Gallus_gallus Locus Poly:4:snoZ18
snOPY snoRNA Orthological Gene Database
Gallus_gallus Poly:4:snoZ18
Gallus_gallus
Poly:4:snoZ18
8
SNORD24
2123..2206
3640
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCT
GCGGGTCGTTATTAGTTTGCGATGGGCGCTGGAGGAGGAGGATGGAGGCGGATTGTGGCG
GCAGGGCCCGGCGCGCCCGTTAGGCCTCGGCCCGCTCTGAGGGACTGTGCGGCGGGCGGG
CGGGAGGGGCTGTGTGAGAACGCGGCCTGCGCTGCCCGTGCTTTGTTTTGTGCGGGAAGA
GCAGCTCGGGAGAGGTCGGAGCGATCCGTACGGGGAAAATGGCGTGGGGGCAGGCGGGCC
TGCGCCTCGGTGCGGACACGAGCACCGGCTGCCTGCGGCGTGCAGCTCTCCTAAAATATT
TCTAGGAGATAAGTTGTGTGCAGGCTGCAGTGGTGTGGTGGAGCTCACCGTTGCCTGCTC
GCGTGTAAATTTGTGGTTCTAGTAGATGCTGGGAAGGGGGGTTTGTGTGGTGTAAGTGAG
GAGGTGCCCCTACCCCTTCATCTGGGTTGTAGGCTGAGCTCTAGAAGGCCTCGAACCTCC
TGTGCTGCTGGAAGAGTATCAGAGCCCTCTTAGCATTCCATGTGCCCGCACATGATGAAA
ACTATGTTGGTAGGGACATCTGAGAGGCTGATGAGTACCAACATATCTGAGCTGGGCATG
TAGCAGGGGAGGGAGGCAGGCATGCAGGCGTATGGAGTGGCTGAGGCACCACGTGCTCCT
CGGGGAGCGCAGTGCACCTAATGGCTGCTGTAGTCAGTTGGAGTAGCTCAGTGATTGTGT
CCCGTTCCTGGTAAGCAGTATGGGCTAGCAGTTATTTCTGTGGGTTTGTCTCCGAGTTGG
CATCGTGTGAGTAAGGGGAAGCTTTACAGCAAGGCTCCGGGCTTTGCTTTGACTTGTACT
TCATCCTTTGTCAAAGGAAATGTGTGACCATAATATCCTCAGTGTTAGTACAAAAGCTAA
CGCATGCTCTTTTGTTTTCAGTGTAAGATGAATCACTTACACTCCTCTCTCTTCTATGGC
TTCAAAATAGGTGAGTGCCGTTTTTGGAATACAGAGATTAAATTTAAAAATACGTGTTGT
GTAGGTGCACTTAGCACAACTAGCCTGGATTACTCTTATATCTCAGGAGATTACAGGACC
AGTGTGAAGCAATTCTGATGTCTGTTAGGCAACTTTCATTCTACTGCTGGGAAAAGCCAC
GTGTTCCTTTGGTGGAAAGTGGATTTCAGGCTTTTGGTTCTGGAAAACTAGTTCAGCTTC
TACCCAGACCAAGAGTGCAGTAGATATGTGTCTGTTCATTACTGGTATTTCACCATCCAC
ACCAACAGATTGGAGAAAAGTGCTCAATGCATATTTCAAAAAAGGACCTGTACTGATTAG
GGTTTGTCATTAAATTGGAGAGCCTGTGATGTTTTCAGTATTAGAGTAGTGGACAGAAGT
GATTTCTGAAAACTCTGTGCTGAGGCTTTTTTCCATGCTTACTGTCACTGCTGGAGATAC
TCCCTAGTTCTGCAGGCATTTGATGATGTCCTATCTAACTTTTTCAGGCCTGCTGCTGAA
TATGAAGACTTGATGCTACTTCCCGAGGTAAAAGTTATTGGAAAAGAAATCAAACATTTA
GGGGCTTGCTGTTTGGATCTTATTTTTCATTTTAATTACCTCAGTGGGCAGACTTTATTC
CCTGAGTTAAGTTAATCCTCTGGTGCCACAATGATGACTGTATAGTTTGCTACTCTTGAC
CAAGAAAATGATGAGAGCTCAAACCACCATAATTTCTATCTGAGGCACAGCGACTTAGGA
TTCACCTTGATAAAATATTTTGACCTTGCATTTACTTTCATAAGCTTTTTCTCTTCCAGG
ATTTGAATAATGCACTCACAAAAGAAACTTCATCTGGTAAGAAACTTTGTGCAGTCTGTG
TCTGGGTTTGTTCTGTGTAGCTGCTGAGTCACTGCAGTGAAAATGGTGGGATGCATAAAA
TGGGATGGCAGTGCTTTGGGATTAATTGCCACTAAGGCACAGAAATGGGTACTTGTTAGT
ATTTCAAATACTCTACAAAGATTTTACATGTTTTATTTTGGGTAATTGAGCTTTTTGAAG
TCCTTGCTGGATGACTGCTTGATACTACTACTCCAAAGCAGATACAGTGATGATAACATA
GTTCAGCAGATTATCTCGTGATGAACTATGTTCTGTCTTTCGCTCCTATCTGATGTATCT
AGCTGTTGTATCTAGCTCCTTGCTAGGGGGTCTAGACTTGACGAAGAAAGCTGAGGGAAT
CTGATTTTCTTTTGTTGCAGGCACTGGGAAAAAACAAGATGAATGTGCAAGGTAAATATT
GCATTAACTACAGCAACACAAACTAGCTTTCTGTCCCTGACCTGTGAGAAGGCTGTGTAT
GATGACAACATAGTTCAGCAGATAACTTGTGATGATCACTCTACTGGTCTTTCGCTCCTA
TCTGATGCAGCCTCCTGTACCTGTGGTAACTCTGGCAGACAGCTCATGTGGGAAGCTTGG
GTGAAAGAGTGTACTCACCATGTTGTTGCTTTGCAGTTTGCCCTGTATGGAGATGGAAGA
ATGCATGTGCCCAGCAGTTAATTTACCATTACTGATGTTGGTGAAGATGTTGCCTTTATA
ACTGAAGGTAATTGAACATATTTTAGAAGGCTGCTATGTTTGACTGCTGTATTTCTGGAC
TAGGTCATCTACAGTGTTGCATTTAGGCTTGCATTTAGAGATTAAAGTGTTTGCAAAACT
ATATTGCTTCTGGAAAATTTGAAGCAAAGATACAAGTGCCTTAAGTATGCCCTATGGTCC
TGTATACTTTCCAGTAAAGTAAGTAAAAATTTTGTGAAGTGTCAAGGATTTCTAGGGTGT
TCCTGCTGAGACTAAATGCAGCAGTGCTAATTTAGTATCTGATATGCTTTTTCTGGTTTA
GGCCAGCTTGAATGTTTGCATGGTGTTGAGGTCTCTGAGCTTTTTTTTTATTGCTACCTT
TTTTCTAGCAGTTAAAGGGTAAGATCCCAAAAATGCTGAGGGGAGCTGGGGGATAGATTT
GGGCTCCCTTGTGGAAGATGGGAGTGTTGCAGTCTGCTGTAAATGATGTTGAATCAGGTC
TCTGATCCCAGTGAGGATAAAACTTGACTAAACGCTGATACAGTATTTGACTGAGCTGGT
TGTTCTTGAGCTCAGAATTTTTGTTGGATCACATCTAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved