Gallus_gallus Locus Mono:10:SNORA72
snOPY snoRNA Orthological Gene Database
Gallus_gallus Mono:10:SNORA72
Gallus_gallus
Mono:10:SNORA72
Un_random
SNORA72
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAGCTGCTT
TTGTTGTATAGTCGATCAAATTGTCAGTACTTTAACACTCAGTTTTTAAATCTTAGAAAA
TCGGAGATTGAATACTACGCCATGCTTGCAAAGACTGGTGTCCATCATTATAGTGGCAAC
AACATTGAATTGGGCACAGCGTGTGGAAAATACTACAGAGTGTGCACGCTGGCTATTATT
GACCCAGGTATGTGTCTTCTGCCATATAATGAACAAATTGGGTATATATCAGTGGTTCCT
GCATTCACCTGTGAGTAGCAGTGCTTAGCAAGTAAAGTGCAGAGGTGAGGTCAAACTTTG
TCATAGTTCTCCTTTAGGTTAGACTGTGACCAAGATCTATTCTTATTTTGTTAGTCCAAG
AATTAGTTTCTTACATTTGCATACAGCTCCTTTTACTGTTCAACTTTGTTAATCTAGAAT
CTTGGTAAAATAAACTGCTGGATTGTGAGTTGTCTTATGTATACACAAGGAATAAGCTAT
ATACAGGTGGATACTAATCCAGTGCTGGAGTTGAAAATCATATTAAATGTTAAAATCTTA
AATCTATGTGTAATTATTGTGGCTTGGTAGCACTCCTTGTTCCAGAGAATTGTTCAAGCT
CATTCTAGAGTCTCCTAACGATGTGATTTCCTATCTTCCTTCCAAAATCTTGATAAAGAC
AAGAATCAAATTTATCTTACATCGTTCTATTTGACCAAAAGCATCCTAAGTAAACGCACA
GATTTCTGTTTTATCTACTCCCAAATGTTGCCCAAGTAACATCAGTTTAAATTCCCCGTT
TCTTTAGAAACCTTTATTTAGCTCGTTGGTATTCTGACAGTAGCTGGAAGCTTAAGTGTA
AGCTAAAGAAGTGGAACTTAGCCTTTCTGCTGTGTAGTATGATGCGAATATTCTCGCTGC
CCTGATATTCCGGTGATCAGGGGAGGCTAGACATTCGCTATATTAAAACTATGCATTGTG
TCCTCCAGGACTGGACTGCTGCTCTAGTACTGGCTTTGAAAATGCTAGTGACATACATAG
AATTATCACAAGCATATTGTGCATGGATTAGAAAAATGCAGCTAGAAGTATTTTTGAGTC
ATCAAAATTACTTTTTTTTTTCCTAATGGACTGTCTTTGCATTGCTTGAATGCTTTGATT
TTAGAGTCCATTGAATCTTTTTTTGCTTATTTCTGGGAATGGATCTTTCTGTAGATCTTG
TAATAACGTATTTCTGTGTTTCTGTTCTGCAGGTGACTCTGACATCATTAGAAGCATGCC
AGAACAAACCAGTGAGAAGTAAATGCTGTAAAGGTGGTCTTTCTACAATAAAACTGGTTT
TAGATCCATTTTAAGAAAAATGTGTATTGTATTATACTTCTGCTGGTTTTAGAGAACAAA
CTATATAAATGAAGATTCATTATCACTGCTGTCTGTCTTGTTCTGTTAGAAGTAACCTTC
ACAGGACAGAACTTGCCTGTTGCTTACTGTAGAAGTTGACCTTCAGTAGTAAGACCTGAC
CGTGGTAAGTATCAAATCCCAACAGGCTGTGGCTTTCTTTAGTTTAGTTTTTTTGGAGTG
CTCGTGGGGAATAAGTTCTTATGAGGTAGTGGCGAATTTGGGGTGTTGGTGGGAGACCCC
AGAGGATTGACTTACACTTAATTTCTTAACACTTCTTTTTAAATGTATTTGTTACTGGTA
GTGCGTACTAAATAGGGCATAGCATTTTGCTGACACGTGGTTAAAGGAACACTTAATGAC
AATCACTTGAACCAGCAGCCCTGAAGAACTTGCATTCTGTTTTCTGAAGTGTATTAAAAT
ACAGGGTGCTTCTTTGTACACATATGTGGTCATTAGATTATCCATGATCACTTAAATCTA
ATTTTGGCTGTAACTCTTATCTGTTTCTGGTGTGGAGTGGATGTGGTTGTGTATTTCAAG
TTAGAGACATAAAAGGGGCAAACCAGCACGTGAAGCAAAGAAGAAACAGCTGGAGTATGC
ACCTATTAAACTCTGGATTTGTATCAGTTCAGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved