Felis_catus Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Felis_catus EIF4A2
Felis_catus
EIF4A2
GeneScaffold_1146
SNORA4
3159..3298
5802
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTTTAGGGTATGATTGGATTGCTCAAG
CTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCTGCAACAGTTGGAGAT
TGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGT
ATTGATAGTGTAGTTCAAAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAAC
TGTGAAGAATTTAAAACTTAGTGTAAATCGGTCCTATTAGAGCCCTCCTTTTAATTGTCC
ATGCATGCAGGGAGTTGTTGAAAGTTCAACATAGGAACTGGGTGTGCAGGTATGGTTTGC
AAGGTTGTGTAAGAGGTTTGAGAAACCAAAGTGTTCTTTTCAGGGTGGACTAGGTCTGTT
CCCATTTTGAAGTTTGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTCTTTGA
CTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCTCACTGCTATA
TTGGCTTTGAAGTAAAACCTTGCTAATAAAACTAGGCTTTATTAAGGTCAAAATGACAAA
TTCCAGTACTTGGGGAAAACTTAAGTATCCACATGTTGTCCTAGATGTAATTGCACAGAT
CATTCCACTGTTCCACTATTTACCCCTTCCTACACAATGAAGAGCAATGTAGGAAATGAT
TGAACTCAGATCTTTTAATTAACATAGCTGGTATCTGGGGCAACAAGATTCCAAGTTTGA
CAAGGCATAAGGAAGACACCTTAAGGGAATTTTATCAGGAAGCTGTTAGATCAGTCTGCA
TTTTAAGCTTGGAAGTAGTTAAGTGCTGTGCATGCATAGAAGCTATTTGCAGACCAGATA
TTTGCCATTGTGCTTTGGAATTTTAGTCACAGCCTATAGTTCTGCTGCATAATAACTAAG
GGTATTGGCTTTTAGATCCAAAAGGTAATTCTGGCCCTTGGAGACTATATGGGAGCAACT
TGTCATGCCTGCATTGGTGGAACCAATGTTCGGAATGAAATGCAAAAACTGCAGGCTGAA
GCACCACACATTGTTGTTGGTACACCAGGAAGAGTGTTTGATATGTTAAACAGAAGATAC
CTTTGTAAGTATTGTTGATTGAATATAATTTGTTTTTGCTATTACAAATTAAAGTTTGCA
ATCCTATTCTTACCGATCTAGAGCTGATAATATGTATGGCTTTGTCTTTGTCAGCTCCAA
AATGGATCAAAATGTTTGTTTTGGATGAGGCAGATGAAATGTTGAGCCGAGGGTTTAAGG
ATCAAATCTATGAGATTTTCCAAAAATTAAATACGAGTATTCAGGTGAGCTTTAATTTTA
CTCCCTCTCCTATAGTAGTTGGGACTTTGGTTAATGCAGGTTGCAGTACAATTGAAATGT
TGGTTTTTTCCCTTAAAGCAATTGGTGCAGAACTGTAACACAGTTTCATAGTGAGGCTGG
TCTGTTTTTTGAGTATTGTGAAAGTGTGTTATTTGTGCAGTAACATAAGCATGGTCTTTT
TAAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATT
CATGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAA
ACAGTTTTATATTAATGTTGAAAGAGAGGTAATGTATCTAATTACTAGACATTAAGATGT
AGCTTTTTTTTAACCTTCTTGTATAAGCACTGTGCTAAAATTACAGAACCTAAGATTGTC
TTAGTTTCTGTAGTAATGCTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAACAGATTGATACATAGCTTTAGGGCGTGTTTTCCCCGTCAAAAAAGTGTTCTAATT
TCCGTCTGTATATCTGTGCAGCCGGGACGTTGGTTCTACATGTCAATAAAGTTAAATATT
GGTTTGACTGGTGATTCTTGAATTAAGGTTTGTTAATTTGCAGCATGGTGACATGGACCA
GAAGGAAAGAGATGTTATCATGAGGGAATTTCGATCAGGGTCAAGCCGCGTTCTGATCAC
TACTGACTTGTTGGTAAGTCTCTTACGGTTCTGTTTAATCTACCAAAAGTTTGTTTTGGG
GGGAAGGTTTTTTAATAACCTTTACCAACTTGGGCTCTTTGGGAGAATAAAGAACAGACC
ACACTCCACAGTGGGCTATACCACTTAACATAGTTCACTACTATTTTGTGGCCTACATTA
CATAGCTGTGTGGGTTTTTTTTTTGGAGTTGAACATTGTATTACTGTATTTCAGGCTCGT
GGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAA
AACTATATTCACAGGTGAGTAGGTGGCATCTTGACTGCATTGGGAAAAGGAATTCATGTA
TGGCTTTTCTACTGACTGATTTATTTGAAAGGTAACTTCAAATCAGGGAAGTAAAAAGAC
TTAGTAACTTGGTAAGGTGTAACTAAAATTGTACTTGGGAAGATTGGTCATCTTACAGTG
GGAAAACAGTTGTAAATGTTGCCCAAATTGTGGATTAATACATACAAATCTGGTTGTTTA
GATCTGTTGGTCTTAGCTTATTTTTGAGTTTTTAGTGAGGTTCCTGTGTCCATGTGCTTT
CTCGATGATTCCTCTGTAGTTGGGATTTTCTTGGTGTTGTCTGGTAGCAATTTGAGCAGT
CCCTGGTTTAGTTATAGTGGCTTTATCCCTAAGTAAATTGAACTGTACTTTGTTATATGA
TGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGATAGCAGCAGTTGATGACGAGATGG
CGCTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTG
TTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTGATA
TTTTAAGTTGCTCCAGCCAAGGCATTTTGTATGTTAGTCTAGTAGGTGGTTTGTGTTGTC
TGGTTTCTATCAGGAAGGTAGAAAGCTGTTTTGGAGGTAAACACGTTTTGAGTAATTTGA
GTTACAACGTGTGAAACTGAGCAAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATA
CTTGTTTTCCCACTGGAAAAAGTTGTGAGTTTTAGGCAGTAGTTAACCTTGCAGCATTTG
TATTTACAGTTTACAGTTCCAGAGGTGCGTCGAAATGGATTACATAACTGTTCTTTTTGT
TTTATCCCTGGTGTTTACATCTGTCCCAGGCTGACATCTGCTCTTGGCTGGCCCACTTTG
GTATGGGCTTTAATTTCACTACCCCAAACACAATACTGTCATCTGCTTTAAAAGTAGTGC
TCAAGACACCTGATAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGGCACT
AACTGCAAAGGAAGATTTTTTTCTCTAGATATTGATTAGCAGCTAGTGCTCCAATTAGAA
GCACGAACTATAACCTTGTTAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCATCATG
TTCAGTAGTTCATTTGAATTTGAGAAGAAACATTCTAATTGCTGGTTTTTTTTTTTCTTA
CACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACT
GAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAA
ATGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTGAGGAGAAAG
GCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCT
GTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAGAT
GTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCA
GCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAATAGAA
AGGCCTTTAAAATTGATTTTTTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTG
TATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCC
CCAGCAAGCAATCATATCCTAGGTAGGGTTAAACCCCCAGTAATTAAAATTGCCATATTG
CACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGGTGTTTT
GGTTATTTTATTTGTGTAAGTTTTAAACATCTTACGAACATTTCAGCAATTCTGAGTTAA
CTGCTGCATCACAGTAGCACAGAGGCTGATCAGTTGTAGGTGTTCATCAGCACCATCGGC
TAAGCACTTGTCTACTTCCTACAAGAAAATTAAAGGTTAGTAAAATTTCCCTTGGAGTTC
CACATTTTGCTGAAGTGTGCAAACAGGTGCCTACTTACAGCAAGTTTTTCTGTGATGATG
GATTTCTGTTTGTCGGAAAGGTTATCGTTTTCTACAACCACATCATGAAGTTGATTTACA
AGCTGAGTGGCTGCATGGCCCTCATCTATTAAATTCTGCAACAGGAAAGTATAGCATCTG
GGGTGATTCTTTTAAGTTCTCCCTTCCCCATAGTTATGAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1066..1137, 1935..2103, 2214..2323, 2524..2667, 3043..3132, 3354..3433, 4685..4802
1001..1063, 1066..1137, 1935..2103, 2214..2323, 2524..2667, 3043..3132, 3354..3433, 4685..4802
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved