Felis_catus Locus TBRG4
snOPY snoRNA Orthological Gene Database
Felis_catus TBRG4
Felis_catus
TBRG4
GeneScaffold_1888
SNORA5, SNORA5
3136..3271, 3649..3782
7994
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTACTGGGG
GTGGGGGGCAGTCGCCCTGGCTGAGTCTATTAAAGGTGCAGGGCCTGTCGGGATGAGGGA
TGTAAACCCAGGAGGTCATTCTGAGCCACGTTGTGAGGCTACAGGATGTGGGTCATACGT
CCAGGGCTTTCCAGGAGCAGTCTGATGTGAAATATCGTCTTGTGCTTCTGGAAGTCCATC
ATTCTTGATCCTGGGTTACTTTTAAAGTAAATGAAAGGACACTGTCTGATCCTGCGGAGA
CTCCCACCTAGGAACCCGGGGCTGAACCTGGGGATCTGAATGGTTGAACCACCCCGTAGG
CAATTGTGCTCTCCAGCCCTAGCTGTAATGCTCCTGGGGTTGGCATTTGGTTCCATCCTA
CAGCGAAACAAAAAGCCTCTGTGCCCCAGGTATGGGGCAGGCAGAAAGCAGAGGTTCCGG
CTAGTGTGGAGAGTGGCCGCAATGTTGTGTCACCTGCTGTGTTCTCGGATCTCTGACTCA
GAAGCTGCGCCTACATCACCCCTTTCTCTCCTTTTCCTCTTCAGGGCTTTGGACCTGGAC
CTGTTCACTAGGAAGCTGCCCTCCCTGCCACCCAGGCCATCATGGCAGCCCGCCTGGTGA
AGCGATGCGCGTGCCTCCTGAGAGAGGCCACCCTTCTGGCCCCTGTGGTGCCTCCGGTAG
GCCGACTGAGGCTTGCCAGCATGGCGCATAGGACTCTGACTTTCTCAGCCACCTGCCCCA
GTTCCCACTTCCCAGGCCCCTTGTCGGGGCTTGTGGAGAAGGAACAACCGTCTGCCCCCT
GTCCAGAGCACCAGGAGGTGGAGCGGCTCATTGAGAAGGCCACCCGGCCAGAGGAGCTCC
TAGAGCTGCTCAGTGACAGTCGCTGCCTGCAAGAGAACCATGCGGCCCTCATGCTTATCC
AGCTTTCTCGCCTGCTGTCTGACAAGCCGGAAGACAGAGCCTTGCTCGTGCAGGATGCCC
GCTTTCAGCAGCTTCTCCATCTCGTTGACAGCCAGGTGGGTTTCTAAAATGTTCTCTCAG
GGTTCCCCATGCAGAAAACAATGGCACCAGAGTCCAAAGCAGCCAGTCACTTTGCAGGTA
TAGACGGGAACTGTGCTGCCTTGCTTAGTTCTCTCCGTCCTGTGAGAAGTTTCTGTCGTA
TAGAAGTTTTTGCTTGCTGTTCCCCACTGATCACAGAGCGGTCCCGTTAGGTGAACATTC
CCATCCTTCCACTGTCCTTTCAGCAGCACATGGGACGCAGAAGCACAGGAAGCCGCACTG
GTTCCACCCGGTTCCTTGGGTGCTTGTCCCCTTGCCAGGCGGTGCTGACTTGCATGACCC
TGCCGCAGTGTCTGGCCAACTGTGGGCACACTCCTATGGCTGCAGGGGATGTGGGGTGAC
TGACGGGGAATCCCAGGCAGCCGGGCGGGGTGGTCAGACCTCAGGCCCTCTCTGGGCTGG
CTGAGGAAGGACTCCCTTCAGCCAGGCTGTTCGCTCCGGTGCCAGGGGCCCGTGGCACTG
GCTGCGTCGGCCCTCACTCCCTGCCTGGGTCCGTGCTACCGGGAAGAAGCCGTGCTTCCG
ACACTGAGCAGGGGATTCTGTGTCCAGTTGTCCGAGAGGATGGGGAGGAGAGGCACGGAT
CGGGGTGGCGGTTGCACTAACAGTGTTTTCCAAACCAGAGGCTGTGAGAGTAGTGGATGT
GGCCGGCTGGTTTTAACGAGATAGGGTAATGGAGAAAATGCCAGAATGAGTGTGTGGTAA
GGGGAGCATGGCATCCTGGAACCTCTTGCTTCAGTTAGAGGTGTGTGATGGGGTCAGGAC
ACCAGTTTGCTTCGTGGTGATGCCATAGATGGTGACGGTTCACTGAGTCCCTTCTTGTTC
CGAGGCTGTAAGCCTGTAATTGTCAGTGCACATTTCACACACACACACACGGAACCGAAG
CAAGTTCTGGGAGACAAGAGTGAACCTTGTAACAGAGTCGTAAGCTGAAAGCAAGCGGGG
ACCAGATTATGGGTAATGCAGATGGTGGCCAGGCTCTCTTATTTGAAAGTGTCCCTGCTG
TCATGGAGCATGCATGTCTCCAGCTGCCCAGCCCCTCCACGCCACCTTCCCTGTTTGCAC
TCAGCCCCCCCGCACCCCCTAACGGGCAGAGGCTGCGTGCTGCAGGTGGAGCCGCACCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTGCTGCTGCACTTAGAGCGGCGCTGGACGGAGATCGATGATGGCCGCACTGCGG
TGGCCCTGATGGCGAAGACGGGGCACCTCTCTGAGCCGCTGATGAACCGCCTGGAGGACA
AGGTACTGCGGCAGGAGCCCTGGGCAGCTGCAGGCGCACCCCGTGGCCACACAGTGGACC
TAGCTGGCGGTGGACCTAGCTAGCAGGCTGCCGGCTCTCCTCCTCTCCCTGGAGGGCCTC
AGGGGTAGGGCAGAGCCTAAGCCGCGCTTACAAGGGGGCTCCACTTAACGCTTCTGGTGA
TGTGCCACACGCCCCGGGCAGTCAAGTCAAATTCGGCCCCCGCTCCTGTTGTAGCGAGAG
CTGGCCCAGATGGCTGCCACAGGAAGCTTGCAGCTCATGGGCTCCGGGTCCCCTGCCCTG
GGACCCGGGGATAAGTTTGGCTGCAGACAGTCCACTTCAGGCCCACGGGTGCCCCGGCTG
AGAACCGAGTAGGCCCGCACAGCAGGGTACTGGATTACTGAGCTCAGGTCCAGTCGCTGT
CCCGCAGGGGCGGTGCTGCATGGGATCCCCGGCCTGGGCCGCCGAGCTGACCCTGAGGGC
TGTGGTTGACAGTGCCTGGAGTTGGTGGAGCGCTTCGGCCCCGACGAGCTGCGGAAGGTG
CTGGTGACGCTGGCGGCTCAGAACCGGCGTTCAGTGCCCTTGTTGCGCGCTGTCTCTTAC
CACCTGGTCCAGAAGCCATTCCCGCTGACAAAAGGCATGCTCCTGGATCTGGCCTATGCC
TACGGTGAGCCTTCCCCATGGGGAGCGGTGGGAAGGGAGGCGGGCTGGCCGCAGCTGTGT
CAAATTCGGTGCCCGCCCACCCGTGGCAGGCGCCGGCCCAAGAGGCTGCCACAGGAACAC
CGTGGCTCATGGGCCCTGATCCTCTGTGCTGGGCCTCAGGGATAAATTCTGTCACGGACA
CCAAGCCCCTGGAGCTCCAGGCCAGGCACTGGGGGCGGAGGGAGGGCAGAGCAGCCTGCC
CACCCTCACCAGGTGAACCCTGGGGTCGCTCTGTCCCGAAGGCAAACTTGGCTTCCACCA
GACCCAGGTGCTCCAGCGCCTGGCTGCCGACCTGCTGCCCCACGTGCCCAGCCTGACGTC
CGGCGAGGTGGCCCGTGGCGCCAAGTCCTTCGCCCTCCTCAAGTGGCTCAGCCCTCCCCT
GTTCGAGGCCTTGGCCCAGGTGAGCCAGGCAGACCCTGCTCGTCCCACCGGGGAGGCATG
GCCGCCCCGGACACTCCCCGGTTACGAACAGGGGCTTCCTACCCGGCTCACTCGTAGAGG
CGCGGCCTCTGTGGGCAGTGGAGAATGGTGGGTGAGGACGGTGTCCTCCGTCGTGTCACT
GGGCTCTGGAGGAGTTTCCATCTGTCTTCAGGTGGCTATAGCAGGACGTAGTGTGGACCG
TGAGGCTCGGAATTTGCTCAGGGCTCTAAACTTCATCCCCTGAAACAGCGAGGAGAGACA
CTTAACTTTACCTGCAGCGGCTTGAGGCTGCGCAGACCACCCGGGGTGTTTGTGACACTA
CCACCGGTTTCTGGGTGGGGGCAATGAGCAGGGGGAGGTCTGGCCCGCCACCCTGTCCAG
GTGGCCCCCGGGCGGCTGGGGGCTCGTGGGCCCTGTGGGAGGGCCCCTCTCATTCTGTCC
TCCACCCCGTGTGGCCGGCCCAGCACGTCGTAGACCGAGCCCACACCGTCACCGTGCCGC
ACCTGTGCAACGTGCTTCTGGCCTTCGCACACCTGAACTTCCGTCCCGAGCGAGAGGACA
AGTTCTTCGGCCTGGTATGGTCTGTGCACCTGTTCACCCACCCTGGGTGTGGAGGCAAGA
GAGGGGAGCCCTGACCCGGGGGCTTCACGGGTGAGAGGGGAGCTGGAGCCCCGTGTCACA
CGGATGGTCTGGGGACAAAGATGTGAGGTCTTCTACATGCCTGCTGTGCGGCCGTGTGCA
CAGGTCGGGAGGTGTTGGCCAGCTCACTCGCCGCAGTCAGGGCTAGGGGGCCACTGGTTT
TCCCTTACTGTCCTGCTGGTGCTCTGAACCCTTGGCACACCACCATGCAAAGCAGGCCTG
AGCAGGCCCACTCAGGCATGACACATCTCGCATGTGCACCTGGGCCTCCACGGGGACACT
GCCCTCCTTGTAGTCTCCAAGTTCTCTCAGGGCCAGAAATCCATCCCAGGGCCCTGTGAT
TTTGTGCCACAGGCCCTTGCTGCTGGGAGGGGCAGCAGGAAAGTCCTGCTGCATGTTGTG
CTGTCCGTTAGTCCCGGGTGAGGAAGAAGGTTTCTGGTACTTTCTACTGGGGGAAGGGGG
GGCTCCAAGCCTGGCCAAGAACATCAGCCAGGATTGCTCCCAGTAGTTGTTCTAGCCTCA
GCGCAGCCAAGCCATTCCAGCATTCCGACTGCCTCCGGCCCAGGAGGTATGCGGCTGCTG
AGCAGAGCCCCCCCCACCCCGCCCCTGTCTAGGTTCACGAGAAGCTGGGGCCCAAGCTGC
AGAGCCTGCACCCGGCCCTGCAGGTGGATGTGGTGTGGGCGCTGTGTGTGCTGCAACAGG
TGCAGGGGGAGGCGCTGCGAGCGGTGCTCTGCCCTGAACTGCATGCCCGGTTCCTGGGTG
AGTGCTGGGGCTTCCCCTCCCCTCCCTAACCCCAGGGGTCTGGGGGCCTCAGGCCTGGCA
GGGAGGGGGCTCCAGAGCAGCGAGATGGTGCCCAGAGCTCACCTGGCTGGCATCTGTTCC
TCCATCCCTCTGCCTCTCCATGTGCGTGGCCCTTATGATCTTGTCTCTGCCCCTGATGAT
GCCAAGTTCAGAGTCAGTTGGGATCGAGGGTGTCACTGTCCCCTGCCTGGCCCCCCTCTT
TCTCTGGCCCAGCGTCGGCCTCGGCTCACCCTCCCTTCTCGTTCTGCCTCAGGCAGTGAG
TCCCCAAAGGACCAGAGCACCTTCCAGAAGCTGCTGCACATCAGCGCCACCGCCCAGCTG
GAGCACCCTGAGTACACGGGCCCCCTTCTGCCGGCCTCAGACTGGGCGCCCTGGCTCTTG
GCCTGTGATGGGAAGGCCACACCCCTGCAGAAGGAACTGCGGGACACCCTGCGGGGGCTG
CTGGGGAGCCCCAGTAGGGGCAGCTTCGCAGTGGCCACGCAGTACGGCTGGGTTCTGGGT
GAGGCCCTCTCTGCACTACCCCGGTGGTGGGCACGGGGCTTGTTCTGTCCAGGACAAGAT
CTCTGTGCCCCAGGGACGGTCCCTTCCATGTCCACCCGTGCCCCTCCCTAGACGCCGAGG
TGCTGCTGGACACGGACGGCCAGTTCCTGCCCCTGAGAGACTTTGTAGCCCCGCATCTCA
CTCCTCCCTCGGGGACCCAGCCGCTGCCCCCTGGGGCCAAGAGGTAGGTGGCGTGTGGCC
GGCCCTGGACTCTGGCTCTTCTCTGGTGCCCCCCTCCTCCTTCCCCCTCCCCCGGGAGGA
TGCCCAGCGCTCTGCCCCTCCCCCACCAGGCTGGCGTTCCTGCGCTGGGAGTTCCCCAAC
TTCAGCAGCCGGAGCAGAGACCTGCTGGGGCGTTTCGCCCTGGCCCGGCGTCACGTGCGG
GCCGCCGGCTTCCTGGTGGTAGACGTGAGTACCGCCAGTCCAGTGGGCCCCTTTGTGCAG
GACGAAGGGAGGCCCAGAACCTCGTAGATTCCCTGTGGCCACGGCCCTAAAGCGTCTGCT
CAGGGCTCTTAGAGCAGGTCTGCGCCCCGCGAGTGCCTGGCCCGGGGCTGCTGATCCCTT
CCAGAGCAGACAGTCCTATATGGGCCGGGGAACCCAGGAGCGCCAGATACCGTGTGAGGG
TTTTGTCACATTTACTTCTTGTGGTAGTTTTGGTATCTCAATGGGCTTTTGTTTTTCACT
TCAAAAATGAAGAAGTTGTCATCAGGTGCCACAGATTCTCAGATGCCTGGCCCTGGGGGC
TCAGGCCCCGGCACCTTCTTCCACAGCCACACTCGGCAGCTTCGTGGGCTTGGAGGGTGG
GGAGGCCAGGTGTGGAGCAGCGGGCAAAGCACAGGTGCCCCTGCCCCCTGCAGGTCCCCT
ACTACGAGTGGCTGGAGCTCAAGTCTGAGTGGCAGAAAGGCGCCTACCTCAAGGACAAGA
TGCGAAAAGCAGTGGCGGAGGAGCTGGCCAAGTGACCCAGCCCATAGCCTGGACTGCACC
CTGGGGGACCTGGCTCACAGCCTGGACTGCACTGTGGGGGAGCCGGCCGGCAGCTCCTGC
TCTCTTGTGGGCAATAAACAGTGAATTCTAGTGTCCACATCAGGAGGTGTCCCGGACTTT
GTCACCATTGCCACCACCCACCCTGCTCTCATGGCGGCCTGTCTGTCCCGGCTTCTCTGC
CTCCCCAGGTCCCCTTGTCCCACATGTTCACACAGAGCCGCCTGCTGTTCACACCGTGTG
GTCCACACCCAGGGTCCTGGGATTCCAGCGTTTGGGCTGCGAGGACTTCCTGGGTCAGGC
CTGTAGGGTTTTGAGGACACGGCTTGGGGTTCTGATCTTGGTGTGGGCACTGACCACAGG
CGTCCTGGGCGTCCCTGCCTGCCTGTGCTGTGGTCTCAGATGAGTGGAGGACCCCCAAGG
ACCCAAGCTGACCAATGTCACTGGCTCTGGAACAAGGGACAGGTGCAGTCAGCTGACAGG
GTGCAGCTACCATCACCTCCAGACCAGGGGGATGTGCCCTGTCCCTGAGTGGCCCGAGCC
TCATCCCTGCCCCACCCAGTAGTCTGTCCCTTCCCCAAGCCTCTGCTGCAAAAGCAGGAT
GACTGCCACATGCTGCCATTTGCCCCCAGCAGCTCAGAGCGGGGCAGGGAGAAGGGCCAT
CTCCAAAGTGGTCCCTCTGGAAGAGCTAGTCCAGTCTCCCAAAACCGTGCAGCTCCCACA
GACGTTGGGGTACGGGTGGAGGGGGGCCTCTGGCATTTGTCATTTGCACAGGCCAGAGGG
AGGAGCAGCTGAGAGGACTCTGAAGCCGGTGTCCCCGAGCGTAGGCAAGATGTGGGGGCA
GGGATGACATCATGCAGTGAAGAACGGGCATAGATGAGGGTTGGGGCGTGGAGCTGGTCC
TGTCCACTCAGGACCACAGGCTTTCACTGGAGACGCTCAGGTCCCTTTGCAGTCTTGAGA
CATCACAGTGGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1414, 2828..2941, 3432..3603, 3881..4038, 4523..4633, 5312..5456, 5752..5997, 6111..6222, 6329..6443, 6893..6994
1001..1414, 2828..2941, 3432..3603, 3881..4038, 4523..4633, 5312..5456, 5752..5997, 6111..6222, 6329..6443, 6893..6991
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved