Felis_catus Locus RPLP2
snOPY snoRNA Orthological Gene Database
Felis_catus RPLP2
Felis_catus
RPLP2
GeneScaffold_3589
SNORA52
1082..1215
3292
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTGCTCGGGAAATGCCGGGAGTGGTCCGGTTCCCGCTAGCGACAG
GCTTAGATTAGAGAACGCACGTGCGGGCCATAAGGGTTGGGCTGGACAGGACAGGGCTCG
AGGCTCGGGGGCGTTTTCTCTGTGCAACTTGGTTCCAGGAGGTGAAGTTAGGGTGTGGGG
CGCAGTAGTGAGCCTCTGGTAACTGCTGGTTGTGGTTCTAGGTCATCAGTGAGCTGAACG
GAAAAAACATCGAAGACGTCATTGCCCAGGGTGAGATTGTGTGCTGGGGGGTTTCGTTCT
CGTGGTCCATCCTAATCCCTGCCGGTCAGCCTGTGGCCTGCCAGGTTTCGCTTGTGGACC
AGAGCACTCGAGAAGCCTCACCCAGAGAAGTGAGCAGGCTTCAGTGGGCTTGTGCCGGGG
ATGCTTCTAGACATTCTTCGTGGGAGGGCAGCAGAGGGTGCTGGTGCTGTCACCCGGCCG
GCTGCCCACCCCACCTGCAGGGTTCGGAACTGGGTATTATTTCCATCTTTAAATATATTT
TTTAATGTTTGCTTATTTTTTAAGAGAACGTGTGCGGGAGAGGGAGAGGGAGACAGAGGA
TCTGTGCGCTGTCGGCACAGAGCCCGATGTGTCACGAACTGTAAAATCATGACCTGAGCC
GAAGCCGGATTAACTGACTAAGCCACCCAGACAGCCGGGAATTAGGGTTTTATGAACAGA
TCTCACCATGTGTTCTCGGGGGGTTGGGAGCACCGACTGGGTGTGGGAGAGACCACAGGT
CCCTGCCCCTCTTTGCCGGGCAGATGGTTTTCTGGTGGCATGAGGGTGCAGCTGATGGAA
TTGTTTGCAAGTGGTGCTGTTGGGACGGTGGTTCTATCCCTGTGTGTGTACTTCATGGGG
CACAGCCAGCTCGGCAAACAGCTGGGGATGAGGATCTGGACCCAGCTAGCTGACTTAGTC
CTGTCCCGGATGTAAATGCATTTGTCCAGCTTCCTTTGGGGTGGGTGCGGTCACCCAGGG
GTGTTTTTGGGGGGGGGGCAGGGAGGGATTCCTAGACAGTTTCCAGACAGGACATTGGAG
GGGGCTGGGGTGCGTGTATGTGGCAGAGGCAGAGCCGCCTGTGTGGGAGGACAGAGAAGC
TTGTGACGCTGGCACTTGGTGATGTGTCCCTATATCGGGCAGACCGTCTTGTCCACCCCC
AAGGGGCCTTCAGGCGAGCACCTGCTCTGATCTCCTCTCCCCTGACTTCCATAGGTATTG
GCAAGCTGGCCAGTGTGCCTGCTGGTGGGGCGGTGGCCGTCTCTGCTGCCCCAGGATCTG
CAGCTCCCGCTGCTGGTTCCACCCCAGCTGCAGGTAAGTGGAGGCTGGGGCAGGGTCTCT
GCTGGGAATCTGGCATGCGCTGTGGGCCTTGCTCACTGTGCCCTTCCTCCCCACAGCAGA
GGAGAAGAAAGACGAGAAGAAGGAAGAATCAGAGGAGTCGGATGATGACATGGGATTTGG
CTTGTTTGATTAGAGTCCTGCTCTCCTGCAAATAAAACCCTTTTTACGTATTTTTTGAGC
CACCTGTGAGTGTTTTGTAAGAGTGCGGCCTTGGCACAGGGCAGGTGTGGGGGAAGAGGG
GGTCCCACCGTGAGTGGTCAGGCCTTCATTCCAGGAGAAACCCAAGCCCTTCCTGGTGAC
GTGAGGAACTGGGGATCTGGTGCAGAGATGGGTACCTGGGATGGGGGGGGCACCTCCTAT
GGATCTAGGGTGCGCCAATCCTTGAGTAGGCTCTGGAGGGGACGTAAGCCTTCTTGGGCA
CAGTCCTGACTCCTGAGGACTGCCGGGGCCTCCCCAGGAACTGAAGCTTTCAGGAGACAC
ACAGGAACACTTCAAAGGCAGTGGGTGGTCTGCAGTGCTCTCAGGAGGCTCTGGCTGGTG
GAGGCCAGCAGTTGTCCCAAGACTGGTAGCATTTTTCAGTTACACACGAGAAAGAGGTGT
GGTGGTGCGTGTGCGATCTGTAGGTTTTCCTGTGGAGTCTCGGCTCCAGTTCATGTTCAA
GCTCCACTTTTATTTATTTATTTATTTATTTTCAACGTTTATTTTTATTTTTGGGACAGA
GAGAGACAGAGCATGAACGGGGGAGGGGCAGAGAGAGAGGGAGACACAGAATCAGAAACA
GGCTCCAGGCTCCGAGCCATCGGCCCAGAGCCTGACGCGGGGCTCGAACTCACGGACCGC
GAGATCGTGACCTGGCTGAAGTCGGACACTTAACCGACTGCGCCACCCAGGCGCCCCTCA
AGCTCCACTTTTAATCTCAGCAACTCGGGGCAGTCACGTTCCTGCTCTGAGGCTTGGTTA
CCACAGCTATCTGACCGTCTGGCCAGATGAGGAAGGGGCTCGTAGTCAGTGATGTTGGGC
CATGTGCCCCCTAAGTCCAGGGGCAGGCCTGCCCGTGCCCATCCAGCCACCATCCTGGCC
CTGCAATGGTTTATAGTCTTCTGGGCCTCAGGTCCTCTGCCCACCAATGCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 2034..2132, 2216..2292
1001..1049, 2034..2132, 2216..2289
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved