Felis_catus Locus HSPA9
snOPY snoRNA Orthological Gene Database
Felis_catus HSPA9
Felis_catus
HSPA9
GeneScaffold_1707
SNORD63
13304..13378
19141
TTCCTGGAAACCAGCAGGTTTGAGACGGGATTGAGGAGCTTCAGTGAGGCCTAGCACAG
CAGAGGCGGCGAGGGGAGGGCGGGACGGGGGCGCAGGCAAAGAACCTAAGATCAAGTATT
TTTTTATTTTGAGGGTCTGAACGATAATTAGCTCAATTCAACCCAATTCTCTGAACGAAA
GGCTGCGTTAGTAGCTCAAAACCAGAGATCCCCGTGGTAAACGGCATGAATTTGAGATCT
GCACATCCAGGTGTAGTTCAAATGACGGCCAACAGGTAACCAAAAGACGAACAACAGACG
GAGCAGACCAACAAATCTGCTCTGAGCCACAGATTTTCAACGAACAAACGCCCAGGATAA
GATGGCGCCGTTACTCAAAAAATTAGAGTGCGGAAAATGACCACCCTAGCGGATGGTGCA
CGCGCCCGCGCTCGCCCCGGGATACAATCTGAGCCGAACTCACGTGCGCTGAAGCATCCA
ATGAGTGCTGTAGTACCTCGGTTTCCACCACGCCCTGCGCACATGCGCCTTAGACGTGCG
GCAGGATGCTAGCTGCGCAGGCGCAGCAGGCTCCTCCTCTCACGCAACTGACGCAAGGCT
TCTGTAATCGGTTCGCAATTTATCCGTGTGACCTTGAGTCTTTCCTGTTTTCGAGGACCG
GGGCTGCCCAAAGTGCTGCCTTTAAACCTCTCTTAGCCCTCTCGCCACTTACTGAGCCCA
GACCTGCTGCAGGCGGAACGAAAGGTCATGCTTTTTCCAACCATCATGCTGCGATGCGTA
TTAGCCATGTGCTCTAACTCAGGGAGCAGGGGTCCCATACTCTCTGGTCAGGCAACCCGG
GCGACGCTTCAGCGGAAGAGTGGTCCTCCAGGCGTCAGCAACTAGCCCCCACCCCCCACC
CCACGTGGTTGGAGGTTTCCAGAAGCGCTACCACTACTGCGCCGCGCTGCTCCGGCCGTC
CGGGCGCATTTGCTGCTTCGTACTTCCACCATCTAGCCGCCATGATAAGTGCCAGCCGGG
CCGCAGCAGCTCGTCTCGTCGGCGCCGCGGTCTCCCGGGGCCCCACAGCCGCCCGCCCCA
AGGTGAGGGACTGCTGGGCCTCCTCCGGGGGGGGCTCACGGCCTTGACCTGCTACGGCAG
GCCTAGCCGTTCGGGGACAGAATTGTGCAGCAGAGATCAGGATGGGGAGAAGGTAACTGG
CCTTGAGTAATCTCTGTTACGGATCCAGGGCCTAACTCAGGGTTTTCTCTTTCCATGTCT
CGGGCTCTGCTGAGTCACACCTCTTGTGAGAGAATAGGTTTATTCTAGGAAGTAACGGGT
AGTGGTCCTGACGGCCCGTTCACTTGCTGATTGGACGGGTTTGGCCTTTGGGGCGAGGGA
CGCAATTTTAGTTGGGAGGGAACCGATATTTTAGCCATTACTTACATATACAAGTCGAAG
GACGAGTGTTCGCCTCCTCTAAAATGCAGCGTGTGCAAGGACCCCGTTATCATGAAAAGG
AGGATGAAAAGCCTCAGTAAATCAGAAGTTAGGTGCAGATTTTCTTGCTTAGGAACATTT
GTATGTAGTTCTCTAAGAGTCTTTGGCGTACGGTTGGTTGTACTATTTGTTATTTCCACG
TACCAACAATGGAGTGGTTGCTCATTATCCAAACATACCTTTGGAGAGCGGGAACTGTGT
CTCTGCACTCAGCATGGGGTTAAAAAGAAGATTTGGAAGTATCCTGAGATTAGATTTTAT
CCTGGTTGAAGGCAACTTCTGAATTTTTTTCTCTAAACTGACTGTCCAAGATTGCCAGTC
CTAGTCCCCTTAAATCATTTGCTTGGCAAACTCTGGAAATGTTTCTGAATGATTTAAATC
TGGAGCTACAATACACACCTACGTGGGGCTTTGGTACCCGTACACTGCTGCTGACAGTGA
TATTAAGAAATATCTGAACAGTGTTTTGTACTGGTGATTCTCAACCAGGAACAGTTTTGC
CTCCTGAGGGTATATTTGGTAATATCTGGAGATAATTTGTTACACCTTGGGGAACCTCCT
GGCTTCTAGCAGGGGAGGCACAGGACGCTGCTAAAAGTCCTACAGTAAACAGAACAGTGC
CCCACAACAGATTTGGTTCAGAAATCCATAGGGCCAAGGTTGAGGAACCCTGTTACAATG
TAACTCAAGACAATTTTATGTGTACTTTTTTCTCCTGGGTCCTTTGGAAATTTCATACTT
GATTAAATTTGTTTGGTGTTTAAGTGGCGCAGTATCTCTTATACGTAAGATCTTGTTTTA
CATTTGTTTTACATATACCGTTACCAGAATGAAACTTCGTATTCTTCAGAAGAATAATGG
GAACAGGCTCTGGTTTTCATGTTGGTTGATTTTTTTTTTTTTTTTAGGATGGCTGGAATG
GCCTTAGTCATGAGGCTTTTAGAATTGTTTCAAGGCGGGACTATGCGTAAGTCTAACTTC
ATTTTTCTGTAAGAGATAATAAATGTTAAACCCTACAGTGATGGTCTCTAAATTTGTGAC
TAACTCTTACACTGAGAAAAAAGTGATGTTTCTGCTTTAATTTATAGATTCTGTAGTGTG
CCGTGCTTGCTTCGGCAGCACATACACTAAAATTGGAACGATTCTGTAGTATGCCATTAT
TCCCACAATATCCAGTATTATTTATTTTTGAAACCATTCTGGAAACCACTATTATGGTAA
AAATAACCATAGCATTATTTTATATGTGTTGCAGATCAGAAGCAATCAAGGGAGCAGTTG
TTGGTATTGATTTGGGCACTACCAACTCTTGTGTGGCAGTTATGGAAGGTAAACAAGCAA
AGGTGAGCACTATTGGAAGTTCTGGATCATATATTAGTAGTCATTAGTCTATCTGGCTTT
CTCTGCCCTGTGGCTTAGATAAGGGGTATTTTAAAAGCTGCATTTAAGTTCTTAAGATTG
TTTTGAGGTGAACTTTTATGCTTACTTGCAATGTGCTGTAAAGTGAATGGATTTGACTTA
TCAGGATTTAGATGTGTCCTAGTATAAAGACTATTAAGTTACTATTAGCACCAATTGGTA
TGACTTGCGTTGTTGATTATTTCTGTAATCAGAGTCCTACATTTCTGTAAGTCAGTTGAA
CCATGGTTAGAGGTACAGGAAGAGTCTAGAAGCAAGTGAAGCTCCACATAACACATAGGC
TGCATCTTAGAAGCTCTTGCTATGGTAGAGGTTGTTCCCCTGAAGGACCTCCTTAGTTCA
CAAAACAGTTTATGCCCACTGGGTTCTTCGCAAGATTTAGAGTTGGGATTTCTGAATGGT
TTCTTGGCAGTTTCTTTTACCTATGCATGAAACTTGTAACCAGCACAAAAAAATTTAGAA
GTAGATTTAATTCCCGCATATGGAAAGAAGGATGATCTGTTTTCAATATTTAGTATGAAA
GGTGTGATTTATATTATCTTTCCATTTTTTTGTTTTTAGTTGTAACTTGTTTCAAAGTGA
AGGACTAAAAATACTTTAAACATCTACATCTGTCTCCAGTAGTAGGTACTTGCTATATCA
GCATTCACAGAGCAGAAAAGCATGGTTATTAGTGCTGTACTTGAACGTTTGTTTTGTGAT
TTGGCAGCAGTTTTGTGTCTTTAAATGATTGATTAAAAAAAAAAAAGGTGATGGTGACTA
GAACCTCATTCTTTGTCTTACTTTGGGAGTTTTAGGTGCTAGAGAATGCTGAAGGTGCCA
GAACCACCCCTTCAGTTGTGGCCTTTACAGCAGATGGTGAGCGACTTGTTGGCATGCCAG
CCAAGCGACAGGCTGTCACTAACCCAAACAACACATTCTATGCCACCAAGCGTCTCATTG
GCCGGCGATATGATGACCCTGAAGTACAGAAAGACATGTAAGTAATAGGAAAAGCATAGT
TATTTCCTTCCAGAGGCCACACATAGGAATGGTTTCAGCAAAATCCTTGGAGCATCTGAC
CTTAGTAATTGTACATATTGTCCCTAGAGGCATGTCCTGCCCTACTGAAAGGATACCTCC
TTCAAAAACATTAGCTTCTGCTTTCACATATTAGGTCTTTTCCATGTATTGATGTGACAC
GAAGATTTGGCTAGTCATTTTTGGACCATGTAAATTGGTGTTAAATTCATAAGGCCACAT
CATGTGCCAATCAGCTGTTTTCAGAGTCTTTCTGTGCTAAGACACCTATCCCTGCTTTAT
TCCTTTTCATGGCCATCAACTTGTATGAACATACAATTGATCCTTGAACAACACAGGAGA
TAGTGGTGCCAACCTTTTATACAGTTGAACATCTGTGTATAACTTCTGACTTCCCAGAAA
CTTAGCGACTAAAAGCCTACTGTTGACCAGAGCCTTACTGATGACATAAGGAGTTAATTA
ACACTCATTTTGTGTGCTGTGTATGTTATATATCATATTACAACAAAGTATATTAGAGAA
AAATCATAAGGAAGAGGAAATATGTTTATAATACTTTATATAGATTCAAAAATATCCACA
TATAAGTGGACTGGTGGAGTTAGAACCTCTGTTAAGGGTCAGTTGTATACAGCATTTTGT
TTGTCAGTTAATGAGCATTTGAGGGCTATTAAGAATACTACCATAGGGGTACCCAGCTGA
CTCAGAAGAGCATGCAACTCTTGATCTTGGGATTGTGGGTTCAAGCTCTATCTTGGGTGT
GGAGATTACTGAAAAGAATAAATAAACTTAAAGAATACTGTTATAAATTCATGTACAGGT
TTTTGTAAGGATGTGTTTTCATTTCTTTTTTTCTTGGTAGATTCCTAGTAATGGACTTGC
TGGGTCATTGGTAACTCTTAATAATTTCCAAAGCAGGGGCACAAATCTTTAGTTTGGTGG
AAAGAATCTTCAGGTGTAACCAGGATGTTTTTAGATGTTAATGATTGCTTTCTAAACGTT
TTCATTAAATGGATTTCTTAAGTCGTCATTTTTTGGCCATGGATCTCTTGGGATGAAAGA
TGGACATTCGTGGTATATGGTAGCCTTGTCATGGTAGGTTGCACTGGCACATTTTTATCA
AATAAAATTTTTGTGTCTTTCAGTAAAAATGTGCCCTTTAAAATTGTCCGTGCCTCCAAT
GGAGATGCCTGGGTCGAAGCTCACGGAAAACTCTATTCTCCAAGTCAGATTGGAGCATTT
GTGTTGATGAAAATGAAAGAGACTGCAGGTGAGAAGGTTTGGTTCCTATCTGTCAAGTTT
GAAGAACTGGATGGTTCCTAACTTACATACTCCAATGTCCCTTGTGTGAGTCTGGGGTGA
ATATTATGCAGAAAACCTAGGATTGGCAAAACTTTGTTACTCTTCACATTTTCCCTACAT
ACTGAATTTGTCCTCAAAGTTTTCCTAACAGGGCTTATTTATCTTCTCCAATATAGAGGA
GTGGTGTTCTGTATTGAAAGCTGAAAGACTACATATTAACCTTTTGGCTCTCTTGGTAAA
ACTTCGTATTTGGAGAAATTCGTGGCTATTTTAAGTCTAAGAATAGGTCGTTATAGCTGC
TGAACCTTCACTATAATGTTAAAGGTGATATCTTGGGTTTTCAACCATTGATTTACTTGG
AGCATTTTCCTACAGGGTTTCTCTCTGTTAGGTCACATGCAGAAAAAAACTGATGAGCGC
TGTCTGTGGCTCCAGGATGACGACCCAGGTTGTTAGGCTACATTAGTAATTCTTTTTTTT
TATTATTTTTAATTGTTTTTTAATGTTTATTTTTGAGAGAGAAGGAGAGACAGAGCGTGA
GCAGGGGAGGGGCAGAGAGAGAGGGAGACAAAGAATCCGAAACAGGCTCCAGGCTCTGAG
CTGTCAGCACAGAGCCTGACGTGGGGCTCGAACTCATGAACTGCGAGATCATGACCTGAG
CCGAAGTTGGACGCTCAGCCAACTGAGTCACCCAGGCGCTCCTACATTAGTAATTCTTTT
ACCTGTTTCATAGGACAGAATGTCATGAATGTATTTCATTTTTTGATTCTTTTCTAGAAA
ATTACTTGGGGCATACAGCAAAAAATGCTGTGATCACAGTTCCAGCTTATTTCAATGACT
CCCAGAGACAGGTGAGTTCATTTGACATTCTGAAAATATCAAGACTATTGATGATATTTA
GGACACAGGGTGGAAAATGCTTTTTTCTTTTTTTTAGGCCACTAAAGATGCTGGCCAGAT
ATCTGGACTAAACGTGCTTCGGGTAATTAATGAACCTACAGCCGCTGCTCTGGCTTATGG
TCTAGACAAATCAGAAGATAAAATGTAAGTTTGTGCAGTAAACTCCACCTAGGTTTGTGG
GACTTCACCTATGGAAGTACTGGGCTGTGATCATTTTTCCCCCCTTAGCATGCATATTGG
CAAGTATTTGTTCAGAAGTATGGTTTTGGGAATGTCTGGCTGGACCATCTGGTTGGGCAT
GCGACTCTTGATCTTGGGGGTGTGAGTTTAAGCCCAACACTGGGCATGGAGCCTACTTTA
GGGAAAAAGTGATTCAATATCGTCAATTTTGCTTTATTTTTTTAATGTTTATGTTTTTTG
AGAGCGCGCAGGAGCGGGGAAGGAACAGAGAGAGAGGGAGACAAAATCTGAAGCAGGCTC
CAGGCTCTGAGCTGTCAGCACAGAGTCCATCGTGGGGCTTGAACTCACAGACCCTGAGAT
CATGACTTGAGCCAAAGTCGGACGCTTAACCGAGCCACTCAGGCACCCCAGTTTTAAAAT
GTTTTTCAACTCTATATTTTACAGTTAGCTATTCGTGCCACATGTTCATATACCTGTCAC
TTAGGCAGTTATCCAATATTATAATTAACTATACCACAGGGAAAATGATCAAGTTTGTTC
CTTTGGTTGTTGAAATTTCTACCCTAGTGATAGGTGTTCTCCCTTAAGACCACCTCTTTT
GTCTTTCTAGAATTGCTGTATATGATTTAGGTGGTGGAACTTTTGATATTTCTATCCTGG
AAATTCAGAAAGGAGTGTTTGAGGTGAAGTCTACCAATGGAGACACGTTCTTAGGTGGTG
AAGACTTTGACCAGGCCTTGCTACGACACATTGTGAGGGAGTTCAAGAGAGAGGTTGGTT
ACCAGTATAGTTCATATGTAGACATTGGGATGGTGAGAATTTCTTTATTCAGATGACTAT
TTGCTTTATGACTTTTTGCCCTTAATAGAACATGGAACAGCACTGAAAGAATTGTGTTTC
AGTTTCACGGGTAGACTGAACCATTCTGGTTGTTGTAGCTTTAGCTTGGGAATCCACAAC
AGGTTGAAGAGGGTATGGTACCCTGTATAATATTGGAAGAGGAATTCTGGGCACTCCTAT
TTGGATCCAGAACCCAGTGGCTCGAAAGAACTAAGATTAGATCAGCCCTCTGGCTCCAGA
CACAATTTGAAGAATAAGATTTCTTTTTCCTACAGATTTTTAAGGGCAGTGAGTGATTCA
TGTTTGTTTATAAAGATAGGGCTTTACTTTAAGTTATCATATCTTATCGTTTTAATCTAA
ATAGTATTCATCACCTCATTAACATTAGTATTACGTGTTTTCATTTTGTAGACGGGGGTT
GATTTGACCAAAGACAACATGGCACTTCAGAGGGTTCGGGAAGCTGCTGAGAAGGCTAAG
TGTGAACTCTCCTCATCTGTGCAGGTGGGATGTGGATGAGTCCCAACAGTCTTAATGTTT
CCAGCCTTAGTTTATTTGAATAGCATATTCTTGGTGCAATTTCTATCTAATCTTTTCTAG
TTTTCTAGGTGGCAGTAAAAGCCTGTCCCTGAACAAACGAACAGTGTATTTTTGTTTTGT
TTTGGTTTTGGTTTTTCTTAGAAGTTTATTCTTAGTACACAAGCACAGGAGGGGAAGAGA
GAGAATCCCATGCAGGCTCCACACTCAGTGCAGAGCTCGACATGGGATCGATCTCAAAAT
CATGAGATGCAGGGCTTGAACCCATGAGCCATGAGATACAACCTAAGCCTAAGTGGGACA
CTCAACCTACTGAACTACCCATGTACCCCTAAAGATACTGATTTAAATTAAAAAAAATTT
TTTTTGACATACTGATTTTTGAGAGAGAAACACCGAACACAAGCATGGGAGGAGCAGAGA
GAGAAAGAGGGAGACACAGAATCTGAAGCAGGCTCCAGGCTCCAAGCTGATGTAGGGCTT
GAATTCACGTACTGTGAGATAATTACCTGAGCCGAAGTCGGATGCTTAACCACCTGAGCC
ACCCAGGCACCCCAAGATTCTGATTTTAAAATCTAGACTTAGTAGTGTGCAAAATGGGAA
TCACTAGCCTAGAAATAATAGGTTTCTCTCATAATTGCTAATGTCTTCACTTAAGACATG
TCTTTGTGTGAGTCTCTAATTGTCTCATTTAATTAATTGGATCAGCAATCCAGAAAGTAA
GCTATGAAACCTGGCTGAAGGCTGGGGTATATACACTTGGGCACATTTCTTTCTGTTAGC
ATTAGAGTTGCTCAGCATCTGTTTAAGTGTTAGCCTGTGTTGCTCCAGTTCTGAGAGGTG
AAGCTTCACTTTGCCTTAGGCGTTAATAATAGAACTATATGAAGCATGGTAGTTTTTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTGGTTTCTCAAGTGGCAGC
AGGAAAGCGGAGCATGTCACTCCTTGAGTTGATGATTTGATCACCCGTACTGAGTGATCC
AATGTGGAAAAACTTGGTTTTTGCTTTTTGGGTTTTTTTCTTTTGAACCTGGATTTTTTT
TTTTTTTTTAACGTTAAAAAAAATTTTTTTTCTTTCAATTTGTTTTGAGAGAGTGCAAGC
AGGGGAGGGGCAGAGAGAGAATCCCAAGCAGGCTTCTTTCAGAGCAGAGCCTGATAAAAG
GCTCATACTCAAGAACCACAAGATCATGACCTGAGCCAAAATCAACACTTGGGCACAACT
GACTGAGCCACTCAAGTGCCCCTTAAAAAAATGTTTTTTAAAGTAGCTATGACGAGTTAC
ACAAGAGTTATCCATGGTGTTAATGGTGTTACTTTATCCCTGCTGTCATACAGAGTGGCA
GAACTTTGCAACATAGAATGGTTAGGATTAGAATTGAACTATGGGATGCCAGAAGATAGC
TTAAAATTCGTCCCAGGAGTTGACAATTTGTGGAGGGTGAAGTTGGTTTTTACTGTGACT
GTATTTTACTGGTAGAGTTTGGATTGTTTTCCAGCATTTTGATATTACAACAAAGTTTGT
CCAGCATTCTTGTATATTAATATTTGTGCATGTGTAATTGTAAATCTCCAGAATAAATTC
CTAGAAGCATTACCTCTGTGGGTTTACAGTGTGGTGTGGAGAGATAGGTATTAATTAGGA
CATGAGATTAACAACAGTCAAACCAGAAGTAATGTGATAGGTTAAGAGTGGCTCCCTAGG
CAGACTGCTGGGATTCAAGTCCTATTTCATCACTTACTATCTGTGGCCTTAGGTAAATTA
TTTAACATTTTCTGTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTATCTAATCTTTTCTAGTTTTCTAGGTGGCAGTAAAAGCCTGTCCCTGAACAAACGAAC
AGTGTATTTTTGTTTTGTTTTGGTTTTGGTTTTTCTTAGAAGTTTATTCTTAGTACACAA
GCACAGGAGGGGAAGAGAGAGAATCCCATGCAGGCTCCACACTCAGTGCAGAGCTCGACA
TGGGATCGATCTCAAAATCATGAGATGCAGGGCTTGAACCCATGAGCCATGAGATACAAC
CTAAGCCTAAGTGGGACACTCAACCTACTGAACTACCCATGTACCCCTAAAGATACTGAT
TTAAATTAAAAAAAAATTTTTTTTGACATACTGATTTTTGAGAGAGAAACACCGAACACA
AGCATGGGAGGAGCAGAGAGAGAAAGAGGGAGACACAGAATCTGAAGCAGGCTCCAGGCT
CCAAGCTGATGTAGGGCTTGAATTCACGTACTGTGAGATAATTACCTGAGCCGAAGTCGG
ATGCTTAACCACCTGAGCCACCCAGGCACCCCAAGATTCTGATTTTAAAATCTAGACTTA
GTAGTGTGCAAAATGGGAATCACTAGCCTAGAAATAATAGGTTTCTCTCATAATTGCTAA
TGTCTTCACTTAAGACATGTCTTTGTGTGAGTCTCTAATTGTCTCATTTAATTAATTGGA
TCAGCAATCCAGAAAGTAAGCTATGAAACCTGGCTGACGGCTGGGGGTATATACACTTGG
GGCACATGTCTTTTCTGGTAACCATTAAGAGTTGCCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGTTGGATCAGGAAAA
GATACTAGGACAAGTAAGTATGAGCTCTGAGAAAAGGCTAGTGTGTTCGAAGAGCAGATA
GGCAGGGTAAGTGCAGAACGTGAGGGTAGAGGCTTGATAGATTTGGGATCTGGGTCTATT
CTGAGAAGAGGGAATATAAACCAGTGAAAACTTTTTTTTTTTTTTCTTAAGTAGTGCCTA
CACCCAACGTGGGGCTCAAACCCACAACCCCAAGATCGAGTCGTATGATCCGCCTACTGA
GCCACCCAGGCACCCTAGTGAAAACCTAAATTAAGGGCAGTAACATGGCCAGATATGGGT
TTGTGAAAAGTGCTCTGACAGAGGTGGAGTGGAAATTTGTTTGGGGTCAGGAGGGGTCCT
GTAGCAGAGGTAGCCTGAGTGGAAGTGGGAGAACACTGGGAGGCTGTAGCACATGGTCAG
GTGGTGGTGAGAGGAAGGACTTGGACTGGAGTGAAATAGAGGTAGTGTTGAATTTGAGAA
GCAACAAGGCTTAGTGACAAACTGGGTTTTGAGGATTGAGAGTCCTGGAATTGTTCAGAT
TGTCATTAATATACAGCATATAGAATTGCATTGATACAATGTCCGTGTGTGGGCTTTTAC
AATTAAATAAAAATTTAAAATTGCATTCCTCAGTTGTATTGCCTGTATTTCAAATGCTGA
GCCATACGTGGCTAGTGGCTGCCGAATTAAACAGCACAGATACAGAACATTTCCATTGCC
ACAGAAAGTTCTGTTGGATTTCATTGGTTTAAAGTTTGCTTGGTTGGTTTTTTTTTGTTT
TGAGAAAGCACAAGTGAGTGAGGGGCAGAGAGAGAGAGAATCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGTTGCAAAGAAAGAAAGGAAATCGTCGGTGGTGTT
CTTTACACTTGATCTTAGCCAAAATGCTGAGAAGTGATGGATGGTGTTCTTTAAAGCAAT
ACTCAGCACTGTTCCTACAAAAGATGTGTTAACTCGTTCACTATTTATTAAGCATTTAAA
TGCCAAAAGTAGTTTACGTGATGAGAGATGGTAATGGGTTTGCTCCCTTTCAGTCTGTTT
CCTGCCAGCCTTGCTTCAGCCTTGCTTTGATGTGAAATTGGAGGGGAGGTACAATTTTTT
CCTGAGGGTCCACGTTGAGACGTGTTTCAGCAAGTTTAGTGAGGAGTTTGGTTAGTCTAA
ATAGTCTGAATGTAGGCCCTATTAGGATACCTTTATTATGGTATGGCTATAGCAGCGTTT
GCTGCTTTCCATGAATGTGATGGCAGTAAAGTCAATCCTGGTGTAGGTATCTTTAGTATT
TCTGTAGCTTCCTTACCATCTTCCTGAAACTTAGAAAGCCTTGGCTTGAGGCAAGTTATT
TGGTTCAGAGCATGCTTTTGACTTACTTTTTGTGTGTGTACATTTTTAAGTTTATTTTGA
GAGCGAGAGAAAGCGTGAGCAGGGGAGGGTCAGAGAGAATCTCAAGCAGGCTCCACACTG
TCAGTGCAGAGGCCAGCATGGGGCTCGAACCCACAAACTGTGAGATTATGACCTTAGCCA
AAGTGAAGGGTCATAGATACTTAACCGACTCAGCCATTGAGGTGTCCCACTATTTCATTC
TTCATTGTTGATAACAGATTCTAAAATTTTTGCCTCTGGGAAGATCATAGGTTGAATCTT
TTTAATTTTGAAAAGGAGGGGTGGTGTAAATGAGCAAGGGTCAGTGAGAGAATCCCAGGC
ACAGAGCCAGGCGCAGGGCTCGACCTCCTGAACACTGAGATCATGACCTGAGCAGGAGTT
GAATCTTAAAGAGTCATTGTGTTTGTGGCTGTTGCTTCAAAGTGGGTCTACTCTCTCTAT
AGCTTTCAAAGTCTTCCTCGTGAGGGTATGGTCTTATTTTAATTGAAGTAATAAAGAAAC
GTCACCAGTATTGCTTTCCCTGCTACCTTTGCAGACCGACATCAATTTGCCATATCTTAC
AATGGATGCTTCTGGACCCAAGCATTTGAATATGAAGCTGACCCGGGCTCAATTTGAAGG
GATTGTTACGGATCTAATCAAGAGGACAATTGCCCCATGTCAAAAAGCCATGCAAGATGC
AGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTTGTTGGTGGCATGACTAGGATGCC
CAAGGTATGGACCCATGGAATCCTTGGCATGGAAAGCAGAGAGGGCAAGCACATAATGTT
TTCTCTGGATAGATGATTTGTGTAGGAACATGACATGGCCTTTCTGCCACAGTGACCTGA
AGGGATCATTGAACGCAATTTATGCCCTCACTAGAGGTCTTTTGTGGCCTCTTTTTAAAA
GGGTTTCAGAAAAAGGATCAGGAAGGGCAAAATGTCTTTGGGGGGTAGCATGGAAGATCC
TGAACTTCATTCTTGGGATATTTTTATAAACCAAGTATTTCTCAAAGTTGGAGATCAGAG
ATAGCTTAAAACCTTGGTACTATCTAGTCTCTACGTGCAGTTTTGGATGCATGTGTTTAC
AGCATAATATTTTGGGTTTCTAACTGCATCACCTCAACAGATTTGTGCAATGATGCATAT
TATTTATCAACACATCATTCTGATAAGATAGGTGTGTGGAAAACTAATGACTGAGCACAA
CCTGTTGAAGGTGTCATTTTTGCTGTATAGCTTGAATAGAATAGTAATTTCCTTTGGAGT
TCATGGGCTTAGGAAAATCTGCACAGAGTAAAACATGGAGAAAAAAATGGAGGCTTTGGA
CCAGGAAAATATCTTTATGTTAACAAATTACCCCAGATGCTGTTTAGGTAGCACTTTTTT
CTAACATTAGTAAAATAAGCTGGAGAGAAGAACATGCCTCACATTGGCAACAATGTTGAA
TTATTGAATTAGCACTGCTCTTTTAAGGTGGTTTTTAGTTGATCTGTAGAAGGGGAATTG
AACTATATCTAAGTCTTGATGTCTTGCAGCCTGTATTTCTAATTTAATATGTCGTATAGG
AAACCCAGTAATAAAAGTTACGCAGCTCCTTCTCAAATTTAAAAGGACTAAATGGGGCGC
GTGGGTGGCTCAGTCCGTTTTGCGTCTGACTCTTGATTACAGCTCAGGTTATGATCCCAG
TGTCATGGGATTGAGCCCCGCCTCATACTCCACGTTGAGCATGGAGCCTGCTTGAGATTC
TGTCTCTGCTCCTCTACCCTGGTCGAGCTAACAATAAATAAAAAATTTTTTAAAAGGGCT
ATGATTGATGCTCAAGTAAAGGATATGAGTGTTGCTGTATTTGACACACTGAGGTCATTA
AGAAGAACTCAAATATGAAATAGTAACATGAGTGAACATTCTTGGATCTGAAGCAGCTTA
TCCTGAGATTTGTTGTGGTCTTGGGACACATGTGCTCTTTTACCCTTCCCAAGGGTAGCT
GCCCTTGGTAGTGGGTGACGGGTTCTTTTTTCTTGGTGGCTTAGGTTCAGCAGACTGTAC
AAGATCTCTTTGGCCGAGCCCCAAGCAAAGCAGTCAATCCTGATGAGGCTGTGGCCATTG
GAGCTGCCATTCAGGGAGGTGTGTTAGCTGGTGATGTCACAGATGTGCTGCTCCTGGATG
TCACTCCCCTGTCTCTGGGTATTGAGACTCTGGGAGTGTTTTTTACCAAACTTATCACAG
AAACACCACTATTCCACCAGGAAAAGGCCAGGTAAGAGTCACCTACCCCTCCGTTGTCAC
AGAGAATATGGGTTCTGTGAGGGGACATGATTATACCCACTTTATTTTAGTTTTTCCTAG
GACATTTTGCTTTTTGTTTTTGAGTCCATACTAGGTGAGGGTGTTAAGAATCTTGCTTTT
TTTTTCTTTTTTTGTTGGTTCCTGAATATGTTCTCCTTACCTGTCAGCTAGCAGTAATTT
TAGGGAAGGTATCAGTGGTGTCCTTCACCGTATTAAAATAACTTTCCAAAAGGAGCTTCA
TCGTTTGGGACTAATTTCCTTGTTTTCTTCTGTTCTCAAAGGCAGTAAAAAGAATGGCCT
GGCCAAGATTAGGGGAGGGTGCTTGTCTTATGGGTGAATGATGGAGATGCTGAGATACCA
AGCCAGGGCTATCTGGACAATGGCTTGCTTAGTCTTAGATTCAGAATTGTTTACTGACTT
TCCCAATTTGTTTTTCTGAAAAGCTGTTATAGCTAATGGCTGTTGCTATTTGTTCAGTGA
TGTATTGCCAATACATCATTCTGAAGAAAACTATGTGGTGACTTCCTGTGACTGAGCATA
AAATACATGTCATGTCTCTGACCTGTTTCCTCAAATGAGCATGTTTCAACATCTCATTTT
CTTTAGCTCCTTTTGAGGATGCCTTTGCTAATGCTGCATCTTTGTTTAGTGCGTTTGCTT
AGCTGAAACAATAGCTACTGTATACCCTTTGGCTGTACTAATCCTATTCCCCTGCAAAAA
CAAAAGCCTTTGTTCTGAACATGGGATTCTTAAGTGTTGAGATGGGAATTTCTTTCTTTG
GCTTGCACTTTTCTAAGGGGAGTGGCCTAAACAGACTGCTAACCCAGAGTTTTTTTCTCT
CTTAGGTGTTTTCTACAGCTGCTGATGGTCAGACTCAAGTGGAGATTAAAGTGTGTCAGG
GTGAGAGAGAGATGGCTGGAGACAACAAACTTCTTGGACAGTTTACTTTGGTAGGTATCA
GGAATCCTGAGTACTTTGCTTTTTCTATAAACTTGGACTAAATTATAATTCTTAATAACA
TTACCAAAACTAAAACACAGGGACCTCGTCTGTGTTACCTTAGTTCAGTGTACAGATGAA
TTTTGCAACTGGATACCCATGGCTTCAGTTTTTCCTGAAAGTTTTGCTTGTTCCTGATGC
CTTAGGAAGTTGATAAATATAAGAGCTACGGAAATAGAATGTTAGTTAGGAAAAATTCCC
CAATTATTAATTTAAGGCATTTGATATCGGCTCCTAGTGAGCATTGTTTATTGGTTCTTA
GTGAACAATGATGGACAGTTTTCCTCTCATTCAGCGTGTCCCTTAGGTATACACGGTCAT
TATGGTTACTTGCTGTAGCCAACTTCACTGGCTTAAGCCCTGGTTCTTTCAGGTAGTAAT
GAAATTACTATTCTTATTTATAAATGTGTGTTTTTATACATTTTAAGTATTGTTTGTTGC
TCCCAGGAACAAGTTACTCTACCCAGAGACTGTATATATAGGTTTGGAAATAGGGCACTG
GACCTCTTGTGAGAGGAACTTAATGCTGCATATTTCTCTATTTTAGATTGGGATTCCCCC
AGCCCCTCGTGGAGTCCCTCAGATTGAAGTTACATTTGACATTGATGCCAATGGGATTGT
ACATGTTTCAGCCAAAGATAAGGGCACAGGACGTGAGCAGCAGAGTAAGTGTTCTTATTT
ATCAGACTCTAAGAGACAAGGGACCTTGAAGTTCCTCTGAGAACTAGACCTTCTAGATTG
TGCATGTGTTTTCCCCCAGCCTCGGGGGGATTGGGGGAGGCAATGAGTCCTTTTTGCCCC
TTTTCTCCTTGGTCATCAGATTCACATTAACAGGTGTATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTGGATTGCGAAAGTTTTGGTTAGCCAGGCAGAACAAATGGT
CTTTGTGGATTTCAGATCCTGGTTTCCTTCTGTTTGTTATAGGACAACGGTATTTCTCTT
ATTCGTAATATATATACATAATACTTCATCATACATCAAGATTGGCTACTCTGAACAGGA
ATATTTTTTTTAAGTTTTGGTGGGGTTTTGTTGTTGTTTTTTAATTTATTTGAGAGAGAG
AGAGTGCAAGCTCCAATGTGCAGAGCCTGACATGGGGCTCGAGGTCCTGAATTGTTCCAT
TATGACCTGATCGGAAATCAAGAGTCGGATGCTTAACCAGCTGAACCATTAGGTGCCCCA
GGAGTGTTCTTTTTCTTAATACAGAGAAAGAGGCAGATAATTTTATCTGGGAAGTAACAA
GATGCTTTTATTTCATTCTAGTTGTGATCCAGTCTTCTGGTGGGTTAAGCAAAGATGATA
TTGAAAATATGGTTAAAAATGCAGAAAAGTATGCTGAGGAAGACCGACGAAAGAAGGTAA
CTATTTTCTGCCTCTGCAACTGGGAGGTGAAAGTGGGAGTTTGGACATGTATTGTTGATT
TTCTAGTCTGTCTTTGAATCTGTCCTTGCTCTCTTTTTGTTCCTAACTTTTGTGTGGAAT
GCTTTTCTTACTCTCATTTCCACATCAAAATTTTTGTGTTATACAATAAGATAAAATCAC
TTACAGACATCCTAGACTACTTCAGACCACAGTAATTTGTCTTTATTCTGTAATTATGTA
TCAGCATGTTCTAACTGGTTGGTTGGGAAGTCTTCATACTAAATTTATAATTTCTCCTAG
GAACGAGTTGAAGCAGTTAATATGGCTGAAGGAATCATTCATGACACAGAAACAAAAATG
GAAGAATTCAAGGACCAGTTGCCTGCTGATGAAGTGAGTCCTCTCTTAAAATAGTTCAAG
AAGTTAGGCATTATCACCAGTGTCAATGAAGTTTGTTTTTCTGTGTGAATCTTGATAGGA
ATCTAGTGGTATTTTTGTTTCTCAGGCTTTTTATTCACATTTTTCACACAGACTTCAGTT
GGGGCCGTTTGATAAATAAGGAAATTGAGATACATTTTTAAAGAGGAGTTCTGTCAAGGA
TAGAAATTTGTTTTTTAATGTTTCTGAGTATTACTCTACATAAAATGGGATAAGAAACCC
AGAGAAAGAGTTTGGTTTTGTTTTTAAGTGCAACAAGCTAAAAGAAGAGATTTCCAAAAT
GAGGGAACTTCTGGCTCGAAAAGACAGTGAAACGGGAGAAAACATAAGGCAGGCAGCATC
TTCCCTTCAGCAAGCATCACTGAAGCTCTTCGAAATGGCATACAAAAAGGTACAAGGACA
TTTTGTTGAGTGAATTTGTGCCTAACTTCATCTTAATAGAACTGCTGTTAATTACTGTCA
CTGGTGGCACTCTACGTGGCCGTTTATAGAACTGGGAGTATTGGAGTTGGAAATACTCTG
GCTTTCTTGGCTCTGCTTTGGGAGGGGGCGGTGATGGCAGTCAAAGGGAGGGACTCACAG
AAACCATCAATAGAGTACAAGAAGGGAAGGAGAGTAGAATAGGCAGGATATGCCCCCTTC
TTTAGTTTATCAAAGAGCAAACTGTCCACTTTAAATGAGTTGCTCTCCAATATTTTCTTA
ACAGATGGCATCTGAGCGAGAAGGCTCTGGAAGTTCTGGCACTGGGGAACAAAAGGAAGA
TCAAAAGGAGGAGAAACAGTAATACCAATAAACTTTGGAGTCAAATTATGACGCTTGGGA
GTGAAGAAACTTCCTGAGCAGAAATGGGCAAATTTCAGTCTTTTACTGTGTTTTTGCAGT
ATTCTATATATAATTTCCTTAATATGTAAATTCAGCAACCATTAGCTAATGATCATTTAA
TGAGAATTCCAACCATACAAAGTTCAGAGTACTCTGTCCCTAGTTAATTTTCAACTGCAT
GTAAAGGGAGGGGAAGATGATTTACTGATCATTATAAAAACACTGTTGTTTTGTGCTTTA
GTAGCCATATTTTCAAGAGGTGAAACCATCTCAATAAAGAAGGTACTTACCCATAAACCT
GGAATGCCCTCTCAGACCATATGGGGATGAGATCCTTCCAGTCAGTTGAAACTGCTAAAC
CAGCCTATGTGTGTGTATGAGGGATTCTTCAACTGAGGCCTTGCAAGGCAAGCCAGCTGT
GCCATGTTGGGAGGTAGGGCAGGAGAAGGTAGATCAATGGGAAAATAGATGTTAGGTGCA
GCTTTAAAAAAGGTAGTAATAGGGCTCCCTAACTTTCCTAAGGCATACTTTTCTAGCTAC
CTTCTGGCCTGTGTCTGGCACCTGTATCCTTGATTGCTTTTTTGATCCAGTATGGATTTT
TAAAAATAAATGAAAAGCATCTTGATCTCTTATTTATAAGAAGTGAGGTTCTGAGATTTA
GCTTCAAGAAAAGGACACGAATCGTATTTCCCAATTCCCTGACCTAAAGCCATTCAACAG
GCTTTTTGTCTAGCATCAAAACTAGGGCTACTATTATCAGGTTGCAATAAGCATGTCCAA
TGGTAAACCCTAAGAATTCAGTGGCTCGATAACATCCTGAACTGATTAGTGCTCAGATTC
CTGTCCTAACCAGTGGTCTTCCTGCATACTCCCCCCTCCATACATGTATAACTGTCCTCT
CCCATGCCCAAAGGAATGTCGGTCCAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 2387..2445, 2734..2821, 3695..3876, 5063..5187, 5997..6070, 6157..6263, 6910..7072, 7551..7643, 12694..12903, 14204..14395, 14398..14430, 15305..15409, 16006..16123, 16821..16915, 17220..17312, 17608..17748, 18064..18141
1001..1081, 2387..2445, 2734..2821, 3695..3876, 5063..5187, 5997..6070, 6157..6263, 6910..7072, 7551..7643, 12694..12903, 14204..14395, 14398..14430, 15305..15409, 16006..16123, 16821..16915, 17220..17312, 17608..17748, 18064..18138
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved