTCAGGTAACAGTTGTTAGGGAAACTTCATTACGTTTC
TGAAGTAGAAAATAAGGTATCTACTCTGGTTGTCTTTTCCTAATACTGCTCTGCTGCTGC
AAACGTAGGTACACGTAAAGAGTATAAGCCATGAAATTTCATTTAACAGAAGCTGATTAA
ATCTCAATGTCTGAGTTTGAAGGAAAAATTCATCTACGTGAAGGATCTGAAAAATACCTG
AGAAAATATTGTATAAAGGAAAACAAATCCAGTCTTCGTCTGATTGATTGTGGAGACCAC
ACAGATCTGTATTAGTGTGAAGGATTATTAAGCCATAGTATTTAATTCCCTTAGGTAGTA
GTGGCTTAAAGAAAAGAAGTTTTGCCTCTAGAATAATAAATGCTTCCTTTGCTTATTTCT
TTGATACAAGAAGACGTTTGACATTGCAGCTTTGAGTCATAATTTGTACTAGTAGTTATG
GAATTGTTTTCTATGACGTAACTCTGCTATGAGCTATAACCTTGTATATTTTTATTTTTT
CAAAGAATCAACTCAAGTTGAATGGCCTGGAGTCCAATCTTGACAGTCCAGAAGGTGTTA
AGTTAAAAACTAGGCGACTATTTCTAATATAACGCTGTAGTTAAATAGTATAACGTGGAA
GATTATTTGAATTTAATAATTTTGAGAAGGTAGCACTGGCTCAATTTTGTTTCTTTTCTG
ATCTTCATTACCACGTCTGGCTGATATGTAATTTTTTTTTCTAATTAGAATACAGCTGTG
AGTATGGCTCGGGCAGATTCTTTATGCTCTGTGGTTTCGGTGGGATTATTAGCTGTGGAA
CAACACATACAGCACTGGTTCCTCTAGACCTGGTTAAATGCAGAATGCAGGTTTGTTCTG
CATGTGGTGAAGTTGATAAAGTGTGCTTAGTGTGAGATTAATTAATCTACTAATGAAATG
GAAGCTTAAACTATCTCTTGGACACCCTTGTCCAACAATGCATGGAGTTTATGTAAAAGC
ATGGTGTGTCTTTATTTTTTGCTGCAGAATACAGTTGTGAATATGGCTCGCTCAAGTTTT
ATGCTCTCTGTGGCGTTGGTGGGGTCCTAAGTTGTGGCCTGACACACACTGCTGTCGTAC
CTCTGGATTTAGTGAAATGTCGTATGCAGGTTTGTATGAACTCAGACATTTCTTAAACTT
TTTCTGTACGTAGCCAGAGTAGCATGAGTTCACAGTACCTTTTCTGGATGCCACGCAGCA
AATAAATTGAACGCTGTTTGTCAAGATGTGAGGCTAGCAAAATACCACATTCAAGGGAAG
CAGAGTCATTTAGGTTAACCTGGGTAAGTTAACTGTGTTTAAGATAAGCTTAGCTCACTG
TATTTCCAAAACAACACCCACCACAAAGTTATTCTGTGCTGACTGGTGGGCTGCTCTGCG
CAGTTCATGCATTTCAAAAGAAGGAATTTGTATCATTAGTGTTTTGAAGACTTAATTATG
TTTTTAGCCTGAAGAGTCATGCATGTATAATTTGAGCCATTAACATTTTGGATATCGCTG
CATGAGTTACGGCTTGGATAGCTTCTAATGATGACATTTTCAGTATAAGGGGTAGAACTT
TGAATTGGAAGTGTATCAATGCCTGTGTCTGGTTTCCTTGTAGTGATTGGAGTGGTTTTT
CACTGAACTGAAAGGAGTGAAACCTCATTGCACTTAATTTGTGATACCAACTCCAACGTT
AAAATAATCTGGTAGACAGCTGTGTGTAAAAACACAGCAATGGGTTTATTCAGGCAAATC
TGTGCCTCAAGAATGAAGCAAATTAAAGCACACTTCTAAGTCCCTGGAAACGTACTGAAG
CTATTAAAGCTTTGGTATTGTTTAGACTGACACCGATTCTAAAAATGGCAGTTTTGTAAT
GGTAGAACTCCTGAAATGAGGAGGAAACTACTAATTAATCAGAACTGCTAATCATACTAG
GAGGACTGCATGTGCTGTTCTATGAAACTGTTCTAGAAGGCCTTTAGCATTATTTACAAG
GAAAAGGGTTTTTGTGTGCTTGAGAACATCTTAAATTCTGGTCTCACAGTAGTGATTTTG
TAATGCAGTGGGCAGACCTGTTGTGCATCAGATGCAGGCAGTGTGATGCCTTTTACAAAA
TCTGGATTGAGGCTCAGCCTCAATCTGTATTTCTGCCTGTAGGGGAAAAGCTGTAGTTGC
ATACATGTGTTATTTCTGAAAGCGTAGCTTAAGTGAACCCTTCTGTTGTTACAGGCAGTG
CATGTCATCAAAAGCCAGGATAGGGAGTCTGACTTACACAGGCAAAGATGAGCTGCTTGG
AAAGGAGGAGATTGTCATGGGTAGAGAGGATGTAGCATCTCAAACAGTTCTTAATTTGAT
TGCTAGTTGGGTTAATGGACAAAAGGCCTGAGAGTCATGCCGTGCTGCATATACCACTGG
GAGCAAGGCCTCATAATTCCTAGGCTTCATCTGTTTTGTAGGTGTGTTTTACTTCTAGTC
CTGGGCATCTTATGAGATGAGATTGGTTATGTTTGCCCTTCCTTCTCTAGCATTTAGAGG
TGCAAAGAGGAAAGGTTCCATTTGGCTTCCAGTGTAACCTTGTAAAACCTGTCAGCATTT
ATCTTTTTACAGGTCCTGTAAGAGAGCATGTTATTAATTCTCCCTAGATTGTCCAGGAAG
ATAACTGTTTTCTGCTTTCACATGTCCCTCACATGAAATAGTCTAGTTTTACTGTACCCA
GTTAAATATTCAATGTTCTGAAACTCTGAGTCTTTTAAAATTGACATGTTTAGGTAAATT
AGTTCTCAGTCAGTGGATAGGCTGCAAGTTTCGCATACATGTCCTTTGACTGCCTTCTAA
AAGGATATCTTCCTTTTCATCTTACTGAGGAAGTGCTGGATGAAAACAAGTACGAAAGGC
AAGTGGACATGACTTAAAATAGGCCAGAATGACATGTTTCAGAGTTTCTGTTAAATAAAT
TGTTTGCTTCCATGTGAAACAAATAGTCTGGTTGGCCTTTATTCTAAGATCTGATACTCA
GAGTACCAGATGACCTCCAGCATCAACAGAGGTTTTTTGTGTGTGGAAAATATTTTGAAT
GTAGCCCTTACTGCAAAATCAAAGTACAAGTGCAGAAGTTCTTTACTCTTTGATCTGCCT
ATCTTAATCTAACTGTTTTGAGGGATCAAACTAATAGTGGACAAATAACTTTTTGTATTT
AAGATTCAGGGGAATCCTCAGGCTTTATTTGGTGTGTTACATGTAGAGTTGATGAGATTG
CTGATAAAAGGCTGTCAAGATTTTAAAGAATTTGATCTGAACAAAATTATGCAAAAATAA
TACTATCAGTGTTAGTGAGTCTCTCCTGTGTACAAAATCTTACTCATGATGTGGAGAATA
AATACAAAGCAGAATTGAGGCTGCTTGGTTCCTGAGTGTTGAAGAACATACTGACTGTTT
AAAATTAGGATTTGAGACAAGCAAGTAATCATTGCAGTTACATCAGTGTAACCTTGTGGT
GATGGTGTTGTCCAGGGGGATCCAGCTGTGTGAGGAATTCAAGAATTTTCTATTTCAAAT
GAAGGCGTGAGAAGAGAAATAATAAGCTATGTCAAGCAATTAATGGTCTGTTCTGTTTAG
GTTGATCCACAAAAATACAAGAGCATCTTCAATGGATTTTCAGTGACAATCAAAGAAGAT
GGATTTCGTGGTTTGGCTAAGGGATGGGCTCCAACCTTTATTGGATACTCCATGCAGGGG
CTTTGTAAATTTGGTTTCTATGAAGTTTTCAAAATCCTGTATGGCAACATGCTGGGGGAG
GTAAGCATTACGTGCTTTCTGTGTAGCTGTGCATCAGCAACATAGTACTACTAGCAGAGA
GGAATCGGGATGAGTACCATTCATTAATGAAAATGTGTTTAAATTCACTTCAGGAAAATG
CCTATTTGTGGCGTACTTCATTATATTTAGCTGCATCTGCCAGTGCAGAGTTTTTTGCTG
ACATTGCTCTGGCTCCAATGGAAGCTGCTAAAGTTCGCATTCAGACACAGCCTGGATACG
CCAACACTCTACGGCAAGCTGTACCTAAAATGTTTGGAGAAGAAGGCATTTGGGCGTAAG
TTTTTACTGTTTCCTTGTTTTTTTTTATTTGGATTTGAATTCTCATTCTTTAAATATTTT
TCCTAATGAAGAACTGTTGCTAAAACTAGTAGTGGCTTTGGCTTATAATACCTGTTGGTT
TTTATAGTTCAGGATAACAACACACTTAACATCAGGGAACCTGTGCTGAGCTGGCTGTTA
GTTCCACATGCTCCTTAGATCCATCTTTGTGAGTATCTTTGTGCTGAGTTCTGCTGGATA
ACTTCAGTTTCTAGCAGTTCCAGTCAAAGTTGCTCGGCAACTTTTTTGGTTGTACGGTCA
AAGATGCTTGAGTCATTGGCATGTGAGAGTAATATAACTGCATGTTAGCTTTCTGTTCTG
ATAAAAGTGACTGTAAATATGAGAGTCATTTACCGCTATCAGGACATGGCTGGTATGCAG
ACATTGAACCTTGCTGCACTTGTAGTAGCAGTACTTCATTATTGCAGTGCATTGTGATCT
GAAATGCGACAACAAAAACAGCTGTGTAGAGTAGGGATCAGTTAAATTCCTGTTTTGCTG
TTTGCAGGTAGTACACAGAAATGAATGAAAGAAATATGTTCCTGTTCATAGGTATTGTGA
CAACTTGACCTTGCAGTGTCAGTCTGTTAGGAATTGTTTTGCTGATAGCAGCAATAAGAT
AATGATTTATTTTTTTCAGATTAGAAATACTCCCTCAATACTCTAGATAATCAGTTTCTT
CTCTTGTAAAGTTTCTATAAAGGTGTAGCTCCGCTCTGGATGAGACAGATCCCATACACG
ATGATGAAATTTGCCTGCTTTGAACGTACTGTTGAAGCTCTCTACAAGTATGTTGTTCCC
AAGCCACGAAGTGAATGTTCAAAAGGCGAACAGCTGGTAGTCACATTTATTGCAGGCTAT
ATTGGTAAGAAAACTTTAAATCCTGCACTTGAAAGCCAAACATTTTTCTGAATATCAAAT
AGATGTAACTAGAGTGGGGCAATTTGCATGTAACTTCAGCGTGTGCAGGTGAAAAGCCTG
GATTCAATCTGATTGGAATGAGCGAGCCTGTAGTAGGACGGTACTCTTAATTATTCCTGT
GTCTGCTATGTCACTGTCTTAGTTTAGAAACAACAGCTGGTTGAAACAAGAAAACTTGTA
TCTTTGCTAGGCTAGGAATGTTGAAAGAATGGTAGAGAAATCTGAGTGGAAGGCTGATTG
TGCATTTTCAAAGACTCAAAATGAGTTTTCTTTTTAGGGGTGGTTAGCTGGTTGACATTT
TTCCTAATAGTCATATAACACTAATAAGAACAGACTTCTGCAATATCAGGAGACCTGATG
TATCTCCTGTGCAGTATATTAGTGATCTAGGGAAGGTGTTAATTCAGTTGGTTAGATTTA
GTGTGCACAGTAGTGATGCAGTTAAAACATCACAGAAGTAATGTCAAATTATTCTTTCAG
CTGGTGTCTTCTGTGCAATTGTTTCTCATCCTGCTGACTCCGTCGTGTCTGTGTTGAACA
AAGAAAAGGGCAGTTCTGCTTCACAGGTTCTTAAGAGGCTTGGATTCAGAGGTAAATACA
TACCTTCATGCATTTTGGATTTAGTGTCTGTGGTCTTTTGTGTTCTGGAGGGGATTTCTT
CTTTCCTGGTTTCTTCTGCTCATGGCTTGTATTTTGCTCTGCAGGTGTCTGGAAAGGTCT
GTTTGCTCGTATCATCATGATTGGTACGCTGACTGCGCTACAGTGGTTCATCTACGATTC
TGTGAAGGTTTATTTCAGACTTCCTCGTCCACCTCCACCTGAAATGCCGGAATCTCTGAA
GAAGAAGCTTGGTTTAACTCAGTAGACAGCTCATGGACTGACTTCGCTGGCTGTCCAGTG
ATGAGTTTCATGAAACTTTTATATATTTGACTATGTGGAAAACAAACTCTATATGGTGTC
ATTATTGGCTGTACCCTCATCCCATGTGAGGGTTAAAATTCTACCACTGTCATTGCCTGA
AATAAATGAGAAACAGAGTGCTTAGTGTCTGTTTACTACTGCATATATAAGCTTCATTTC
ACAGCGGCAAATGCCTCAGATACTTCCCAAAGTGAAAAGTAAAAAAATAGGCCTTTCTAC
ACTTCAGGAATTAGAATTGTGAAACAGCAACAAAATAGGCTTTCATTGTTCCCAGGGGAG
GGCCGAGAAACCCCATGGAGTATTGCAGAAACTAACTGCAGTTGTATGCTTTTTTTCAGT
CCTGTTTCACCTGCCTATATAAGCTGTTTCTGTAAAACAGATCAACTGCAGTGGATGAGA
TAGAAATGCAGTCTGAAAGGACATCCCAGTTATAGCATCTGTATTCTCCAAGAGTTGAGG
GAGAATCTTACAGTTCTCAGAACTCTCTGCGTTGGGATGGTCACTGCAATGCAAATTAGG
CTTACTTGACTAATTTCTGCTTCTCTTGGCTTTGAACTGCACCAAAGATGGTAGTTGTTT
TAGCTGTACCGTGGAATTGAATTGCAGCAGCTACTTTAACAAAAGCAAAGCTGATGTAAT
AAAGTTTCTCAGAAATATCCAACCACTAGAAGCTTAAATTAAAAATGGCTTGTCTCTTCT
TGTAGGGATTGAACATGCCAACTGTTTCTTAACTTTGGTATTTCTATAGTTTGATTTCTC
CTCCTGTGCCCCCTGCCTTCTTTTTCATTCAGTGAGGTTAGTACTGAGTTTCGATTGAAC
CATACACATCTGGGGGTCTGATTTTGAACCTTAATGATTTGAAGAAATCTAAGCTTGTAG
GCATGCAAGGAGTGAATCTTGAGAATGTTTTATTAAGGCAATGAATTTTATTTGCTTCCA
ATATTTAATGTAAAAGATGAGCATTAATGTAAAAGATGCTGCCTTTTGAGTTTCACCTGT
TCAAGAAGCAACGGTCAAATCACAGAGTAAAATTCAGAAAATGTCTAACAGTATATCAAG
GGTTCATCATCTCCAGCATTACTTTGCTCACTTAGTAGAGCTGGAGCGTGTGTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1496..1649, 4107..4228, 6720..6761, 6778..6786, 6837..6899, 7013..7194, 7931..8103, 8640..8750, 8864..9195
1502..1649, 4107..4228, 6720..6761, 6778..6786, 6837..6899, 7013..7194, 7931..8103, 8640..8750, 8864..9021
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved