Felis_catus Locus ENSFCAG00000004021
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000004021
Felis_catus
ENSFCAG00000004021
GeneScaffold_51
SNORD42
1477..1543
5409
GATTTTGAGGATGCAAACATGACTGAAGCAAGGATGGGAGGACTACTTAAAGGGAGGGG
ACTGTAAATGAAATTATTCACAAGAATTAGCAAATCCTGGAGAAATCTGTACACTGGGTG
TTTGGAATATTGGTAGAGTTTCAAGAGTATTATTGGGAAAACACACAAAATCTGACTGTC
ACGGGTAAAGAGGGGCAGATGTGGCCACCTTCTACCTCTTCGGATACTTTCCTCTTCCCC
TCTGCCTGACTCAAACTTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTATTTTTAA
AAAATGTTTACTTATTTATTTTGAGACAGAGAGAGAGCCCGCGAGCGCGCAAACATGCGG
GCGTGGCAGAGAGAAAATCCCAAGCGGGCTCCGAACTGTCAATGTGGGGCTCCAACTCCC
CAACCGTGAGATCATGACCTGAGCCAAAATCAAGAGTCCCACGCTTAACCGGCAGACACC
TAGGCTCCCCTTGACTTTTTCTAACACCAAATCACTGTTATTGATAAACTACATCCCCTC
TCTGGACCCAAATTTCTACAGATGTTGTTTGAAGGACTTGAACCAAATTCTGCTCTAACG
TTCTAGAACTTCGCTTTACTCTCCAAATCAACCTAATTATATTCACTTCAGTTTTCAGTG
TTACTGTCTCCTGCAACTACGATCCTCTTTCCACAAGATGGAAAGCGCTCAGGACCAAAC
GCAAGCGGCAGCTGGCTGCACCATCCACCATCCACCCGCAGCAGCAAATAAACACGTGTC
TCCAAAACACTACAACTCCCAAGAAGCTATAGTGTCTTTCGAGGGAAGAGGTGGAGCATG
CTTAATCGCTCTGGGGAGGAAACTAAACCTAACTACCATTCCCGGCGGTCTCCGCGCCAT
AGATTATCCAATGAGCTTTAAATGAAAAGTATCGCGATTCTTCCGTGAGACTTGGCTCTA
TAAGCCCCTGGAAACAAGCCTCGGAAATCCCTTTCACGAAGATGGCGCCGAAGGCGAAGA
AGGAAGGTCTGTGCTGGGGCTGGGGGTACCGCAGCTAGTTGGCCTGGGATTCCCGCAGAG
TGAACAAACTGGGAGGATGGAGGCTGAGCTGGTTCTTGGGGTGTCTGCTCCGGAGCTACT
TCTAGCATTCTGCCACTCTGCGGCGCGCGTGGGCCCAGCCGCATGGGCTGAGCTCCGTGA
CAGGGTTTGGGGAGACAAGTCCGGCCGCCACCACCTGTCGGGGCTGCCAGACTGTTGGCT
TTGGGGAACTACACGCATCCATAGGCCGGAGTTTCATGTCTCCAGACCTGAGTTGTTGTC
CGCACCTAATTTTCCTTTTTTCCACGTGTTAGACGGGGCTATGAACAGTTAAAACTATTA
GAGTATATGTTGTCAAGTATCAAGCATTCGATCATTGCTAGGTGTTTTTTTTTTTTTCGT
CGTATCGCTGGAGTTATTCCAAGTTCGCCCCAGTACCGTGCATATGATGGAAAAATTGTA
ACCTCCTGAGACTTATGATGTCTTCAAAGGAACCGCTGATGCACGTGTGCCTGGGAGCGC
CCGCTAGGGGTCTTGAGGACGGAAGTGAATGGTTTCTGAATCCCGTGCCTTCATATTCTT
TATTTTAGCCCCTGCCCCTCCCAAAGCCGAAGCCAAAGCAAAGGCTTTGAAGGCCAAGAA
AGCAGTGCTGAAAGGCGTCCACAGTCATAAAAAAAAGAAGATCCGTACGTCACCTACATT
CCGACGGCCCAAGACACTGCGTCTCCGAAGACAGCCCAAATATCCTCGAAAGAGCGCCCC
CAGGAGAAACAAGTCAGTACTGCCCCTTTCCCATGAAAAGATCTTGGGTATCCTCCATTC
GTAATTTGGAAATTTACCAGACCTACAGCACGCCTTGTCAAATATCTGTTGGTACCTAGT
GTGCGTCTCTTAATAGTGTGAAGAGATTGTTAATGCCCTGTTTAAGGACAAGAGGAGGCA
TTTTGACAACATTGGCAGGCACTGTTTAAGACAACTCAGTGACTTCTGGTTATTAGGTTA
ATTATTGCTTCACATGTGGTCAGGGTTTTAAAGTCTGCTTTCTTGGAGTATATAGTAGGA
CTTTGATACATGCTTTTGTTTTGGAGTTCCCTATTACTGTAGGGGACAGTCCTTGATGGT
GACAATGTGGGATGATTCTAGGTTGATAAGGATATTTAATTATCTGTATTAATCAGAGAA
GGCCTGCAGCGGTGTATAGAAGCTTCTCATTTACTCTCAACTCGTTAAACTCAAGGAATA
GTTGGGGGGAGGGGAGGGTTGGAGTTTTTGAGTATTTGCCACACTACTGGTAATAACTGA
CCTTAAGGGCCACAGATTAAAACACCAGTAGTAATTGCCACCTCCCACTGCTTTCCTAAG
AAAAAGGCAGGAGTGGGTTCTGCCCCATTTGGACCTAGGAGTTAGTGTGAGGAGAGGTTG
AGACCTGATGTCTAGCTTTAAAACAGGAAGCAGGTCGGCGCGCCTGGGTGGCGCAGTCGG
TTAAGCGGCCGACTTCGGCTCAGGTCACGATCTTGAGGTCCGTGAGTTCGAGCCCCGCGT
CGGGCTCTGGGCTGATGGCTCAGAGCCTGGAGCCTGTTTCCGATTCTGTGTCTCCCTCTC
TCTCTGCCCCTCCTCCGTTCATGCTCTGTCTCTGTCTCAAAAATAAATAAACGTTAAAAA
AAAAAACAGGAAGCAGGTGTCCAGGTGAATGGAGACTTGTTTCTCTGAATTTCAGGGGGA
AAGCTGTGTTGTAGGTGTTTTCAAGCCACTGTAGTTTTTAACTTACGCTGTAAATAAGGG
TTGCTGTCAGTTGATGGCCCTCAAACCAGTTTTCACCAACCAGAGGGAGCAGAAATGTCT
GGCTAATCTCCTGATGAAGCACCAACATTCTTTGGAACTCTAGCTTGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTGACTA
CAGAGTCGGCCATGAAGAAAATAGAAGACAACAACACTCTTGTGTTCATTGTGGATGTCA
AGGCCAACAAGCACCAGATCAAACAGGCCGTGAAGAAACTCTATGACATTGATGTGGCCA
AGGTCAACACTCTGATCAGGTGAGCCAAGAAATCTGCATGGAGTCAGTAGGTTTCACAGC
TTGCAAGCCTTGAGAAATGAGTGATTTCTGCTGTAGTTAGTCCTTTGTATCTATACAGAC
TTTAGAGGACACATTAGTTCTCCTGCCTCTAGGACTTGATGTATGGAGTTAGTGTTCATT
TTCTTGATCCCTATACCTCTAGACAGACAGGCCCTAGAGTAAGATAAAATTTATGTCAGA
TTACTTGGAGTTAAGTTTTAAAATGTTATATGGTGTTCCATGTAAAAGGGAGTTGACTTC
ATTTGTGGCTTGGTGGCATCCCTAGCCTCCTGTGCAAATGCTGGAAAAGACTGACATGGA
CAAAGGAACCACTGATGTGCCATAAAGACTAGGGGAAGAAGGGAGGGTTTGAGGGCTGTG
AGAACAGCGGGAACTAAAGCTTCCTTCATCCTAGGCCCGATGGGGAAAAGAAAGCATATG
TTCGACTGGCTCCTGACTATGATGCTTTGGATGTTGCCAACAAAGTAAGCTTCCTTTGCT
GTTAACTCACCCCCGAAGTGCAAGTGATGTGTCCATTACTGACCAAAACCTGACTTGCTG
ATTTAGTCTTAAATGACTGCACCCCTATCCTTAATAGGCCCTTTCCTTGCCTTATTTTTG
CTTTTTAATTATGACCTTCCAGCTTAATCTTCATATTTTATCTCCCAGTAACAAAGCTCC
CCTTTTGTTTTTCAGATTGGGATCATCTAAACTGAGTCCAGCTGGCTAAATCTAAATATA
AATTTTTTCAACATATATGTTTCTCTGTCGATTTCTGGTTGGGCTTCAGGAAGGCCATAC
TGTGGTGTATACACACCACAGTAACAAGGCTTGGGCAAGACTCTTGGTCTACTTACCCTG
TTGGAACACTCTGCTTTAGTACCTCACCACACTTGTTAACATTTTAGCAACAGGAACTCA
AATATTTGTGGCCCAGATTAGGGTTGGTTGTCTGTCCTAGGACAACTACCATTTGCCACC
ATCATAGTGGTAGGAGAAAAAACAAGAACCCCTCCCTCTATCCCTGGAAGAGGCTTTGTA
TGAAACCAGTACACAATACACAATTCTCATTAGCATCCACTTCAGGGCAGTGTGGGATGG
CTGCCTTTCATAGCACCTTGTCCCTGCACCCAACCAGCATGTCCAACCGGTCTGTCTGCT
TTCCTCACCCCTTGCCCAAGAAAGGACAAGGACTTCTGGAGGAGTGCTTTCATTAGCATT
TTCAATAGTAGGTGCAGACTTGAAAGGTGGAGAGGTTATCCCCAGGATGCCCCAGGCTTG
GGGCTAATTCTTTCATATATGTGTGAGGCTCTGTTCTTGGCTGTGTTTGCTCTTGCCACA
AGTTGTAGGCTTTGTGCCTCTCACTCAGTCAAAAACTTGTCTTTGTGTTGCTGGCTGGGG
ACACGCTGAGGGCAGAAGTCTGAGCGGAGGAGACGGGAAAAGTAGATGAGGATCATGATG
TCCAGCATGAGCAGGATACCCAGCAGAAAAGTGCCCAGAGTCCTCTGGCCCAAATAACGC
AAGAAGTAGTGCGTGAGGTAGGCCTGAGGGGCCAGGCGGAAGAGAAAGTACATGACCAAA
TTGACATATTTGTTGACCCGGTAGAGGAGAAGGTGCTGGGCATTGTTGATCTTCATCATC
ATGCGGAAGGTGAGGAATATGTTGCTGACCTCCACCAGCAATGTTAGGACTCCCCCACCG
ACAAAACTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1628..1809, 3530..3678, 4114..4183, 4395..4409
1001..1025, 1628..1809, 3530..3678, 4114..4183, 4395..4406
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved