Gallus_gallus Locus Poly:0:SNORA8
snOPY snoRNA Orthological Gene Database
Gallus_gallus Poly:0:SNORA8
Gallus_gallus
Poly:0:SNORA8
1
SNORA8, SNORA32
1001..1139, 1543..1665
3144
CTTCCAAATGAAATGGTAGTGTAACATTTCCCTCCCTTTTCCCCCAAAAGTCATGACAG
AAGAAGGAACTTTATAGGAACTGTATGAGATGCTTTTCCAGTCTGCTTGATTTTTGTTGC
ATTAGTTTATGGTCACAGAAATGTTGAGGTCTATCCCGATAGGATCTCTTCTGTAGGTTC
ATGTCGTTGGAAACGCCTCACAGAACAAACTTGTGGTTTAGTTTTACCCTTGGAGCTACC
TGTTAGCTCTGTGGGATAGAACTACAAGACAAATCTTCATGTCCCATTTCAGGAATGGAA
GTAACATGTCATGTTCTCCCTCAGGTACTGGCTCATGCATTTGATATAAATGGAAAAAAA
AAGATTCAAATGGAAAAGCTTGGTAAGAGTGAAAAAGAGCATGTTCTGAGATTTAAAATG
TAACTAACATGTTTAATTGTGTGGGTTGAACTTGCTCTTCAGCCAGATGTCTGTGAAGGT
ACCAGACCTCTTAGTGGCTTTTTTTTTTCCTGGTTGGCTTGAAGCAGACTCTTCCCACTT
CAATCTGAAAGTGACTTTCTGTTCCTTGTGGTGGCTATAGGTTTAAATTAAGAAGTCCAG
CCCTCTGATGTCTGTCCAGTCTTAAAGTAATTCAATGAGCCTGCCGGATTTTTGCTCTAT
GTAATTCAGCAATACTGCTTTTCTCCTGCTAAGCTTCAAAGTAGCTGAGCATCTCAGGCA
GTTTACTAGTACAGTGTCAGAAGTCCTGGGTTGTATGGAGCATTGTGCTATTCTATAGAA
CATAGCTTAAAGTAAAACGCAGACAATGCTTCTATAAGCCCTTTGTGCTGGGAATATAAA
TACTTGAAAGAATTACGAGGCTGCTGAAATTGATGGAATTTCTTTTCCCTCTTCGTTGCA
TGGCAACTTCTGTGAAATTGGTACTTCAGCTTATCGCTGCCTGGTGTATGGACAGCTTGA
ACCTTAACGTGCATTTGTTGACTGAGGACTGCTGCGTCTGTTGCACTGAATGGTATCTGC
ACCCAGCAGCGTTCTTCTGATGGGGTGTTCAAAAACCAGTGCTACAGTAATTCAGCATTT
GGCATCGTTGGTTTTCACTCTGCAGTGGTTGTTAAACCTGGTATTCTTGCTGATACAGGT
GCTGCCCTCTTCAAGGATTTGAGCGCAGTCCTTTTATGTCGGGTAGGACTTGTCAGTGTG
AGCTGCCCACTGGTTCTCCCTCGTGCTCAGTTTGTTTCTTTAAAACAGGTGCCTTGGGAT
ACACAACAGTCAGTTGGCTGTGGAAGAGGAAACAAAGTGTTGGACAGGTAAGCACTGAGT
TCTCAGTTCAGAAGGTTTCAGGCAACTTGATGGAAGCTCGGTTGCTAATGTATGACTCTA
GAAGATCAAAACTTCCATAAACTGTCTAGAAACATAGAAATGACTGTCCAGTAGCAGGCA
GTCCTGGGCAGCACTCCAGATTTTGGCAGTATCTGGGTCAGGGTGTCTACCTGCAGGCTA
GTCTTAAATGCTTGTAAAAGCAGTGGTAAAGGGAGAGAGGATCTGGTCATTACCAAGGCT
GCAAGGATATTGCTGTTCCTGGTGAGCTGTGGACATGACCATATAGCAAGTCCATCAGAC
TCTTGAATTGCTGCGTTGTGTGGCAGTAGGTCTGCTGGGAATAAAGCTTTGGTGTAGGCC
ACAGACACAGCACTCCCTTCTGCTGGGTGTTAGCGGCTCTCTTTGGCTGCCAAGGAACCA
AAGTGCTAGCTAGAATCTTCAGCTGTTGAACTCAAGCTCCAGAAGCTGCTGTTGACAGAA
CTGTCATGCGTTCAAAATGGAGAATGAAAGGCTGCTCCTTGCACTTGGCATCCAACTTCA
GTTTAACTCTTTTATACTAACTACTGTGCCTTTGTGTACCCAGAGTCCGCTGCTGTCACT
GAATGTCAGGGGGTGAGAAGTTGTACCTGAGTGCTGCCACAGTAAGTCTGTAGGTAAGAT
GCTTAGCAGCAGTGCTGGTACCCACAAGAAATTCAAGGTCGCTTCAAAGAGGGTTTGCAT
GGCTGGAGAACCAGCAGCTCTTAACGCAGTGACCGTACATTGAACTCCTTTCAGCAGGAT
GCTGTAGCCACTTTGTGTGTGCTGTGGTCTATTTCAGAGGAGACAATTCTTAAGTTATAT
TGCTGCTTGGAATGAGAAACCACCTGTAGCTTCTGCCCTGTCACTTCTTGAATTGCTAAT
GCAGGCAGAATGCTACTGATTTCATCTGCAAGCAGCTGACTTCAGCAGCACGTGGGGTTG
GAAGAGAATATTCATACAGTTGTGGCATGATGAGTAGTTCTTGTATCTTTTAATGCTTTT
TTTTCTGCTTGGGTGTATGGCATGTTCTTGAAACTGCATGGAAACAGATAATCCCAAGTA
GGTGAGGAAGTGGACAGTAGTGTTGAAATGGAATATTATGGATAGAGTGCATATAGGAAA
CTAATCAGAGCTACCATGCAAAATGATTTTGCCCCTAAAGAGTTTAGTAAGGGACGTATA
TATGTGTGCCTGCCTTACTGCTGTTACATTGGCACCATGTTACAAAGTTAAGTTCCTTCA
GCCTATAGGAAGGCAGAAGGCAAAGTGCTTTTCTTTCTCTTGAGTTATGGTGCTAACTAT
TTTTTTTTTCTCCCAGGTCCTGATGTGATGTTGCTGCAAGTCTCTTGCAAGAAAGAAAAG
GACAGCTCTTAAATGCTCTTAAACACTCCTATTTCTTGTAATAATTGAGAATGTTAAATA
TTTTAACTTCACTGCCCTGTAAGTTGGAGTAGTGGATCAAGGTGTGGTTGTACTAGGAAA
GGGTTATCAACTGTGTTCCAACTGTTCAAGTGTGGAGAGGGGGCTGTTTACTTCATACAG
AATGTAACATTCAAATAAAACTGATGACTGAAAGAAGCAGCTGCAGCCAGGGAATTATTT
TGTACTGCTACACTGCAAGCCAACACAGGTGTAAAGCTAAAGCAGGGATTTAGCTTTAGC
TAAATCTTAAATGCTAAAGCCTCTAGAAAAACAGACAGTAAAGGTGAGAGAGCCTGCACA
CTGCAACTAGCCCTCTTCCTTCAGCTCTTTGTCCTGTACTGTTTGTTTAGGGGGAGTTGT
AACAGTTTGGGTCTCTTCAGCAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved