Gallus_gallus Locus Mono:5:SNORD19
snOPY snoRNA Orthological Gene Database
Gallus_gallus Mono:5:SNORD19
Gallus_gallus
Mono:5:SNORD19
2
SNORD19
1001..1077
2077
CCGTATCAACTTTCTCTCTGACAACGGCATCTTGTGGCCAACCATGCATGTGACAAAAC
TCCTGTTCTGATGATGGGATCTTAATTTCAAGGGGATGCTTATTCCATTCTATATCCCCT
TTTTAATCTATGGATTTGATGAATCCCTCCACAGGCCAGGTGGACTGGAGTTGAAAAAAA
TTGAGAGTAGTGCCAAAATCTATGCAGGTGCTGAGGCATAAATAATAGTTGGCAAAGCTG
CATTTTTACCATCCTTATTAATCTCAGACATCATCCTAAAACGAAGCCAGTGCTTCTAGT
GACTGTACAGCCCCATCAGCATAACTGCTACTCCATACAGATCCATCACCAACATATTTG
TTGCGGAAGAGTATAGCTCCTCTTTTTCTCTCCTGCTTATTTAAGATGCATGCTTCAATA
CTTACCTCTTACAGCCTTTTCTGATCCTTGTTTGGGAAGCACACACCATAATCCTGCCAT
AATCTAGGGTTCTTTTTGGCAGGTCACAGTAGAAGTAACATTTTCTCTGTATACAGACAG
GTGTTCCAGCCTTCCAGGTTGGATTCAGGCCAGGCAAAACCAACCAGGAATCTCTTTTCT
ACATGAAATTATCATTTCAGATGTAAAGATGTGCCCAAACACTGTGACACTTCTTACCTT
TGCAAAACGTCTACCTTTGCAAACATCTTCTGGAAGGTAATAATATTTTTTTCCAGTTTT
CCAACATAATCTGAAAGTAGTGTCACATTCACAAGCATCTGTTCTCATGGAAGACTTCAA
CCACTCTGACATTTGTTGTAAAAGCAATACTGCCAGGTACACATAGTCCGGGAGGTTCCT
GCAGTGCACTGAAGATAACTTTCTGACACAGGTGGTAGAGAAGCCGACAAGAAGAGTTGT
GTTGCTGGGCTTTGCTCTTATTAACAAGGAAGGGTTGCCTGTGGATGCGTAGGGGAAGCC
TATGATGCAGTGATCATGGAATAGCAGAGTTCAGTATCTTACATGGATGAAACAAGGCAA
TAAGAGTAGGATTGAAACCCTGGACTTCAGTAGATCCAACTCTGATTTCTTCAGATACTA
TGGGCAGTATCCCATAGGCAGCATGTGGCCCGCTCCATGATCCACATCATGGCAGCAGCT
ATTCCCCACTAAGCAGCCCAGCCCAGAACCTGGCAAGCATCCATCCCTCAGCAACAATCA
AGCATCAGTGCCCTATTTACACTGTCTTGGCTGAAATCAGGATGAGGGAAGGACAGAGAG
CAGTGCTAACTGAAGTTATAACAAATAATTCTATGCATTTTGATACATGGAGTAGACACA
GTCCTTAGAACAGTGAAAAATAAGTAGCCTTGCTTTGCATTCTGATACAGTAATTAAAGA
ATTGATTTCAAGATTGATTTTAAAAAAATCAATTTTTTTGTATATTTCTGATTCTACTTT
CAGTTAACATAAACTACCTATAAATTTTCAAATGGAATGTATGGGATTGCAATTATCGAA
TCACAGAATTATAGAATGCTTAGAGTTGGAAAGGACCTTTAAAGGTCATCTAGTCCAACT
CCCCTGCAGTAAACAGGGACATCACAGCTAGATCAGGTTGCCCAGGGCCTGATCCAGCCT
CACCTTGAGAATCTCCAGGGATGAAGAATCCACCATGGTGATGTGCGGAAATCAGACCCT
ATAGCCAGTAAGGATATAGAGCAGGTATGTGTTTATTGGTGACGCGCGTACACCCTGGTA
CAAGGGGGATCGTTCCACCTAACTTGCACACCGTCCAAAGAAATCGTGCTATAGATATAG
GTCAAACTAATACATAATCAGGAATTTGGATACATATTCACTACATTCCTGAGAGCCCAT
TAGCATACAGTCCCTCCCCCGCTTGCGTGTGCGTAGTAGGTCGTGATGATGAAGGCTCAT
AGTCTTCCTCGCTGCAAACTTCTGACCCTGAAGGGGGGGGGCATCCCCCAAACTGGTTTC
AGCTTGCACATCAGACATCTAATCACCTCCCTGCCAAATGTTTTCGAGCTGTTCTCCGGT
CCTTATCTTTTTGGCCTTCATTCTCCTTGTTATTCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved