Gallus_gallus Locus Mono:7:SNORD50
snOPY snoRNA Orthological Gene Database
Gallus_gallus Mono:7:SNORD50
Gallus_gallus
Mono:7:SNORD50
3
SNORD50
1001..1071
2071
CTGCATTATCATGTCAGCCCCGTTCAAAAGTACGAGGTGACATGTAAGCAATTACTGCA
GATGGCATATCTGAAATACAGTAGAGTTTATGTGTATGTGCATCATGGGAAATGCTGAAA
TTTTTCATCATCTATATTGGCCTTAATGGTAGGTTTTATCAGTTCCAGCTCGAAATACCG
TGCTTAATTTTCATGTTGCTTCAGGTGTCCTACGTAGAATAGGTTTTTTAATATAATGCA
TGTTGGTAGATTGGAGTTTTTAATGTGTTGATACAAGCTGAGAACCATATTCTCACTATC
GTTTTCAGAAATTAAGCTTTTGATTATGGTAGAGGGAGACCTAGACTTAACAGATTAGTT
GTCTGTCACAGCTTATAGCAAAGTTAAGTAGTGTCCAGGTAAGACATGCAAAAAAATCTT
ACTTTGATGTGAGGACCCTTGTAGGTTAAGTTCTTTGGAGCTTAATAAGTACTGGTGTTA
TTCCACCACGTGCTTAGTAACGTATGATAGACCAAATAGTAAGTTGTGTTTTGAGTGATG
GAAGAAAACATTTCTGAGCTAATAAATGTCTCTTTTCCAGCAGGAAAATGGTCACAACTG
TACAGACAAATGCTTTAATTTGTTCAGGTATGTAATTAGAAAGCTTCCAAGCGTTTTATG
AATAAGTCTGAAGTAAGTCTGTGTTTACAAGTTAGAAATTTTTAGGACTATGATTGTTGC
TAATGCACTTCAATAGCTGATACAGTAGGTTTGTACAGTAGCTTACTACTTACTGTGTAT
ATGTACTAAGTATAAGATCGCTTACTACCCAAGGGACTGCATGTGCCATAGTTGTGCTTA
ACTTTTGCTAACCTTAAAATCTGCCTGTGAACTTTTAAATACCTTATTTATGTGTGATAA
GACAAAGAATGCTCAGTCTTTTCATTGCAGTCAGCAACACTATCAAAAAAGAAAAGCACA
TCATGTATTAGATTTGCTTTTGTGGTGCGGTCTCTGCATCTCATCTATGATGATCCTATC
CCGAACCTGAATTCTTTGCTGAAAAACCTACTACGGATCCGGCATCTGAGATGAGATGAG
AAGACTAGATTTAAACTTACTGAAAAGTATTACAAGTTCTGTGCAGTTTTAGGTGCTTTT
GCAAAGAAAAATAGTAAAAAGTATACAATTCTGTGCTTATTTGCAAGTTTAAGTTTCTTC
CTCAAATGAACCATTTTATTTAGACCTTGTTCTCCTTTTTCCAGTGAGTTGGAACGTTTT
TGTCAGTGCTGCTTGACAAATGTGGATGATCTGTAACTGGAAGAAAGTGTAACACCTGAA
GAGATGTTCTCGCTTGGAGTGGGACCATGCTTTTAAAATCCTGCTGAAACAGTTGTTGAA
ATTGTTTAGCAGATACCGTTATCAAAAACTGCACGTGAACCAAAATTACTGTCTCTGCAT
ACTTAAAATAATGCTTCTCTCAAAACATCAAACTGCCCCCTTTGGGAAGGATAACAGTAG
CAGTAGGGAAATGAGTGGTGAGCTTCAATATATGAAAAAGAAACAGACTATTGGCCCTTA
GGAAATGTAAGGGTATGCAGACTTTGATACTGAGCATCTGTAATAACTCAAAACAATGGA
AGTTGCAGGTAGGCCATGCAGCATTGATACATAAATTCAAACTACTGAGTGCTCCTTGAT
GATGTCATGTGGGAGATTGAAGGAGGTAGATGAGGTGGTGTGGAAGCATCAACATGAAGC
ACCTGTAGAAAGAAACGCTTGAAATTTCAGGTGGCGTGAGGAAGTTGTGGTTACAGAAAA
AGCATAGACTAAAGCTTTCATTTTCTTCTGCATCTAGATGGGGAGAGAAGGAAAAGGGAG
TTTTCATGAGCTGCCAATTTAGCATGGAAAGACCAGTATCGGAACTGGAACTGTGCCCAC
TGAAGAAGACATTGGCAGTGTTATCTGTTCCCAGTGTGGGAGGAAAAGGAATAGAAACAT
TGGAAGTTTTGCTTGCCAGCAGTCACTAACCACACAGTAACATCTTAACATTGTATTTGT
TGTATTAAGCAGATCATCTCTCTTCCACTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved