Gallus_gallus Locus Mono:9:SNORA73
snOPY snoRNA Orthological Gene Database
Gallus_gallus Mono:9:SNORA73
Gallus_gallus
Mono:9:SNORA73
Un_random
SNORA73
1001..1205
2205
CTTTAAAGAAGAGGTGGTTCAGTCAGTTCCTCAGTTCATAGTGCAAGTCTTGCCTTATA
AACTCTGAGATTATTTGCTAAAACTTCAGTTTTCTGTAGCATCATAATCTGCTTCTGTTT
TGTGATCCCTACAGAAATGGAGTCTCTGCTCCTGTTTACTGTGCTTCAAGGCAGGAATTG
ATTACCAATTGATGTACTAATTTGGATAGATACTTTCGGTTTCCTTGTGCCAGCTGTGTA
GCATCTCTTTGAAGCAGAAGAAACTGAATGGGGTTCTTTTCTCTTAATTTTTTTTTTCTT
TTTGCTGGAAGTTACCAGCACATATGATTGTTTGCTCTAGCAAAAAAAAGGATTGCTGAT
TCTTAAAAGAAACTAGGTTGAAATTTTACAGGTTTAGTGGAGGCCAAATGCAGCTTGATT
TAACTTTGCCTTATTGCACCATGCTGCTGGCTGTACTTGATTACAATAGCAGAATAGTTG
TTCTGAGTTTGCAGAACTCTCTGAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGCCCGCTGCGTTCTGTTCACTGCGCCTGCGCGATGAGGCCCCGCCCCCCTCC
CGTTCTATAAATAGCCGCTCGACGCGCTGCTCGCTCTCTTCTGGCGGTGAGCGGCGGCGC
GAGCAGGTGAGTGTTGAGGGGGGGGTTGGGGGCAGGGCGCGGCCTGGTCTGGGATCGGTT
GTGTAGCTCCTGCTTTCTGCTTTATTTTCTACCTTAGTGTACTGTGAGGGCTGGGAGGGT
CCACGCTCCGGGCCCCGCCGGCCCTCACAAGTGTTTCTCTTCTCCCCCAGGCCGGTCGTG
CTGCCCCGCGGCCCAACCCCGCCCGCTGCCGCTGTGAGTATCGCTGCGCTCCGCCCGTAC
GGGGGGGAACGGGGCCGTATCGGGGGGCAGACAGCCGCGACCCAACGAGGGCATCCGGAG
AAGTAGCTCTCTCTCGGCTCTGTCCGTGTGGCGCACGGGAGCGTAGGCCTTCGGGCCCGA
GACGTATATTCCCCTTCCACATCGTTGGAGAACAAGCTGGGCCTCGAGCCTGCAGCCTGC
ATATTCCTACTGCTTCTCTGAGCCCTCGGGCAGTGACAGAGGAGATAAACCATGCAGGAA
ACACATCCGTGCTGAGCGGCCGTGGGGGGCGGTGGGGGCACGTGGTGGGGGGTTGGGGGT
CTGCAGTGCTCCTCCTGTGCCGGTAGGAATAAGGACAGCCCCTGTGGGATCACACAGAGC
TGGCTGTGGGTCAGCCCCGCTGCGCTGTGCTCTGTATGGGGTGTAGTGCTGGAATGCTGG
GGCTGGAGTGGGGTGGGGGGGATGGTGGGCATGCACTGGGAGCTGTAACTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACATAAGATAGACAACGTGCAGGACAGC
TCTGTTATTTACTGGGAGCTGAACATCCCACTTTATTGACAGAGTAATAGAGTATATTAT
TCAGTACACAATTTTATATAGAAAAATAAACTTCTTTTACAGGGAAGATCATTTAAATAG
AGGTCCAATTGTTTTATTTCAGAGCATAAAAGTGAAATCCAAAATTTATCAGCACGCTGC
TTTCCCTGGGGCTAGCTCTAGCTCTTGCTATGTATGCAGCCAACAGGATGACAGCTTTAG
TTTCAGTAGAATTTAAGCCTTCATAAAAGAAATATTTGGCTGTTCACAAGGACGAAAAGA
AAAGGCCAGCATATCAGCTGGCATACCTGTTACGGTTAGCCTATTAAAATAGCTTTAAGC
GTGAACTGTTCCTTTCATCTTAAAAGAAGCTCCAGATACCTTAGTGGCCAACTTCTGAAA
CACTCCCATGAATTCTGCGCCTATGTGAGTGTGACAGGCTAAGCCTGGGGGAAAAATAAG
CCTTTTTCCCCTAAGAGATTCAGCTCACCACCAAGGAAGAAGCACTCTCTTGCCATTTCA
TGCAGAATAAGGAAAACCAATCAAAATGGGCCAGGCTGAACCATGCATACTCCACAGGTA
AGTTCAGTCATGTTTTGGAGCAATTCTATTTAACCCAGCTAAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved