Gallus_gallus Locus Mono:8:SNORA24
snOPY snoRNA Orthological Gene Database
Gallus_gallus Mono:8:SNORA24
Gallus_gallus
Mono:8:SNORA24
4
SNORA24
1001..1131
2131
TTTCGCCCTTTAATTCTACTGTCTCCTCCTTTTGTACAATCCTAGCAGCACTTTTGTTA
TTTTAGAGTATTGATGTCTGATAGCCGTATGTTTGAAGCAGCAGTATTACATGGCTGTCC
TAAAAGTGATGAAATGCACCCAGTTACAAATATGCCTTAAATACACGTATCTCTCTGCAC
ATATAGAAAGCTGCATTGGTGTGTAGTCAGGCTGGAACAGTGCTTTGGGTTTGGAAATAC
TCCCAGCTCCTTTTCCCTTGATCTTGATTCTCCTACATATTATGGTCAGTAGCGAAATAC
GTATATAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGTTTAAATCATATTTAC
AGTCAACCCTCATCCTGCTGTCCCGCTGCAGCTCTGCAGACAGAGCTGTACTCCGACATT
ATAAAAACTGCGCGTGGTGTGAAGGACAAACTGCTGCCCCCCACATGTCCGCTGCACCTC
CGCCTCTCCCAGCGCGCGGAACGCACTGCAGCCGCCATCCCCCTCGTGCTCCAGCATCGC
GCAACTGCCACCGCCCCCTCCTCGCCCCGCCCCCTGGGAGGAGCACGCACCTCGCCCGCC
CTTGCCGCCTGCTTGGGTGGTGGTTCCGGTTCAGCTAGCGACCGTTGGCGGGCGCACGTG
GCGGCAGAGGCTGGGGTTGTTGGTGGGCACGCGGGCAGCCGTTAAGCGGGCGCGTGCAGC
GACTGTTAAGCGGGTGCGGGAGGCGGGCTGTGGGGATTTCTGGTAGCGCTGGCGTAGCCG
TTGGGTTCCGCGGTCATCCTCTCCACCTCAGAAGCGGGAGGGACTCAGTGGAGCCGAGCC
GAGCCAAGCCAAGCTAGGCTGGCAGAGGTGCGGAGCAACTGCAGGTAAGGGGAGGGTGGG
TGCTGAGCGGCGGCGGGGCGACGTACGATGGGGAGCGGGGGGAGCGAGCGGCCGGCCGTT
GGGAAGATGGCGGTCGCCATGTGGTGGGGGGGGGATGGCCGCTCCATGACTCCATGGGGG
CTGCCGCTCGTGGCTGTCCCCCTTCCTAGGCATGGAAGAGCAGCTTCTTGCTAATTGGCA
AAACTTCTACCATGGCGTTGGTAGTAGTCGTTGACTGTGGCAAGTAACAAGCCGAGTCGG
CAGGGGTTTGTGGCGCAGGGGGGTGGCAGGTTCTTGTGATGCTTTTGTTTTTTGTTTTCC
TTCGTAACTTGTCGAAGCTCCGTTTTGTAAGAAAGTCTTCTCCTCTCACCCCCCACCCCC
CCCTTCTTTTTTCTTAAGCTTTCTTAAAATGCAGAAGCCGGAAGTGAGGAGGCCGCGTAG
TTCCTCTCCTCAAAGACACCGCGTGACTGGGTATGTGTTGCCTTATGAGCTCCTAATAGA
GAAATTTTGAGCGGGAATAATAGCAATTTACTAGTTACGTTTAGCGACTAAGCTTCCGAG
ACCCATCTGATCACCACTGAAATCAAGATATGAAAGTCTTGATTTATTGAAAAGTCTGCT
TGGTTGTGCGTAATTATCTTTTACTGACAAAAAGCTGTAACCGAGAGGAAAAGTCTGTGC
TACCTGGAAGAATTGGGCTCGGGTGCAGATGCATTGAGTGTATTCTGAAGACTGGGCTGT
GGTATTGCCAGTACTTTTGCCTTCTAAACTGGAGGCATCTGGGTCCAGAGATGTCAACGA
GTGGTGTATGCAAGGAGCAAGCCTATCAGTAAGCACGTTGCTGAGTTAGCGAAGTGTACA
AACAGTGGTCTGAAGCAGGGGAGATGGCTTCCAATAGCTTTGTTTCAGAGCAGTGTTCAG
TTTCTAGGAAGGCACCGTACTGTTCAGTAATGTCTGCTGTCTTGTATGTGTAGCAATATT
AAACTGCGTCAAACTTCTCTTTACAGGGGAAAAACATTCTTGAGTTGTGATGGCAGAAGA
AGACGGGTCTAAATTCAACCTGTAAATTTTTGGAGTAACTGTGACTAGAATTTCTATTGT
TTACTTACTTTTAGGATAGATGGGCAATCTTATAGAATTAACGGCCTTTGTGAGCAAGGG
TATTCCTGATTTTCAAACAGGGAAGCAAGCAGTACTTTTAGGCTAGGCCTTAATTTCAGT
TTAGACTTAAATGACTCTTCTAATTAAGTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved