Felis_catus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Felis_catus TOMM20
Felis_catus
TOMM20
GeneScaffold_3466
SNORA14
1553..1687
24667
GATATAGGCCTTTCCGCGTCCCTAGAAGCGAGAGACAGGTCGCAGAGGCGCGGTCCGCT
GAGAGGGTTCTCGGCCAACTGCTTCCACGCGGGGCCCGACGCCGCGGCGCTCGCTCCTGC
TCCTCGGTCGAGAGAAGATGGTGGGCCGGAACAGCGCCATCGCCGCCGGTGTCTGCAGAG
CTCTTTTTATCGGGTATTGCATTTACTTCGACCGCAAGAGACGAAGTGACCCCAACTTCA
AGAACAGGCTTCGAGAACGTGAGAGGGTCCCCTCGGCACGGGGCCTGCAGCCTCTCCTCG
CCTCCGCTGCTTGCTCCTCGATGCCGCGCGCGGGGGTGTGGGGGGTGTCGAAAATGCGGG
GGGCGTAGGGGGTGCAGGGCGGCCGCGGGCCTAACACAGGCAGAAAAAGGCGGCGGCGCC
GGCTGCGCGCTCCCGGTGCCGCTACTGCCTATGGGGCCCCACATGATTGCCTCCCTTTTG
GAGGGACAAATGATTCCCATTTTATCTTACCCGATCATCTTGCCGTATGACTGCATTCTG
GGTTCGTGATCATGGACTGAGAAAGTAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCAATGCACCCGTATCGCTGCTGCATTCTTAAACCCTCTTGGTAGCTTTCC
TGAAAATGCTTCCAAGATATGAGTGAATGCTATAGAAATTGCAGGGGAGTCCAAAGGGCT
GCGCTTCTCCTGTGGCTCAGTCTTATTTCATACCTGCGACATCTTTTACGAGACATTTAC
AATGAGGGAGGTCGTGCCACCAAAACCTTTGTGATCTTTGAATTCCGGAGGCCTCCAAGA
GCAAATGTGTAGCAATAAGAAATATTTTTGTAACTTTTCTGGGCTGTTCAGTCAAAACGC
TTTCTAAAAATTAAAGCCCAGAATGTAGGAAGAAATGATTAGTCTATTTCACACTTACAG
TTTGATTAAGCTGTAGCAGGTTGTCTCAGGTGTTCAGTGCCCCACGTGGCTAGTGACCTG
CCCTCTTGGGGCTAGAAGATGATCTTGTACCATCTACAATATGACACCTAATTCCAGCTG
TCTTCTGTTTTAGGAGGGAAGGGATACAGAGAATTTATTTTATTTACAGTTAGATAGATG
GGGAGGGTGCCATTTTGGATTCAGAAACTCAGTTTTCCAGGCCCAGGTTAGTCACACATC
AGCTGCATAATTTGGGCTTTCCGAATCTTAATTTTCTTAGTTGGTAAAATCAGGTGATGC
CACCTGCCCCTGGTTGTTCTTGTGAAGATTGAGATGTTTGAAGTGCCCACCATCATTCCT
GACCCAGAGAAAGCCCCTCTGCAAAGGCTGGCTGTAAACATTCACTAGAAATTGAGATTA
TTTTCTTGTAGTTTCCATTTCAGCAATAGTTGGAGGCATGGTGGTGGTGGTATGGCTACA
GAGCTCTATAAAGAGTAGGTTAATCCTTTCTTACTTTGGAAACACTGCAGTCCTATTAGA
AACCTTGAGAAAACTAATTTTTGGCCGAAGAAATCATAAAAGCTGTCCTTTTAGACAAAT
TGAGAGATTATTTTCATAATCCCTTTTCCATCATCTTCAATCCACAATTTTTTTTCTAGC
ATTAGCAATGGTCTACACTGATCTCAGTGGTCAGTTGAATTATTAGCTGAGTAACCTTGG
GCAACCGACTTAAAGCTTCAGTGTCCCTCTTCTGTAAAATGTTATAATACATACGGAGTT
TAGTACAGTCCCTGGCACATGGTAACTGATAGATGCTAGAGATTGTTTATGAATGTAATT
ATTATTTGACATTTTCTTTAGGAAGTAAAACTTATATTCAGAGTAATTCTGCAATCTGTA
AGTTCCTGTTTTACGTGTATTTTTAAAAGTAGATATGGGGCGCCTGGGTGGCTCAGTCGA
TTGGGCGGCCGACTTCGGCTCAGGGCATGATCTCGTGGTCCGTGAGTTCAAGCCCCGCGT
CCGGCTCTGTGCTGACAGCTCAGAGCCTGGAGCCTGTTTCAGATTCTGTGTCTCCCTCTC
TCTGACCCTCCCCCGTTCATGCTCTGTCTCTCTGTCTCAAAAATAAATAAACGTTAAAAA
AAAATTAAAAAAAAAAGTAGATAAAGTCTCTTTTAACTTGTTAGGTTTACACAGTAGCAC
TTGGGACTAATTTCTAGTAAATACTGAGTCAAGGGCTGAATTGTAACTGAATGTGCTGAA
TTACTGAATGTGTAACTCCCATGATTTTTCAGGCCCTTACCATCTTTCCCTTTATCATAG
AGATAGTATTATGTACTGATAAGGTGACAATTAAATTGTCCCAAGAAACTAAAGCTAGAA
TCTTACCGGTAGAAATTTAAAGGAACTAAACCATCTTAAAATTGGTAATTCTATCAGTCA
GACATGCAACGACAATCACTCCTCTCCATCCTATTAAAAAAAAGCAACTATTAAGGTTGG
ATAGTAATGGAAAACGAGTTCCTCTCTACTGGGTTTCGTTATTTTTGTCATTTTTCATAA
ATTCTGGCTTAGCAAACTGGACGTACCTGTTTATTCCACAAACTTGCCTTGTTCATTTCT
GAGGTACCTTTTATTTTTTTATGGGGATGTCTTCACGTCTGGTAGAAGGTAGAGGAGGGA
CAGTAGAGTTGTTCTGCAAACTGAGAAGGCACTTTGAAACTGGAAAATCAAGCAGGTGAC
CCCATGGGTTTACAGTTTTATTCAGCATAACTTAACGGGGGTGGGGGGAGTCAGATGGTG
ATCCGGCTGCAGATTTCCCCCGCAAGGTCCAGACCTTCGTCCGCAGATTTTATAGAGTGA
AGAGACTAGCAGAAGAGCATTGTTGCAAGATCGAAGGGTTCGCATGCATCTCAAAGCGTT
TGCATTGACCTAAATGACAGCTAACCTTTAATTCTATATTGTGGCACTACGTGCGCGTCA
GGAAGGAGAAAGACTATGTTCTCTCTCTCAGATTGGTGGGGGGCCAAGAAAAAGCCTTCC
CCAGTCCTCACCTTGGGCCTTTCTGAGGCACGTGCATTAATCTCCAAGGGTCCGGGAACA
CACAGTCCCAGGAGAGGTCATCCAGTGAGCTTGAACAAGACGGAAGGCCAGAGATGGAGT
CAGTATTGTCGCCACTCTTAACGACTTCTCGCCAGCATATAGAGGCAGTACAGAGTAGTG
TTTGAGTACACACGTTCTGAAATTCAGCTGCTTGCTTTTGAATTGCCCCTCCGCCAGTTA
TTAGTTGTGACCTTGGTAAATTTTCTCAAGTGGAAATGCTAATCATACCTGTCTTAGTGT
TCCTGAGGAGTAGGTAAGCCAGTTGATACTTAGAATAGTGTCTGGCGTGTGGCATCTAAA
ACTTACTGAGTGCTTACCCTTCACATCTGACTGTTCCTTTGTCTTCATGTCTGGTCGTGG
CAATCTCCTTCCAGCACTGGTGATGTTTAGTAATTACTTGATATAGTATGGTATTCATTA
TTTTCTGCTTAAAGACAGACAGACGGGGGGACGGCTGGTTGGCTCAGCAGGGGTGGCTCG
GTTGGTTAAGGGTCCCACTCTTGATTTTGGCTTAGGTCGTGATCTCACACTTCCTTGAGA
TCTGAGCCCTGCCTGACAAGGTGGAGCCTGCTTGGGATCCTCCCTTCCTCCCTCTTCCCC
CTCCCCCGTTTGTGTGTGCGCATGTGTGTACTCTCTCCCTCAAAATGAATAAACATTTAA
AAAAAAGAAAAATGGGCCGTCTTCACTTGATCCTAGCCAAAAGGCCAGGAAGCGATGGAC
TGTCTTCAAGTTTACATACAAGATCGGCTTATTTAACCTATATTGTTTTGTTGAAACTGC
TAGAATTGTATTTAAGTCTTAGAGTTGTAGCACTTTAGGTACACTGGGGGCTAGAGTTGG
CAAGAGCTACTGGTGTGGTTAAACCCAGTTTGTAAGGGGAGATAAGAAATTTCCTGGACC
ACAGTTAAATTAACCCATCTCCCTGCAGTTAGGCAAACAGGTCACTACCTCTTCAGTCAT
GCACTGATTAGACTTGGATTTATAGAACACTAAGGTTTTCAGAGGACGTTTGCTTGTCTT
TTATGGCTTTTGTTCCTCGTAGTAGTAAGAGTAAACATGCCTTATCTTTGCAGAGTTAAG
AGATTTATTTGCCAAAGATCACCCACATAATAAGCATTTGAGTCTTACCTTTCTTAGCTC
TGCCACAGTCTCCATGTTACCGGTAGTTTTAATGATTAGTAATGCAGCATGGCACAACTC
GTAAGCTGAGGAGCTGGTGTTGAACTATCTCGGTACCACATGCATACTGAGGTCGTTCAT
TACCAACTCCTCGTGTGGCACGTGATAAACCGGACACAGTTAAGAAATATTTTACATGCA
TTAACTCATTTAATCTTCACAAGAACGCTGTGAAGCATGTACTGTTCTAGACCAGTTTTA
CATCCGGAGAAAGTGGGGTACGGGTTCCTGTAACTTGTCCTGGGTCACACTAGTAGCGAG
AAGAGCTGGGGTAGAAGCAAAGCTAGTGCTTCCTCTGTGCTAACACTCCTTCATGTGGAG
TATATAATTAAATAGCAATTTAAAATACCGTTGGTGTCCTTTATTGATTTGGCTTAAGGG
TTGACTAATTGATGATTAAGATTTTAAACATCACTTGCTTCTGAGATAGGTAGTATTGCC
TTTTCATATCAAAAACAAGACAAAGAAACAAAACAACTTCCAGAGTGTAGGCAGAAGTTT
TTTTCTTTTATTTTTTTTCCAGTGTTTAATTTTGAGAAAGAGACAGAGTGTGAGCATGGG
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCAGCTCTTAGAAACTGTCTGTCTTGAAAATTGCTGATCTTGGTGCCCCA
GAGGGAAGGAAAAAGCTCTTGCTCAGAAATGTCACATTGTCCATAGCTCATTGACCAGAA
CTGTTTATAAGACCTTGACAAATCACAAGGAGACAGGAGAATAGGAGAGCCCTACTCAGG
GATGTTTCGCAAATAGCATATATGACTGTCACAGCAGTTTGACTTCTTTTGATTCCCATT
TTAATGATGATAAAGTGAAAATATTCCATGTCTTGCAGGAAGAAAGAAACAAAAGCTTGC
CAAGGAGAGAGCTGGACTTTCCAAGGTAATACTTAATCTGTTTTTTTGTTTAGGTTGTAT
AATATACTTCATACTTCACTTGAAATGTGTATTTTGAGAAAGCTAGTTGATAACAGGCGT
TGATTTTTTTATTTTAAAATACAATTTGTTGTTTCTCGGAATAGTTAAGTCAGTTCAACT
GCAGATTATCCGGTCCATCATTATTTCCTCCCTGTTGGCCCTAACTGCAGACAGTTTATT
ACATGAGCAATATTTGAGGGGCAATAAGATGATACTCTCCAGAAAACAATTCTACCAAAA
GGTTCAAACTTTCTCACTCAGCTGCTTCAGAATAATACAATACAACATTAATTATTAATT
TTCCTTTGTTCAGCTTCCTTTAAAAGAACCACATGCTATTTGTTTTCAGAAGTTATATAG
GATTATTCATAGCCTCTGATCCAGAATCCCACTGTGTGGCACATTTTTACCTTGATGTAA
TATGTACATATAGATATAAATCTTTCTACTTTTTTCTTTTCATAGATCCTGTGTTCATGA
TTATTTTTAATGACTACATAGGTTTCTCTGCTTGATAAAAAAATGTTCTGTGACATGTGT
AAGTCAAGTAAGTAAATGTTAGTCATTGCACATATACCTCATATACCTTTTCTTTTTTAT
TAGAATTAGTTCCATTGCTTGGATTCCCAGGACTTGGACTACTGGATCAGTAGTGGTTCT
TTTTAAAGCAAGTTGGAAAAAAAGAAAAAAGAAAAAAATACCAAGTTGGAGCAAGGAAAA
ATGAAATCCACAAATGTTATATTTTGTTGTTGTGATACAATTGAGTAATCCCAACATAGC
TAAAAGACTGGACATGATGATAGGGAAGTGAAACTGAGAGGTGGCCACTTTGTTCCATTA
TGTCCAGACTCCCTTTCTGAAATACGTAGCATGTTCATAATATTTCAGTAACCTTTTTTG
TCTTGACATGAGAAAGTAGGTATAGACACATGCACCGTGTGTATTTTCAGATTCAGTTGT
AATCACATTCTTGCCTGTGTTGGGCTGGTTGATGAAAGATGCCTCTACTTTCAGAAATTT
AAATTTTTTGTGTGTTTGTTGGTAATGAGAATGTATAGAAGTCAGGAATCAAAAACTCCC
AGTAATAGAAGTCTAGGTTTTTAAATAAAACAGGCCTTTTTTTTTTTTTTAAGGTTTATT
TATTTTGAGAAAGAGCATGAGCAGGGGAGGGTCAGAGAGGGAGAGAATCCTAAGCAGGCT
CTGTGCTGTCAGTTCGAGGCCTGATGCGGGGCTTGAACTCATGAATCGTGAAATAATGAC
CTGAGCCAAAGTAAGAGACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTTTTTATTTTTATTTTATTATTTTATTTTTAAAAAATTTTTTTTAAATGTTTATTTA
TATATATTGAGACAGAGACAGAGCATGAACAGGGGAGGGGCAGAGAGAGAGGGAGACACA
GAATCTGAAACAGGCTCCAGGCTCTGAGTGGTCAGCACAGAGCCTGACGCGGGGCTCGAA
CTCACAGACTGTGAGATCATGACCTGAGCCGAAGTCAGATACTTAACTGACCAAGCCACC
CAGGCACCCCAAAACAGGACTTTTTAATAATAGGTTTACATTTTTTGAAGAGACAAGTCC
TGGGGCACCTGGGTGGCTCATTCAGTTAAGCAGTCAACTCTTGGTTTTGGCTCAGGTCAG
GGTTTGTTGGTTTGAGCCCCGTGTGGGGCTCTGTGCTGACAGTGCGGAGCCTACTCGAAA
TTCTCTCTCTGTTCCTCTGTTCCTCAAAATAAACAAACTTAAAAAAAATAATAAAGAGGT
AAGTCCTATAGCTAGTGGCATTATGTATTACCGTAGTCTGATAATATGTAGCAAACTACA
AAACCAAAAACTTAAGTAAAGCTACTTGTTAACAGTTTGTGTTAGCAGAGAAATTAGGAG
TAGCTCAGATGTCCAACAAACAGATTGTGATTATGCAATCCTGTATTTCTCCATGGAATA
GTCTCCTACCATTTACATGTAATCTTTTAGATGCATGTAAAATCTATTCAAAATAATGGA
TCAGAGGAACAGTTGGTTATAGTTATATAAAAATGTATAATAATGGGGATCAAAATAGTG
TAAATAGTAAATTGCATATTTTATGGTATAGATAATTGTAGTCTTCATTTTTTAAGTTTG
ATGCACAGCTTTCTAAGAACTGTTCTAATTTCAGTTTAATCAGTAAGGTTTTTTTTGCAT
TCATTTAAATGTAGATACTAAACTGTAATGCTTGTGAGTATTGAAGAGTAAATTTATTTT
TTATAATGAGCTCTTCAGTTTTTTGTTCTTTTGTTTTTAGTGCAATGATTTTCTCTGTAT
TGGTTATATTCCCAGCATAATTTTGGTATCATGTATTAAATGTTCTGTTTCCAAACAGTT
ACCTGACCTTAAAGATGCAGAAGCTGTTCAGAAATTCTTCCTTGAAGAAATACAGCTTGG
TGAAGAGTTGCTAGCCCAAGGTAATAATCATTAAAAGACTAGGAAATTAGAATTCCTCAC
ACTAATACAAATTTGTGGTAGTAACGGTACTTTTTTGTGTGTAGTACAGCAGCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGACTTGAACTGTTAGATCCAGATTGAGAA
GGACAGTAACTCATAGTGGTTGAGGGGGAAGGTGAAGGAGGGACAGGGAAGAGTTATTTT
TCTTCCCAAGTTCATGTTCCACACTTTAACTCAATACCATACAGAGGGTTACTTAACAAC
TCTGCCAAGCTGCTTTTTTTCCCAGTGGAAACCATCAGCCCAGCTCAAGGTTGAAGAGTC
AGGTGGTTAGAATTAGGGGAAAAGTCAACATCAAAGTAAGCCAAGTAAAGGCATAATTGA
CTTAGGCAGTAAACTTCATTTCACATGGTCTCCTCCATCTAGGGGTCTTCCGTAAGCATA
TTCTGTTAACTGAGCCAGATCTCATCTTAGGATACCTTGAATGGGCTCAGGTCTACAAAC
TAGAGAGGAAATGGTTTCATCTGCATTGAATTGCTTTGGTTGGTCATTAACTGTTTGCAT
TGTTTTTAGAAATATTAGGAGGTGTCTCAGAATCCCCTGTGTTCTACACTAACACTCCAG
TAGTAGCTTTATTTCCATTTAATAATCAGAATTAATATCCCCAGGCAACAGTGTAAATCC
CCTACATTGCCTGTAAATTCAACGGCATGAGGATTCAGTGGCCAAGTGGCATTTTAATTT
CCAAGTTAATGGAGTCATTTGTCCCCTGATGAAAGTCAAAGCCCAGGCTGAAGACCTAAG
TCTTAATTTTCTTTTTTATAATTTTTTTTTGAAAATTTTAGGGAGAACATGAGCAGAGGA
GAGGGGCAGGGAGGTTAGGGCAGAGGTGGGGTGGTGGGGGGCGGGGAGAGAGAGAGAGAG
AGAATGAGAATGAGAATGAATTATAAGCAGGCTCCACGCTTACTGCAGAGCCCGACGTGG
GGCATGATCCCACGACCCCTGGGATCATGACCTGAGCCACAATTAAGAGTCAGATGCTCC
ACTGACTGATCTACTCAGGCACTTCAGTCTTTTGTGTTTCCTCTTTTAAATACTTCTTTG
TAGAGTTGTACTTTCTGCAGTTTGAATACCTCAGATTTTCTCAAGTGAAAATGTTAAAGC
AGGCAGTTCCTCTTTATACACCATTCTTCAGTCACTTACTCGGTCATTTTCTTCTTCAGG
GTCAGAAAACTTCGCTTACTGGTTTCTTATAGAGGCTGTGACTCCGGAGCAGGCAGATGA
AAGAGATTGTGCAGGGTGGTGGGTGGACAGGACGGGAGTCTTTCGTCGTCTGGATGCACC
ACCCTCCTAGGGTTTTTTCTGTATCTGCTTGTGATGCCATTCAGATAGTGTAAAGCGATT
AGTGTAAAGTGAACTTGGACTTCTTTTCCACCTCAGTCCCCAGTCTTCAGTTCTTTCTTC
TCATAGAAAAGTACTGTTCCATTGTTAGCAATTTTCAATATGTTGCAGAAATATTCTAAG
TCTGTAAACGGTAATATACTTGCATATTTCTGCACTTAGTCTCTCCCCTTCTGTGTGTGT
TTTGAAGATCCTTTCATATCTGTGCGTGTGATCTGATTCGTTCTTATTAATGGTTTCATA
ATACTCAGTTATATGAAGGTACCGCAGATTATTTCCAGGCTTTTACTTCTTTGATGTTTT
TGGTCATGATCACTTGGAAACGTAGTGAAGGCTGTACAGTTGAGTTTTTGACAGAGGCAA
ACAAAGGCTTTCCAGGTCACGCTACTTTTATGTAAATCTTCCAGGTGAATATGAGAAGGG
TGTAGACCATCTGACAAATGCGATTGCAGTGTGTGGACAGCCACAGCAGTTGCTGCAAGT
GTTACAGCAAACTCTTCCACCGCCAGTGTTCCAGATGCTTCTGACCAAGCTTCCGACAAT
TAGTCAGGTGAGGATTTGAAATGTTAACAAAAGTGAGTAGAATATAAAAAAAGAAATGTT
TTAGGGACATGGACTTTTAAAAATTAGTGAAACCATAAAGGCCATTCTTACTGTTACAAA
GAAAAATTAGTCTAGTGAACATGGTGAAATTCTGAAACTCATTCTTGGGATGAAATCAGA
ATTGGAGATACCCGTGCTTGAAAATGGTCTTCCCTGATAACATTTGAGTGAGTGGTCATA
AGATCTAGTCCTTGTGCCCTCTGTGCGGATCAGAAAGTGTGTCTCAGGGGCACGTGGGTG
GCTCAGTCAGTTAAGCATCTGACTCTAGATCTCAGCTCAGGTCTTGATCTCAGGGTCCTG
AGTTCAAGCCCCACTTTGGGCTCTGTCGTGAGTGTGAAGCCTACTTCAAACAAAAAAAGA
AGTGCGTCTCATAGTATTAAATCTCAGACCTTGGTATTCACGTACCGAAATTCAGGCCCC
TCTCACCTACTTTCTAAAAGTAGCTTTCTACCTTCTCTTGTGAGCCCATGCATTCAGTGA
AGTGGCCTGGCAGAGGACAGAGGAGCTAAGATGGCACAGCCTGAAACTAGATCGTAAAGG
ATTGTAGATTGCCTCTGACCTCACTTGTCTAAAGGCCCCAGTGCCTCCGCTTTTGCCAAG
GTGGGCTTTGAGCTTGGAGCTATTTAACCACATCCTCAAATCTGTATTGAACACAGTACC
ATTTGTATAAAAGATGACCTATAACTTAAGAGTTGATTAAAATTGCATTCTGTTCATTTT
TAATCGTCTCCAGGAACTGAAATGAATCTATTTTTTGGAACAGTTTGTGTATTCATGTGT
TAATTCCCATAGTTGATGTGATTAAAAATTAATAAAATGACTGGTTAGTTCTTCAAACTG
ATCTTTATTCAACTAGTTGGAGAAGGGACTAGAAAGAAAACAAAGTCCCCAAAGATTTAA
GGGAGAGGGTTGAAAAACCAAAGATTTGGTCTTAAACCTTTTTATTTAGACTAATGTGGC
TCCTAGCGTGTCTGTATCAGAATCCTCTTAGAGTGTCTACTCTTGGAAAGGCAGCATAGC
GTGGTGCTTTTGGAAGATTGACCTGAGGGTGAGGTCTTTTGAAATATGGATGAGTTTGGG
ATGAAGCCTGAATTCCTCTTTATAAAAATGGCCTCCTTTACTTAGTTAACTTATCTCATA
TTATTTTGACATATTTTCAAATGCTAATTTTGGAAGTACTTGGGAGCATTTTCAGGCCAA
AAAGGGAAATGTTTGGAGGCTAAGATGACCAGTAAAAAATCAGTATTCTTAGTTTATGTG
GGAGTGAAAGAGATCTTAAATTCTTTTTGGTTTTAGTTATANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGGAAGGAAGGGCCTCAGGGACAAGAGCAGGGGTGGCCA
CGGCCTCGGGAGGGTGGGAAAGGGGCAGAAAGGCATCCGTGCCTATTGAGCACCTACTGT
ATACCGGGTGTTTCCAAATGGGCTCCTGTTTCATCTTCTTGGCAGCCCACGAGGCAGGAA
GAGTCAGCCCCGTTTCACAAGGGGGCGGGGGGGTGGAAGCGAAGGCCCAGAGGGGCCATG
ACCAGCTCAAGCCGCTTACAGGTGGGCCAAGGAGCCCGGCCGGAGTCTGTCAGCAGGCCA
GGCAGGGCTGTGCTCTTGAGCAGGCCTGAGGCCCCGTGCACCAGGCTCACCGGGTGTCTG
AGGGAGGGAGGAGGGGAATGAATGAGTGAATTAATGAGTCTGCCCGATGCCATCACCCCT
CCCCCCCCGGGGCCAGCCCACCCTCCCCCACCTCTCTACCCTGGAGAAGGGGGCCAAAGG
TGATGATGATGAAGGTCATTTCATCCAAGCCTCCAAACTAAAACCCAAAGGAGCTGTCAA
AGGGCAGGGCGACTGAGGGCCTCTGTGTCCCCTCTTCCAACCTCCGTGCTCCCCCAACGT
CCACCCCACCCGGGTCCTTGGCAGAGTCTGTCACGCACCAGAGCTGACCCTAAGCGAGCC
CCTCAGTGGACCCCCACGCAGACCTCTCCCCATTTATCTCGAGGTTTCCACAACACAGAC
ATGACCTCCAGACCCCTGAGGACCTGGAACCTCGAGGACCAGTAGAGGCATCCAACCCAG
AGAGGGGAGAGGGCTGGTACCTGTTCCTCCCGACAGGCAGTGCCCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGACTCGGGGCACCCTGGAAACGCTGTGGGC
CAGGGAGACAGGCCTGGCTGGACTGGAGTCCCCATCTGTCACTCTTGCTGTGTGGGCCTG
TCCTGGCCACTGCACCTCTCTGAGCCTGTTGTCTGTCCTGCAAAGCTAGGACCATAATGT
CTGAGACTTACGTGAGAATTTGCGTTGAGCGCCCGGCTCGGGGCCTAGCATACCGTAGGT
GCTTAGTCCGGGTTTGCTGAGTGCGTGCTGGCCCTTGGCGACAAGTTAGCACCAGCGGCT
TCTAACTCTGCCCCTGGAATGGGTCCTCCTGGTTTCTGAGGGGAAGCTGGGGGGCGGGGG
GGAGCGCAGAGAGAGGAGCCAGGGTGGTCTCACCTCTAAGGCAGAGACAAGGAAGGAAGG
GCCTCAGGGACAAGAGCAGGGGTGGCCACGGCCTCGGGAGGGTGGGAAAGGGGCAGAAAG
GCATCCGTGCCTATTGAGCACCTACTGTATACCGGGTGTTTCCAAATGGGCTCCTGTTTC
ATCTTCTTGGCAGCCCACGAGGCAGGAAGAGTCAGCCCCGTTTCACAAGGGGGCGGGGGG
GTGGAAGCGAAGGCCCAGAGGGGCCATGACCAGCTCAAGCCGCTTACAGGTGGGCCAAGG
AGCCCGGCCGGAGTCTGTCAGCAGGCCAGGCAGGGCTGTGCTCTTGAGCAGGCCTGAGGC
CCCGTGCACCAGGCTCACCGGGTGTCTGAGGGAGGGAGGAGGGGAATGAATGAGTGAATT
AATGAGTCTGCCCGATGCCATCACCCCTCCCCCCCCGGGGCCAGCCCACCCTCCCCCACC
TCTCTACCCTGGAGAAGGGGGCCAAAGGTGATGATGATGAAGGTCATTTCATCCAAGCCT
CCAAACTAAAACCCAAAGGAGCTGTCAAAGGGCAGGGCGACTGAGGGCCTCTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGTGGTGGCACAAAGGATGGTCCTGCCCCCGCACTGTAACGTAATCGCCTGGCTGT
CTGACACCAGGAGCTGCTCGGGAACCATCCCCCTCGGCACAGCTCAGGCGACAGAGGAGC
AAGCTCACAGGAACCACCATGGGGACACATCATGACAGCTGTCCTTGAGGGCAGAGGGTG
GTGCTCTTCCCTAAGGAGGCGATAGGGGACATCTGGGGACGACACGGCCCCTCTGCTCCA
GAGCCGCAAGCTTCCAGTGTGGGTCCCGGCCCTGACATTCTTGCCCTGGGTGGTCAAGTC
CTGTCCCCTCTCGAGGGCCGTGTTTTCTCGCCGTAAAATGTCAGGTTGCAGGGTGACATA
TGATTCCGTGGGGCGGTGCTGGATGAGGTGGTGTTGACAGACACGACAAGATGGGGAGAG
CTAGGGGACGGAGGGGCCGGCGGGCGTGAGCCCTGCGATCGTCTTTCTGGACTCCAGCCG
TCTTTGACGCCGATCTCTTAGTTTTGCACATGGAAAATCTGACGCTCGCAGGGGCTGGGG
GGTGGTGTGGGGGCAGGGCTTTCCCTGTGATTCCGGACTACTGGACCCCCACCCCACACC
ATAATTCCCAGGGTCACTGCCCTGGGCTCTCCTCCTCCTCCTCCTCCTCCTGGGCCTGGG
TCCCCGCTCACCAGACCTTGGGCTGGACCCCTCCGATCAGAGCTCCCTAAAGAATTGCGG
TGTGGCCCTGGCCTCGTGCTGGCCTTCTCTGGGCCCTGCCTGACTCCTTCTCTGTGGTCC
AGGAGAGGATCCAGAGGCCCCTGAGAGAGGAGGTGGTGAAATCTCAGGCTGCAGCTTCCA
GCTGGCCCAGAGCCAAGGTCAGGCAGCAGGCCAGGGCGGCCCCGCCCCAGGGGCTGGCCC
AGCCTCGGACATTTCATAAGGGCTCGTGACTCATAAAAGACAGGGCAGCAAGGCAGAGCA
GGGACGGCCAGGAGGAAGGGCAGCTTGGCAGGGCCTCAGGTACGATGTCCCAGGGAGGTG
GGGTTGGAGCAGCCGGCAGTCAGGGCCAGGGCTCCGGCTGGTGGGCTTGCTCGGGGACTC
CAGGTTGCCGGCTGCCTGGGCAGGCCTGGCCACTCACGGCCACATGACACAGGCTGGCTT
TGTCTTCCTGACTGCCTGGGGAGAAAGGGGAAGGAGGGAGGAACTTCCCTCCGCCCTGAT
CTAAGAATGAGAGCGGGAAAGGGAGGGGCCGAGGAGAGGCTCTGGGGTTCCTGAGGCTGG
TGGTCAGCAGGCACCCTCCTTTTGTGGGAGCTGGACCACCGTCTTCCTCTCGCTGGTGTT
ACTGCGCATCTTTTATGGGTCCGAGGGCCCCAGCTCCGGTCCTGGCTGCCCCAGGAGGGA
ATCCCATCCTTGGGCGGGGGGGGGGGGAGTGAATTGGGGAAGGGGTGGGGGCGTCAAGCA
TCCACCTGGCAACACGTATTTCCTGGGCACTGCTGTGCGTCCCCGGTGCTGGGGCAGGGG
TACCCAGTGGTTCTGGGACGTCTCATCCTTGGGAACGGGCTCTGCCAGAGTCCAGGAAGG
TGGGACCAGCCAGACCCACCCGGCCTCGAGGAGGGACTGATTCTCAGAGGGACATTGCTG
GGAAACGGGTAGCCCGACCTCTCTGTAGGGTGGGGCTGGGGTTGGCTCAGCCCACAGGCC
AAGGGTTGGTCCCCAGTTCCTTTGGTCCCCATTATAGGGAGGGGACTCTGCCAGAGCTTC
TGGAGAGCCTATGAAAATCCAGCTCAGGCTACAAGGGGAGGTCTGGGCTATTAGGACCTA
TGGGGTCACCAAGGCCGGCCCTGTGACGTCTGCCTCCGGCAGCCTGATCGGGGTCCTCCA
GGCCCTCAGACCACCACGTTTATCTCTGTCTCCGTGGCCAGTTCCATATCCCTGCCCCTA
CGTGGCTCTTGCTTCCCTGGTGCCCACACTGGGCCAAAGTCTCCTCGGGCTCCTCCCCCG
GGGTCTCCGCCCTGAAGCTGGCACAGGTGTCCTTCACAGTCCGTCTGAATAACGATCCTG
CAGAGCCAGAGTCACCGAGCACTCACAGGGCTCGGCCCTGCACAGAACACTGCGCGCCCG
AATTCTCCCAACCACAGAGCAGCTACAGGAACCATCCCCATTTCACAGATGGGGAAGGTG
AGCCACAGAAAAGCCGAGCCACCCGCCCGAGGACTCCTGGCCAACAGACAGGACTGCCAG
GATCCCGACCCCGGGTCATCGGGCCCTGACACGTTATACCAAAAGGATGCCCTTAGGAGG
CCTCTGGGACCGCCGAGGAAACTGAGGCAGAAAGATTGACAGAGCGGGCAGAGGCTGGGG
TGGGAGGAGAGTAGGGTCTGCACTGAGGATTGTTCGCCAGCGGGGCTGGCCAGGACGCAG
CAGGTGGGGGCAGGGCAGTAGATTCCCAGTGATGCTCTGGAGCCAGCAGACCTGAGTGCC
CACCTTATTCACCCCTCCTTAATTCCACGCGATCTCTCCGGGCCTCAGCTGCCTTCAGGG
TCACCATGCTAACACCCACACTGCACCACCCCGGGCACCCAGGCTGGCACGCTGCAGTCA
GGGCCTGCTTATCATGATGGTGAGGGGACCCCCGGGCCCACGGCCTTGAGGGGTCGCGGC
TTGTCCTCCCCCGGCCTCCAGGCCATCCACTTATTGGTGTCATCACCAACTGATGTAGAC
ACTCCCACCACCCCACCCCCTGCCGCCCTCACCCAGAAGCATCAGGTCAGGAACAGATGC
GGCCGAGTGGGTAGTTGAAAGTGGGGCCCTCAGCACCAAGCCCGAGGGGACCAGAGGGGG
AAGCAGGGTGGGGGCCGGCAGGAACAGCAAGGAGGCAGGGAACGGGAGCAAACAGCACGC
CTGCTCCCCCCCGAAGGCCCCTCCCGAGCCCAGCCACATAGCCCGCCTGCCGGGCCCTAC
ATCTGTAGTTCAGGCCAGCCCCCGAGGTGTCCCCTCTCCCCAGGGGTCGGGCTACCCTGC
TCCCCACCCGGCCACGCAGGGGATGAAGGGTGGATGGTGGCAGCCCTGTGTTCCTCTGGA
TTCCAGTTTTCAATGTAAAGAAGCTGAGCGGTCTCGGGCCACCTCCTTGCCGTCTCTGGG
CCCAGGTATCCCTCTCGTTGAGGGAGAGGACAATGCCCTCAGCAGGCTGTCACGGTGGTC
AGATGAGTCACACAGGCACAGGAAATGTGATTCAGCATCCTTAGGAGCCTCCACAGCGTC
AGATGTACCCCGGGGGTGAGGGGCGGGGGACGGGGATGGGCTCAAGGACTCCAGCCCAGC
CCGATACACGAACCCCCTCATCTGGGTGTCGTTTGTGAGGTCACAGGCCCAGGGTCCCGC
AGATCCCAGGCAGAAGGTGGCCCGGGCTCCTTTGCACGCCTGGGTTGTGCCCAGCTTCCC
ATCCCCCAACAGGCACCCCTCGGTCCCTCAGTCCAGAGTGACCAACCTGCCGGGGACGCT
GTCAGGTGAGTTGACCTCAGTGTTGCCAAGAGAGGCTGCTGGAATGTTCCATCCAGAGCT
GCACCCCCACGGAGCTCCCTGCCCCTCACTTGCCCAGACCTGTGCCATTATAGTTACCTG
CCTTACATTTTTGTGGGTTCTTCACACGCTGTTATGAAAAGGCACGGGGGGGGGGGTGCT
GTGCTTTGCCCTCGACATCCGTCATCGGGGGTCCGAAGGTGTGAGCGAGACAGAGAAGGG
AGTGGCGGAGGGTGGAGAGAAAGAAATGCTTGATAGGTACTTAGTACCCATAACCACTGC
TGGCCTTTCTTGAGCATGCAGCAAGTGGCCAGAGGCCAACGCTCTACATGGCTTTATGCC
ATTTAGCCATCAGGACGGTGGCAAGTGCCATTATCGTCCCCACTTTACAGACAAGGAAAT
TCCCAGGCGCCCCGAAGCTATAGTTTTAAAGACACTAGACAACCAACAAAGGGTGGTGAT
CTCGGAGAGATAGAAAACAAATGAGGGGCGCCTGGGGGGCTCCGTCGGTTAAGCTTCCGA
CTCGATTTTGGCTCAGGTCATGATGTCACTGTTTGTGAGGTCGAGCCTCCTTGGGATTCT
TTCTCTCTCTCTCCCTCTCCCCTGATCATGCTTTCTTTCTCAAAATAAATAAATATTCAC
AAAAGAAACAAGAAAAGCAAAGAAAACAAGCGTGAGGAATTCTATGATTTCCCGGTTTAC
AGCCTGGAGAGTTTCGAAATACAAGAAGAAGGATTTCAGGCAGGGCCTAGCAGCCTGCTT
GAGTGAAGCAGACAGATCTTGGTGTTCAGAGAGGTCAAGGAGACTAGAGTTCTCAAGGCA
GAGAGTTAGAAAGGAGAAAACCACAAAATAGAACTCCAAAGATGTATAGAAGGTTCCGCT
TCAGTCTTCCACTGAGTATGGATCAGTGTATGCACATGAGAGAAATGCTTGAGGCCAGAA
AATGAATAAACCAAAAGAGTAACATGAAAAAAAATTCTCAGAGGCCACACAAGGCCAAGG
ATGGTTCCTTGTAGCAACTGTCAACTGCTGCGTCCCAGATTACCACATACGTAGTGGCTT
AAAATAAAACCCATTGACAAGTTCACAGTTCTTCAAGCCTGACGTCTGACGGTGGACTAC
CTGGGTCCTCTGCTCACGGGGCCACAGGCTGATGCCGGGAGGTTGGATGGGCTGGGTTGC
TTTCTGGAGACTCAGGCTGAATCCACTTCCAAGCTCATTTGTTGTTGCCAGAATTTAGAT
CCTTGCAGTTGTTAGGATGTTTCACTGGTTAGGATTTGTCATCGTTCATTTTTTCACTGG
CTGTCAGTCCTGGCTGCTCTCCTCATCTTAGCGGCTAATTCCAGGTCTTTACCATGTGGC
CTTCTCCATCTCAAAACCCACAAGGGAGAATTTCCTTCATGTTGAATCCCTCTTGTGCAT
CAAAGTTACGTTTTCATTTTTATGTTTATTTATTTTGAGAGGACAAGAGTGAGCATGAGT
GGGGGAGGGCAGAGAGAGAGAGAGAGAGAGAGAGAGAGAATCCCAAGCAGGCTCCGTGCT
GTCAGCACAGAACCCAACTCAGGGTTCGATCTCGTGAACTGTGAGATCATGACCTGAGCC
AAAATCAAGAGTCAGATGCTTAACTGACTGAGCCACCCAGGTACCCCCTGCATCAAATTT
CTTTTGTCAGCAAGAACCTAGTCCTTTTTCAGGGCTCATCCGATTAGGCCAGACTCACCC
AGGGTAATCAGCCTTTTTTGGTATCAATTGTGCGGTATAACATCACTTGATCATGGGAGT
GACTACCCCTCCATATTCATCGTTCTTATCCATACTCAGTGAGGAGGGGATTATATAAAG
GTGTGGGTGATTAGGGGTCATCTTAGAATTCTACCTATCACATTCTTGTTCTCACCACTC
AGAGTAGAAAGCTTTGTTAATGATGATGGGGAATTGAGTTGAGTACTCAGAATGGTTTTG
CCTCAGTATCGTGACATAATTAGCCCTACATCAAAGGTTGCTCTGGTCCTAAAAAAGCTT
AAAGGAATTACTCGAGAGGATAAAAAAATGTTTCCCAGTAACTTAATCAACCTCCAAACA
AAGCTCAAGAATGTTGATAAGATCACAAATATAGGTTTTTCTGCATCCCTTGTGGCAAGC
AAGGGTCCAGTGGGAGGCGGGAGTGGGGTGGTCCACTCTGAGAGTTCGCAGCTACCTGCT
TCTTCACCAGGATCCCGATGTCACCAGATTCACCCCTGCTCCTCATTCGAGAGAAGATGG
CGAGCCAGAACATCACCATCGCTGCAGGGGTCTCTGGGGCTCTTTTCACGGAGTACTATA
TATACGTCAACTGCCAGAGACAGAGTGGCCCCAACTTAAGAACGGGCTTCAAGAACAAAG
AAAGAAACAAAAAGTTGCCAAAGAGAGAGTTGGACTTTCCCGGTCACCGGACCTTAACGA
TGCTGCAGTTGTCAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TTTTGGGGCCCCAGAGTTTTCTCTTTTTTGGGGAGAGAGAGGAAAAAATCCCTTCACACA
GGGTTTTCCCGGGTGTTCAAAAGAGTTCCCCCCACGGCCCACGAGAAAATTGTTTTTCCC
CCCCCTTTAGGAGCCCTCCCACAAGGTTTCAGATATCCCCCCCGGGGTTAAGGGGGCGGG
GGAACGGGGAATGGGCTCAAGGGGTCTCACGCCCCACCCCGAATACCCGGAACCCCCCTT
ATTTTGGGGGTTTGTTTTGGGGAGTTCACAGCCCCAGGGTTCCCCCAAGATCCCAGGGCA
GAGGGTGGCCCGGGGCTCCTTTGCACGCCTGGGTTTGTGCCCAGCTTCCCATCCCCCAAC
AGGCACCCCTCGGTCCCTCAGTCCAGAGTGACCAACCTGCCGGGGACGCTGTCAGGTGAG
TTGACCTCAGTGTTGCCAAGAGAGGCTGCTGGAATGTTCCATCCAGAGCTGCACCCCCAC
GGAGCTCCCTGCCCCTCACTTGCCCAGACCTGTGCCATTATAGTTACCTGCCTTACATTT
TTGTGGGTTCTTCACACGCTGTTATGAAAAGGCACGGGGGGGGGGGTGCTGTGCTTTGCC
CTCGACATCCGTCATCGGGGGTCCGAAGGTGTGAGCGAGACAGAGAAGGGAGTGGCGGAG
GGTGGAGAGAAAGAAATGCTTGATAGGTACTTAGTACCCATAACCACTGCTGGCCTTTCT
TGAGCATGCAGCAAGTGGCCAGAGGCCAACGCTCTACATGGCTTTATGCCATTTAGCCAT
CAGGACGGTGGCAAGTGCCATTATCGTCCCCACTTTACAGACAAGGAAATTGAGGCAGAG
AGATGAGTTAGCTGCCCGGGGTCACAAGGCCAGCATGAGTCTCGGCCAGGGGACAAGCCC
GGATGGCAGGCAGGGCTCTCGGCTCCTGGGTCTTGGCACGGGCCAAGATGGAGGGTGGGG
TCTGGGGGTCAAGGCCGAGACCGAGAGGGGCTCTGAGAATGTCCCCTTTCTGCTACACTG
TCACCCTCTCTGGGGGCCATGGGGCCTGCCTTGTGCCCCAGGCAACTGCTCAGTTAATCT
CAATCAGAGCAGGAGGCCTGTGGGGTCGGTCTGGCCCCCATCATGCCTAGGGCTCCAGCC
AGGCTCTTAGCACAGAACGCCCTATGGGCTGGGCCATCCAATTGGCTGGAGCAGGCTCAG
GTCTCAGGACTATGGAGCATTCCAGAAAACCGAGGGCCGTGGGGTAGCCCCTTAACCGTA
GCTGGCAGCCTTGGGTGCACGGATGTCCAGCCCTGGGCTCAGAACTCGACAGCACGGTCT
CATCCTTGAGAAGGACCGTGTCAGCTGGCGGGCGCTCCCATGACCCCCTAACAGATGAGG
AGATTGGGGCACTGGGACCGAACTCAGGGAGGCAGGCAGAGAGGGGCCAGGGGGGCAGAG
AGGGTGAAACCCACTCCTTGTGTGAAGGAATAATCAGGGCAGGCTGCCTAGAGGAGGCAT
TAGCCAAGCTGAGACCTGAAGGGAAGCGAGTCAGAGCGGGCAGGCGGAAAGGGTCCCCAC
GGGTCCTTGGCACCAGGGCAAGAAGTGAGTGCGTCACCGTGTTCCTCCGATGAGCCTCGA
GTAAACAGGCGGGGGCCCGGGGGACTGTGGCTGTCACTCAGGGCAGCGTCACTGCCCCTC
AGCCCTTGCGCCCCACTGTTCTCTGCTCTTCCATCCCTGGCACCGGGTACGGGGCACAGA
AGTGGCCACTGCCCAGGTCACTCAGCCCCCTGAGCCACCACCGGCCAGCCTGGCCTCCCC
AGGCTAGGAGCCGGAGGGGACAGTGCATTCTGTGTCTGGACCGTCCCACAGTGATGGCCA
CGGTGGCTGTTGGTGGACCGTCCCTCTACTTACCAAACTCCTCCTGGTTACTCCGTGCAG
GCCTGGCAGGGACGAGGGCTGCCCCATCTCCCTGAGGGGCACCAGGGTGGGACGGGGGCG
CCGCCTGGGGGCAGGAGAAAGCGGGGTCCCCTGGCTGCCTGCCTACCCTAGCGGCAGTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGCAGCTACTGTAAGTGCTATGGCAAACC
ACACAGTGTCCCAGATGCTTCTGACCAAGCTTCCGACAATTAGAGAATTGCAAGTGCTCA
GAGCTTAGCTGAAGACGATGTGGAGTGCGAGACAAAAGTCAACATCATCATCTCAATTAA
AAATACTTTTGGGACGGCTGAATGGCTCAGTCGGTTAAGTATCCAACTTTGGCTCAGGTC
ATGAGCTCACGGTCGGTGGGGCTGGAGCCCCGCACTGGGCTCTGTGCTGACAGCTCGGAG
CCTGAGCCTGCTTTGGATTCTCTGTCTCCCTCTCGCTCTGCCCCCTCCCCAGCTTGTACC
CTCTCTCTCTCAAAAATAAATGAACAATGACAAAAAAATTTTTAAATACTTTTAAAATCT
GAACTCAGAAGATGAACAGCTCTGGGGGAAGAAGGGCAAATAATTTTTACTTTGTGCAGA
TCCGTTTGTCTGTTTTATTTATTCTTCCAGTGAAAAGTATATTTTGATTGAAAGCTTTTC
ATCTTATAAATACACTATGAGTTACCAAAATATGGATTTATTACTAAAATGTGCAACTAA
AATGTACATATGACATCACATTATTTATGTTAAAAATAGTGTTCAGTTTTGAAAGATAGG
CAAAAAAAGTGTAGGAGAAAGCTGAAGAATGCACATTTTTTTAAACCAGTATAGTTTGCT
CTACATAAAAGAACTGGATGGAAACTTCTTTTTGTTTATGAAGACTGAACATTAAAATCT
TTGAGACACTGGGGCGCCTGGGTGGCTCAGTCAGTTAAGCATCCAACTTCGGCTCAGGTC
GTGATCTCACGGTTCATGAGTTCCAGCCCTGCGTCGGGCTCTGTGCTGACAGCTCAGAGC
CTGGAGCCTGCTTTGGATTCTATGTCTCCCTCTCTCTCTGTTCCCCCACTTGTGCTCTGT
CTCCCTATCTCTCTCAAAAATAAATAAAATGTAGAAAAAATTAAAAAAAAATTTTTGAGG
GATTAAAAAAATATATATATTCAGCACCCACAAGTTGAAAGCCAAAATATTTGAGATCTA
ATAAAAAAGTAGCAAGCAGGAAGATATTATTCATAATGGGGAGAAAAATCAGTCAATTGA
AAGTGACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 6242..6288, 8782..8863, 11528..11670, 24487..24531
1001..1121, 6242..6288, 8782..8863, 11528..11670, 24487..24531
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved