Felis_catus Locus NOL12
snOPY snoRNA Orthological Gene Database
Felis_catus NOL12
Felis_catus
NOL12
GeneScaffold_602
SNORA21
4127..4255
6604
CTGTGACCCGGCACTGTGACCCTGCCAGACTGGCCAGTCTTTAAAAGCAAGGGTAGCAG
CTTGTCTGCGGCACCCAGCACAGATGAACTGAGATAGGGGATTCAGGCACACAATCCTAG
TTACTAAAATGCTCCTGCAGGTGGTGTTCTACTGAATGCCTTCACATGCGTGCCCTCATT
TTCAGGAGAGGATGTGCTGTTACACCCCCATGGCACGCTCTGGGAAACTGACACACAGAC
GGGGGAGACGGCTTGTGTCGCAAACACGTGCGAGGCATGTCTTACTTACACGCACTGTGA
CATAACTCACCTTGCCTCAGAATCGTGGTTCTCAAAGTGTGGTCCGTGGACCAGCAACCC
CTGAGAACATGTTAGCAATGCAGATTATGGGGCTCATTCTAGACCGGCTGAATCAGGAAC
TCAAAGCAGGTGCAAAGCCATTTGTGTTTCAGCAAGTCCTCTGGGGGATTCTGACGCAAG
CCAACGTTGGAAAACCACTGCCTTGCAATAACCCTACAAAGTCACTATAATTATCCCTAT
TTTATAAATAGGCCAACCGGGGCAAAGCAAAGGCAATTGGTCCAGAACCACAGCTGTGCG
TGGACTACCAGGGTTCTAATCCAGATAGTTTGGCCCCAGAAGTGTGCTCTTGGGAGACCA
CCAACGAGTTGACATGAGAATCGAAAGTAGGATCAGAAATATTTGGCCCGTTTACTAATA
TCTCCGTACTGAGCACCTACTGCACGCCAGCCACCGTGCTAGGCCCTGGAACCTCGCTTT
CACTGTTGCTAGTCTATGAGACGGATTGGGGTTAGGAATCACGGAGGGGGAACACCCAAA
ACGCAGGACTGGGGAGGCCGGCCCCGCGGCCCCTTTAAAAGGCGGGGCCTGAGGAACGGA
ACGACGGAGCCTAAGAGCGCGGCGCGCCCGAGAGGGTAAAAACGGTACACCCGGAAGTGT
TTTAGGCGTGCGGGCGGCGCGCTGCCGGGGGCCTCACCGCTATGGGCCGCAAAAAAGAAG
AAGAAGCGAGATGGCGACGATCGGAGGCCGAGGCTCGTTCTCAGCTTCGACGAAGAAAAG
CGGCGGTGAGTGCCAAGCCTGGAGCGGATCTCCTTCGGGCTGCCGGCCAAGGCCACGGCC
TGGCCCGGGCGACTTCCACTCCCGCAGAGGTCCCTTCCGGCCCCTCCCTCTTGGCGTGGC
CCGTTGCCCCCCCCCCCCTTCGACACCAACCCCCACTGCGGAATGGAAGCGGCCGCTGCC
GGCCCCCAGCGTGGGGAATGGAACCGCCCGCCCCGCCCTCTCGTTGCTCACTTTGCACCT
TGCTCCTGCTGTGTGCGCTTCGGCTGGGAGCTGGGAGCTGGCGGCTCGTAGCGGTGGCTT
CGATCTCCCTAGCCCAGCCCAGCCGCCCCGCACGCGGTAGACTCAGCTGTTGGTGATGAG
TGATGAATGAATGAGATGAGAGTGGCTCAAGTTCACGTATTCACTCGTCAAGACGTGTGC
TGAGCTCCTTCGGTGTGTGTGCCAGCCAGATCGCAGGACCTCTGAGTTGGACCCCTGAGC
CTCAGCGTCCAGTCCGTCAGATGCTATCCATTCAGAGTGCCACTTTTGCATATGGTAGCG
GGTCAGCGAAAAACCTAGTGTTGGGCCCCGGAACGTTTGGGGATGGTGCAGCCAGCACTA
GAGAGATGACAAGGAGCCAAGATCAGATAGGAGAGGGGAATGCTGGAGCATCGTCAGGAT
ACACAGGGTGACGTCAACAGGCCCTACGGTTGGGTCCAGGGGGCAGGTGTCCTGGGCAAA
TGTGCCAGTCAGGTGGAAAGTTTGCAGATGTCTGGATGAGGATGGCCTTAAAAGTGGCCT
TGCTAAGGGGGCGCCTGGGTGGCTCAGTCGGTTAAGTGTCCGACTTCAGCTCACGGTTCG
TGAGTTTGAGCCCCACGTCAGGCTCTGGGCCGACAGCTCGAGCCTGAAGCCTGCTTCGGA
TTCTGTGTCTCCCTCTTTCTCTGCCCTTCCCCCATTCACACTCTGTCTCTCTCAAAAATG
AATAAACGTTAAAAAAAAAAAATTAAAAGTGACCTTGCTAGAAATGGCTTAATCCCCTGG
GTAGTGGAATTTGGCAATGTAGAAGGGCCCCCACTGGCCCTGTTGCTTGAAGTCGAGAGC
CTTGGAGGGTGGTGGGTGGAAACAGGCAGCATCTCCCTCTTCTTCCTAAACTTACACTCT
CTATGACCTTTTGCAAGTGACCTAGCCTCTCTGTGCCTCAGTGTCCCCATCTGTAAACTG
GGAATTGGTGCCTGCTTACAAGTTGTGAGGAATACGTGAGTTAAACCGGTGTTAATTTTC
GGAGCAGTACAGAGGTAGTGGTTTTTCTCTCCCTGGAGTGAGCCTGCCTTTCCTCGTGTC
CCCTCCTGACTCTCCCTTGCCTCTTTCCTGTAGGGAGTACCTGACCGGCTTCCATAAGCG
GAAGGTAGAGCGGAAGAAGGCAGCCATTGAGGAGATCAAGCATCGGCTCAGGGAGGAGCA
GAAGAAACTCCGGGAGGAGGTACAGGGGGAGGAAGGGGACTAGGGAGACAGAGAGAGTGT
GTGTGTGTGTGTATGTATGTGTATATATATCTATCTGAATATATGTATGTATCTGAATGT
ATATATATTTGAATATATGTGTATCTGAATATATGTGTATCTGAATATATATCTATATCT
ATATCTATCTATCTATCTATCTATCTCTCTATATATAGATAGATAGATAGATATAGATAT
ATATATCTGACTCCCAAGGGATTTACAGCCTTGGTTAGCCTTAATAGGGGTATCTGCAGG
AATGAGGGGAGGTGTGGGCAGGCCTGGGGAGCAGTTTGTACAGGTAGAATCACGGTGGGC
CCAGGTCTGGGGAAGGTTTAGGATGGAATCTCCTAGCGTTTCATCCCGAGCCACACATGG
TCTCACTCACCCTGGAGGTGAGCAGTGCTCTTGCCTGGGGTTGGCCGGAGAGGCCATACT
CACTGTGTTCCCTTCCCTTTTGGCTTTAGCGCCATCAGGAGTACTTGAAGCTGCTGGCAG
AGAGAGAGGAGGCTCTGGGTAAGTCCCAGCTTTTGCCCGGACCTGGAGAACAGCTAACAG
GCCTAGGCTTTTTTTTTTTTTTTTTTTTTTTTTAATCCCTTGGTGGGTGAAAGGGGAGAG
GTGTGGGGGCTGCACAGAAGCCAACTGCCCTAGCTCTAGGCGTCTTGGTGGTGACCTGGG
GGTCATGGGTGGTGTTCAGGGACGTCTAAACGTGAGTGGATCAGAGACGAGGAGGACAGA
TGTCTTGGGAAAGCGATTCCTTAGCAGAAAGCCCAGTTTCTGAGGCCTGGAGGGACTAGG
GGTAGAGGGGATGGGCAGCAGCAGCTGCTGGGGTCACATCGGGTTTGTCCTAGATGAGAA
CCAGATGGTCTGAGGTCCCCCTGGAGCATCAAGGGAGGAGTTGAATCACTTACGTTTGTC
CACAGGCCAGGCTCTGGAGCCGGTGACTTCCCTGGACACTCCCCCATAGAGTAGCGGGGG
CAGCTGCGCTCCAGGGCTGGGAGGGGGGTTAGAATCTGGTCACTTGTGCTATGAGGCTGC
GACCCGCTTCTTTGCCCACCTTGCGCAGAGGAGGCAGACGAACTGGACAGGTTGGTGACA
GCAAAGACAGAGTCGGTGCAGTATGACCATCCCAACCACACGGTCACCGTGACCACCATC
AGCGACCTGGACCTCTCGGGGGCCCGCCTGCTTGGACTGCCCACACCCGAGGTGGGTGTA
ACTTCCGGCCCCAGGAGGGAAGGGGCCCAGGTGCAGACTGGCTTGTCGGGGTTGCTAAGT
GCTGGCCCATGTCCTGGGGATGGCGATGATGCCGGGGGCTCTCTCCCTGCCGGGCGCTCG
TTAGAGCCCGGACCAAATCCCTGACCCTGGGGCTTCCAGAAGCCAGTTCCATGCCTGAGC
GGCTGTGGGGGCGTGGGCAGGTGTCTGCCTTGCCAGCTTTCCTTTCTGCCCCAGTAAGGG
GGGGGGGTCACTGGTGATAGCAGTCACACGGAAGTTGTCAGGCTTTGAGCTGAGAGGTGT
TAGCAGGTTGCAATCAACAGTAAAAAAAAAAAAAAGGATCCCCCCCCCCCCTTTTAAAAG
CACTCAGCGCGCCTTGACTAATGACCCACCGAGCCGTCACTAAAGGGCGGACTGAAAACG
CTGCTTTTGGACGAAGCGGCAGCGTGTCATGTTCCGCTTCCGTTGGTGTCACAAGCTGTT
CGCCTCGGGGCCGGGGGCACCGACTGCTGGGGGTGTGGGTGAAGGGAGAGGCTTGGGAAG
TGACAAGGAAATGCTACGCGGGCGAACTGGCCTCAGCTCTCGACAAATAAATACAAGTGA
ACACTTAAAGAAAAGGAAAGAGAGCAGAACGTCATTGAAAACATCAAAAAGCCTCCCAGT
TAAGTGTCATCTGAAACGTTTGTTTCCGGCTGAAGTTGTGTCTGCCTGGCCGTGTGGGCC
TTTCACGGAAATACCTGTACGTACACGGTTACGAGGCAAACCACACTTCCTGTCACGGGT
TCACGTGTCCTTAAGTCCTGAGCTGCTGCCTTGTCACGCCCTTAGTGGTCTCGCCCTCAC
CTTCTGTTTTGTGCTCATTCTTCCGCACGGTCCTCCCGGCCTCCGCTTACGGTGGACGGT
CAGACGTTCACAGGTGAGAGAACTCGAAAACTGGGGGAGAGGCTCTGAAACACAGCTCTT
CCCCGTGTGGTCCCCGCTTTGGGGGCACACGTGGCTTTTCCACCCGCAGCCTTCTCCGAG
CCCCCAAGCCAGGCCTCGAAGCGGCAGGCCATGCCCTCACGTGACATAGCCGTGACTGCT
CGGGGTCAGGCTTCCCGACCTGCCACTCTGTGTGACAGTCCTTGTCCTGTGCTTCTTTAG
CAAGCGGCCGGGCACGGGTCCGAGGAAGAGGCGTCATCCACGGAGAAGCTGACCAGAGCC
TTACCCAGGAAGTCCAGAGATCCCCTCCTGTCCCAGCGGTGAGCCCTGGCCTGTCCTCCC
CTATGACGCTGCTCCCTCATGGCTGACAGTGGTGGCCGGGCCTGTGGAGTCGCCTCTCGC
TGGCCTGTGGCGGGTGGCACGGGGCAGGTGTGGAGCCTGGAGCAGCCGCTCTGCTTTGCC
TGTTGAGGAGTCCCTCCCTCCTTACTGTCCCCCACCTCCACTCCTTGAGAATGGCCAGCC
CTGGGTGCCTTCGGTGCCTGGGGTAAAGGCCTTTTCATGAGCTGAGGAGCTGGCAGGGCC
TCTGGGGTCAGAGCCGGCTGCCTTTGGCATGGATGTGGTTCTCCCGGCACTCAAGGCCTG
TTCCGACATCCTCCGTGAGCCGGGCAATCAGTCACCCCGCCACCCAGCCTCCCACCCATG
CCTTGTTCCCAGCCTCACCAGCCTTGCACCCTCCTACAGGATCTCCGCTCTCACGGCTTC
GCTGCATGCACACAGTCGCAAAAAGGGCAAGAGGAAACATCCCCGACGGGCCCAAGACTC
CACCAAGAAGCCCCCGAGTGCCACCCGTACGAGCAAGACCCAGCGCCGCCGGCTGACGGG
CAAAGCCCGGCACAGCGGAGAGTGAGCCCCGAGAACCAGGCCACGCTCCAGCCTGGGCTG
TCAGGGGCCGTCCTGTCTCCGCTCGGCGGTCCCAGGAACCCAGCACTGCGGGGGTGACTC
TGCGGCCCCGGCTTGGGAGGCAGTTCCTCTGTGGCCCAGAGCTTGGACGCTGGAAGGGGG
CAGGCAGCTGAGAGCTGGCTTCCCTCAGGAGGAGACTTCAGAGCCAAGTCGGGGGCATCT
GCCTTAGTGGGAAGGCTTCCCACTGAGCCATCCTCGGATTTGTGAAGCTAAGTGCCCCTG
TGATCTGTTTGTCCCTGACCCTGGTGCCACGTGCCCAGGGCAGGCTTCTGAGGGGGTGGA
ACCTGTCGGGGAAGTGGGTCTGTCCTCACCCTCCAGCAGTCTTCCCCGTGGGGGTGAAAA
GGTCGCGTTGGGTCTGGGCCCCCTCACCCGGGCTCCAGGCCAGCATAACCACTGCTAGGG
TCCGGAGTCCTGCTGCTCTGCGAAGCGGGCCGCCGAGGCAGGTGGCTGAGCGTTGCCAAC
CTCTGCCCGTTACCGGCTGAGGCTGTGGGTCTGTCCCTTCTCCGTGGCCTCCTTGGTCCC
CTCAGCTGAAATCGAAGTGCTGGAAGCAGATGAGTTCCAGAGCATTCCCCAGCCCCAAAC
TTGGGCATCCTCCCCAGGCTTCCAGCAGCTCGCGGAGAGACACCGATCGAGGCGTGATTA
ACCCCTTTTAAAGAGTGTGTGTCTCGACTCACTTGAAAGCGTGGCGGTTCCCAGGCAGAC
CCCTCAGGAGGCCAGCGGGTGTTCTGCAAGGCTGCCGGGTTTTCACGCCCCCTGTCCCTT
CCTTGTCTCCGCTTGTGAGTGAGCCGCCTGACCCCCCATCCCCTGACCGAGCAGGGTGGA
ATCCTGCCTGCAGCAGGTAGATAGATGTACGGTGAGGACCGCCGGAGCACCTGTCGAGGA
ACCCCGTGAGCCGCCACCACCCTCTGCCGCTCGCTGGCTCCTGGGATTCTGGCCCAGAGC
ACAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1016..1084, 2433..2538, 3029..3077, 3628..3770, 4920..5017, 5439..5604
1001..1014, 1016..1084, 2433..2538, 3029..3077, 3628..3770, 4920..5017, 5439..5601
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved