Gallus_gallus Locus Poly:2:SNORD12
snOPY snoRNA Orthological Gene Database
Gallus_gallus Poly:2:SNORD12
Gallus_gallus
Poly:2:SNORD12
20
SNORD12, SNORD12, SNORD12, SNORD12
1001..1092, 2079..2170, 3071..3162, 3724..3818
4818
GTGGTAAAATGTTTAATGTGAAGTAATTTGCCTATCGAAGGCCACCTAAGCACAAAACG
AGTGCTGCTGTGATCTGTCGTTTGCTTTGGGCAAGTTACTGAACATCCCTGAACCTTACT
TTTTTTCTTTCTAAGAAGAAATGAACTAGAATAATTTATAAGATGTATCGATGCCAGAAG
CACGGGGTGCACGCAGCACCCGCCCAACTGACATTTCTGAGCCTTTCCTGCGTTTTAAAA
TATTAAAGGTATGGAAGCAAAGCAGACTTCTCGCTGTGAGGGTGAGCGGGCACAGCAGCG
ATCCCCTGCCGGAGGCGCCCGGCCTCGCGGGGCGCAGGAGCTCCACGGGGCGGCGGGGCC
CCTCGCGCTGCCTCAGCTGCACCGCGAAATGGCGGCCGGGGCCCGCCCCGCGCGCCTCAC
ACCACCCCTCCCCCGGCATCCAGGGCACCCGGGCGGGGAATAAGCGACCGTTTCCCCACT
CCTCCTGCGCAGCACAGCTCGCCACCCGGCTGAGGCGGCAGCACCGCGGAGCTGCACACG
AAAACTCAGAAGCTGAGAGCACCACCCGACATGGCGGCGCCTCCCGCCCTCCGCGCGGGC
GGAGCGGGGCGGGGCGGGCCCAGGCGGCGCATAAAGCGCGGTGCGCGCGGCCTGGCGGCC
TCTTGCTGCGTCGCTGGGAGGTGAGTGGATGTGCTCTGCTGTCTCGGGGGATGGGGATTG
GGTGGGGTGGCTCGGTGAGTTTGGGTGTTACGCTCTGTTTCTTCATAGCGGGTCAGACTC
TCGCCTGGATGCCTGCCCTGCCGCTTTTTTTTCTTTCCCAGTGAGGGAGCAGCTGCCCTT
GCAGCATGGCCGCCCCTTCCTGGCTCTGCCCCATCCCTTCTGCTGCGTCCCGTATCCCCG
CCCGTGCTCTGCGGAGCGCTGTGCTGAGGGGCCCGCCGTGCCCTCACTGTCCCCGCGGAG
CGCGGCTGCTGCGGCCGTGCAGCTCTGCCCGTCCGGGTCCTGCTGGTGTAGGTGATGACT
GAACTTTTTTCCCCATCAGAGCGACAGTGTTGATTACTCATCACTCTAGCCAGGTCTTGT
CTGATGCACCAGCAGAGGAGAGCTGCTGTGTCCCACAGCCTCGCGTGCTCCGTGCTCACT
GTTCCTTTGTTTTGTTCCCAGGCCTCTGAAGCGCGTTGGAGCTGCGTGATGGACGGCTGC
AGCTGCCCGGCTGGCTCTGCCATGCCAGAGCCTCTGATGGGTGAGATTCCTCAGTCCTTT
CGGTAACTGCGAGTTTTAAGGGTGTTCCCGGATTGTTTTCGTGATGTTTTGCTACATTAT
TATCCCCGGAGATTTGAAAGATGAGTAGATGTGAACATTAGCCTAAATATTGTAGAGCTG
GATGCAGTTTTGCTCGTACAGAAACATTGTAACTGGGGCCTCGTGTTGCTCCGGTTACAC
GCAAAGTGTCAGGTCTAGGATGGCAAGAAACGAGCAGCCCGAGTCGGAGAGCGGGTTACC
GCCGTGTCTTTGGCAGGACAGCATGGCGCGGGGCGCGGCCAGGCCGTGCAGACACGTGGG
CGCTGCTGTTCGGAGCTGCAGGCCCAGCCCGGGAGCCCATGGGCGGAGCTGTGCCTCCCC
CAGGCAGAGCGGGATGGTTCGGACCTTCTCTACTCTGCCGCTTGCCGGTAGGTATGCGGT
ACTGCTCACGGGATGGGGCGTGCGGTGTCCGCGGCCCTTTCCTGTGTCCTGGGGTTTGGC
GACTGCCCAGCACTCACAGCTGCACGTGCAGCCGCCTGCCCTTGCATTGCATGGGAAGAA
ATGTCTTATGGCCATAAGGGTTGTAGCTGCAGAGTGTATAAGCTGTTATCTCTGGCTGCC
TCCTATGTTATTTTTGCCTTAGCTGTCTTATGCTGTACTGCAGAAGCCTATTTCATCTTT
TTTTTTTTTCTTGGTGCTCTCCAGTGTTTCCCCTGTGCCATTAGCCTGTTGAATAGGTAA
ATCAGCTAGCTCTTTTCGGGGAAGGATTTGTGCAAGTTCATGCAGACCCTATGGACATGC
CTAGGGAAGTGGAGTGTAGCTGTGTCACTCTTGGCACCTGCTGGTGTAGGTGATGACTGA
ACTTTTTTCCCCATCAGAGCGACAGTGTTGATTACTCATCACTCTAGCCAGATCTTGTCT
GATGCACCAGCAGAGAAGAGCCGCTGTGTCCCACAGCTTTGTGTGGCTCAATGCTGAATG
TTCCTCTGGTTTTACTCCTAGGCCTCTATGAAGGCAGAAGGGCATTGGGCCTGCTGGAGA
CCTGATAGGATGGCTGTAGCCAGCAGTGGATCAGTTGTGTGATGAAGGCAGTCGTCCTGG
CTTGCACCACCATGCATGAACCTTTAACAGGTAAGAATAGCAAGTTCATAAGGCTTCTGT
TGCTGATCATTGGTTTAAATTTAGTAAGACAAAACATCTTTGTGCAAAAGATCTGATTCC
AAAATGCTTTGTCAAATTAGTATCTTTAGAGACTTCCTCTGTATAATTTGCAATACATAG
CCTAATGCTCAGAGATGAAAGCACACAGGGTTTACTTGTGCAGAAGCATTGCAACAGGAG
CCTTTGTGCCTCATGTCACTCACGTTCCATCATGTCCAAAGTGGCAGGTGTGACTAGTGA
ACAGAAAGCAGCATAGCAAGGGATCAGTAACTTCGTACCAGTGAGTTTAGCTGGGGCAGG
CTAGTGGGTTTATAGCTGTGTCCCGTTTGTTTTTTTTTTTTTTTCCTAGATAAACTGTTC
ATAGAACTATTTGTAAGGTCATTCTGCCTGGAGACGCGGGGATAATCTGCTCAGAGCAGC
TGCTGTAATATGGTATGGGGACCATCCTGACATGGATCCCTTAGGAAGAGAGGCTGTTGA
GTCTGAGGTTTGAGTGCTAGCCAGCTTGTGGAAGTGTTGAGGGGTTTTTAGATCTATTAG
TGTTCAGAGGGGGCTGTATGTCTGTATGGCTTTGCTGTTTCTGCCATTAGTTCACCATTC
TTTGTGAACCTGTTTCAGGAGGTGAGAGCACTGCATGGCTAATGTGGGTGGCTCTGTAAC
TCCTTGGACCTGCTGGTGTAGGTGATGACTGAACTTTTTTCCCCATCAGAGCGACAGTGT
TGATTACTCATCACTCTAGCCAGATCTTGTCTGATGCACCAGCAGGAAAAAGCTGTGGTG
TCCCACAGCTTCACGGGGTTCAGTGCTAACAGTTTCTTGGATTTCACTCCTAGGCCTCTG
TGAAGGCAGAGGGATGTTGGACCTGATGGAGACCTGATAGGATCACTGTAGCCAGCAGTG
GATCAGTTGTGTGATGACTGCAGTTGCCCTTGGCTTTCTCTACTGTGCATTTCCACTTTT
GATAGAGGAGCAAAGGTAAGTTGTTTCCCTAGAGACTTGATTAATAGGTAGACTTGAGTA
CTGTAGCATGAGCCCTCTCTGCATTACCTTTGTCCTCTTACAGCGTGTTCGAGGTAGCAA
ATGAGGCAGTGAGCAGGGACTAACACTGCAGGTAGTAACCTGAAGGAAGTGATGGTAAAT
GAACAACAGCAGATGAATAGAAAACACTTTCTACTAGTTTACCTGAAAATTGATACCTGT
TAAAATACTCTTGATTTCTTCTACCATTTTTTGTGCAGGGTGTACTGCCCTGTTGATTAT
TATGAACCTGAAGGCTTTTTTTTTTTTAATTTGTCTCAACATTAAGCTGAAGAGCATCTG
TCATTCTGTGGTATATGATGACTTCAAACTTTTTTCCCCATCAGATCGGCAATGCTGATA
CAGACTTGTGTTTAAGCCAGATTTGTCTGATTCCACAGATGCAAGATTCTTCAGTTTGTC
ATTTGGTTCTGTATTGAGGCTTCATGCCTATGGGCAGGGAATTTGTGTGTGCTGCGTGCT
CAGAGGGCAGACAGCACTGGAGGGTGCTGTCTGCACATATCTTAGTAATACTGATTGCTT
TACATTATTTGACATGCATAAAGGTCTTAAAGACTGAAAGTGAAAGGATTTTGGCTTTCT
GGAGATCTCCAGTAACAGAAATGGCAGAGAGCTTTGACAAGTTCAAATTTAACTTCAAAA
GGGTATAAACATAGCTTTTTTTCATTTTGCCTCTCTTCAGCAGTGTTAAAATGAAGTGAG
GGAACCTTTATTGTGGATTTATTTTACTTGTGAATGAGATATTCTCCATACCTTATAAGT
GGATAAATGTGAGCTTTCAGTAAAGTTCTGTTTTGCAGAGAGGGACTGCTTCTGGTGTTT
TTTCTTTCTTTGCTTCTGTAAGGGATTATATGTGATAACTTCTGAAAACTTGGTTATTTG
TTTAGGGTTTCACTAATGCTTTTAGAAAATGTGCTTAGGAGAATTTTGCTTCATTGAATA
AACACTTATTGCTGGTTTCATTCAGTTGCAGCCTGATCTTGCTGTTTGTGTAACCCATGT
TCAGGGAGCCTGAAGTCTCCTCAGTAGCTCATAACTGAAGAGCACAAATGTGACCTTTCT
GTACAGCACAGTAGAATTCTAAAGGGTATGAATGATGTGTCAGATGGCAGAGCTGATCAA
ATATAGTACTCTGGCACCCTCTGCTCAGTTAGTTCCCCTGGACTTTTATCAAATACTATG
AAATACCCAGAAATTTACTTCCAAGAGTGTGTCCTATCTGGAGTGCCTGGCAGTACCGCA
GTTCTTTTGGCTGTTTGCAGAACAATCCTTACCATCTTGAAGAATTTTGGGGGTGAGATT
TGAAAGCTGAGTTTTTGCTGTTTGATGTGGAGTGAACTGACACAATGTTGGATGTTTTCT
TGACAGGTTGTGTGTGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved