Felis_catus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Felis_catus TNPO2
Felis_catus
TNPO2
GeneScaffold_824
SNORD41
25861..25930
30857
ACTTGATTGGGGGAAACAGCAGAGATCCGTCAGCAGGAGTTAATGCTGACTGGGGCAGG
GGGCGGGAGGGGGGAAAGACTTGGCCAGACCTGATTGGGGAAAGCGACGGGGACCCGTCC
AGGGGTCATCTTTCGTGGGGTGGGCGGGCTTGGCTGGCTGTCTTTCCGCGAGGGAACTCG
GACCTGTCTGGGGATTGCTTCGGGCCCGATTAAGGGGAATCTATGGATGGAGTCTGGCTA
GGCCAAAAAGAGGAGAGTCTGGCATCCGGCTCAGTTTGGAGGGACAGATTAGAGGAGGTG
GCAGGGATCGGGACTATTGGAGCACCTTGAGGCCGTGCATCTGGGGAGGCTCAGGGACCA
GACCAAGGCGGAGGAGGCGGCTGGGATCTGGCGGAGCGTGAGGGCTGGATTTCGGAAGAA
GAGGGTTCTTTGGGGACCGTGCCTGGACCAGGGAGACCGCAGGGCCGGGGCGCTGTCGCG
GTCTGGGGCAGGGCCGCTGGATGGAGAGGTGGCTGGGGCCTTGCCTANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGGCGACCCCCGCCTGTCCGCCGAGGGCGCTCCCGTCGTGCTG
CCGCTGCGGCCACCTCCACGGCGGCTCAGCCCGGGGCTCACACGGGGCCCCTGGGACCCA
GCGCTGACCCTGGCCCCTACCCCCGCAGCTCACCTCGCGCCATGGACTGGCAGCCAGATG
AGCAGGGCCTGCAGCAGGTCCTGCAGCTGCTCAAAGACTCGCAGTCGCCAAACACAGCCA
CGCAGCGCATCGTGCAGGATGTATCCTTCCTTCCTTCCTTCCGGGCCCAGGGGGAACTGG
GCAGACATCTGCAGCCCCTGAAGACCAGAGGAAGGGGCCCGCTCCCTAATCCCCAGACTC
TTGTTCTGTCAGGAGCTACAATTGGCAGAGAAGCAGGGATCCGACCCCTTGGGTCCCACG
TGCAGAGAAAATGTGGCCCTGTGGGGGAGGGGGAGGAGGAACACCTTTCACTGGCACTGG
GCCGTTTGGTTAGTTTCACCGTCAGGATTAATTTTTTTCAATCGAGGTTTGAAATACTCT
GACTTAAAGGTTAAGATACTTAAACCACCAGCAAGTTTCCCTTGGAAATATGACTTCCCT
TCTTTTTTTAAAAAAGCAGGCAACGTGGGACTGGTGGCGAGCAGGACTGAGTAGCAGCCG
CCTCCTTCAGACAGAGAGGCTCAGCCATGCTCCCCCACCACCTGGATGAGTTTCAGGCGC
CTGAAGTGCTGTGTTATTCTGGCAGGGAGGTTGACAGGTGGGGTCCCAGGAGCTAGCCAC
CTCATCCCAGTGGGCAGGGGGACTTTCAGCCACAGGACAGTGAGGGGACCCACCAGGGGA
AGGCCCTTGTCTCCCAAGTCCCTTAACAGCCTGGCAGAAACTCAAACAACTGAACCAGTT
TCCCGACTTCAACAACTACCTGATCTTTGTCCTGACCAGACTCAAATCGGAAGGTATGTC
CTCAGCGCCCCTCCACTCCAGCCGGACCCCGCTTTTTCCCCTGCGGTCCCCTGACCCTCG
GCCCTCTTTCCCCAGACGAGCCGACTCGGTCCCTCAGCGGTCTCATCCTCAAGAACAACG
TGAAGGCACATTACCAGAGCTTTCCGCCACCCGTGGCCGACTTCATCAAACAGGAGTGTC
TCAACAACATTGGCGATGCCTCCTCACTCATCCGAGCCACCATAGGTGAGAGCGGGTAGT
GGGAACCGGCCAGTGAGGACTCCTGAGTTCTCGCTCTCAGCTAAGGAGCTTTGCAGCCTG
TTAAGAGTATCAGTTCACTGAAGGCTCCAGTACCGTGGTTGGTAGTTCCGTTACGGTTGC
CATCTTACAGATGAGAAAACTGAGGCACAGAGATGTTAAGGGACTTACCTGGTAAGTGGC
AGAGCTCGGAAGTGGCCAGCGCAGGTCGGTGCTCTGAACCACTCCCCCCGAAATAGCCAT
TCTTTCTTTTGAGGCCACCACTCAGTGTCTAGGCCCTGAGGGTGTAGCACGTTAGAACCC
GAGGCCTCCCTGTCCTGAGGAGTTGGGCGTCTTCGGCTGTTTCTCCCCAGTAATGAGATG
ACCCGGGAGTTAGTTTTGTGTTGGAGCCTTCCTGGCTCTCGGAGGGCTGCCTGAACAAGT
TAAGGGAAGGACGGTGGAGAATTCTCCAGCTATTTTCCCCCAAGCCTTTTCACTACTGAT
AAACACCAACTCAACGCTTTGTTACCGGCTTGCTTTTTTCCCCCCACCTTTACTGAGATG
TACTTGACCCCCAATGGATTTATGTTGGTATTCTTTAAATTGTCAGCTTTTTAACGTTGC
TTTTAGAAGAAAGTTGTATCTAGCTTTTTTTTTTTTTAAGTTTACTTGTTTAGTTTGAGA
GAGAGAGAGAGAGAGAGGATGATCAGGGGAGGGGCAGAGAGAGAGAGGGACAGAGGATCC
CAAGGGGGCTCGGTGCTGATAGCACAAAGCCCGAATTCAGGGCTCGAACTTGCGCACCGT
GAGATCATGACCTGAGCCAAAGTCGGATGCTTAGCTAAGACACCCAGGCCCCCCCCAAAG
TTGTAGATAGCTTTTAAATGAAAAGATGTTTGTTTGCCATAAAGAGCAGGTAACCTTAAA
AACATGCAACAAAGACACAAAAATAGTATTAAGTTGGAATAGATACTGGGCCTGCTAGAA
GTGCTCATCTTGGGGCCTGCTTCCTCTGTTAAGTGACCCTTAGCCCCGACGATACCCACT
GTGAGACCAGTAGAAGGATCTGGACTTCCCGAGTTCACTAGATAGCCAGGTTCTGCTCTA
AGTGTTTGAATTAAGGCATTGAAGCTTCCGACATCCCTAGGGACCCATGGTGGGTTTTTT
TTTCCCCCCCTTTTGAGTCACAGAGGGGTTAGGACACGTGGCCAAGTTCGCACAGACAGG
GACAGGGCTGGAACTGCACTCCCGAGTCCTCAGAGCCTACCCACCGCAGGTCACCCCTTT
TCCAACAGCAGCAGGAGCCAGAGTCCTCTAGAGTGATGGCAGTGACACCTTCACCCTGCT
GGGGAAACACTGCCACCTCCTGGCTTTAAATCCTATGTCTACGTCACCCTCACCTGTGTT
CCCTTCGGCCGTATTGGGCTCAGCCACCAGACCGCCTCACGGCCCTGGCCCTGCCCTTCA
TTCGCGTATTGTACTTCACACTTGGGCTTCTAATCAGCGGTACGAGGCCTCCCCAAGGCC
ACGTGGTCCTGCACAACCTGCCTCTGTCACCTCTCAGCCCTCGCCTCCACCTGTTCCCCA
CCCTCACCACCCCCTGCTCAGCCCCTCTGGCTCCTCACCTGTCTTTGAGCACACCCAGCC
TGCCTTTGCACCTGCCTGGGATGCCCTTTCCCCAGGGAGTTGGACAGCATCCCCTCATCT
TCTTCAGGTCTTTCTCAGAGAGCTAAGCGTCACCTGGGCAAGGCCTGCTCCGGCCACCCG
TTTTTAAATTGCTGTTCTTGGCGCTCCTGACTGGGTCCGTCAGAAGAGCATGCGACTCTT
GACCTCGGAGTCATAAGTTCCAGCCCCACCTTGGGTGTAGAGTTACTCAAAAACTAAATA
AACTTTATAAAATTTTTTTTTTTTTACATTTTTTTTTAATGTTTCTTTATTTTTGAGACA
GAGAGAGACAGAGCATGAACGGGGGAGGGGCAGAGAGAGAGGGAGACACAGAATCCGAAA
CAGGCTCCAGGCTCCGAGCGGTCAGCACAGAGCCCGACGCGGGGCTCGAACTCACGGACC
GCGAGATCATGACCTGAGCTGAAGTCGGACGCTTAACCGACTGAGCCACCCAGGCGCCCC
TATAAAAAATTTTTTTTAAAAAAACGTTAAAAAAATTGCTGCCCTCACTCTCAGCCCTTG
CCGGCCATCTTCTCTGCTTTCTTTCCCCCCTTAGCTTTTGGCATCTAGCCTCCCAGTTCT
TTTGCTGATTTATTTTTACCTCGGAGCCTCTCTCACTAGGCAGTCTGCTCCCAAGGGCAG
GGCTTTTGTATGTAGCTCTGTGCTGCTTCCCGGGGCCTGCAACAGCTGGCTTACGGTAGG
GCTCCGAGGATCTCGAAAGGAGCGTGTAGGGCTTCTGGGGGACCGCGCACGGACAGCCTG
TGAGCCAGCGGAGCGAGTGCGCCGCAGGCCCGCACCCAGCCTGAGGCGGCGTCCTTTCCC
GGCTGCCCCAGGCATTCTCATCACCACCATCGCTTCCAAGGGCGAGCTGCAGATGTGGCC
CGAGCTGCTGCCCCAGCTGTGCAACCTGCTCAACTCGGAAGATTACAACACTTGTGAGGT
AGGTGACCGGCTGTGGCCCGCCTGGGCGGGAGCCGGGGAGCCGGACTGGGGTTCACATCC
GTCTGCCCGCTCCTCTCCACCCAGGGGGCCTTCGGAGCCCTGCAGAAGATCTGCGAAGAC
TCATCTGAGCTCCTGGACAGCGATGCCCTCAACAGGCCCCTCAACATCATGATCCCCAAG
TTCTTACAGTTCTTCAAGCACTGCAGCCCAAAGATCCGGTGGGTGTGGCTTCCCAGGGTG
GGGGTGGGGGTCTGTGGAGGGGCTGGGCGTGGGCGGAGTCAGGGCCGACCCACATGCCCC
CTCCCTGCCAGGTCCCATGCCATAGCCTGTGTGAACCAGTTCATCATGGACCGGGCCCAG
GCGCTGATGGACAACATCGACACCTTCATCGAGGTGGGCTGCCGGGCTGAGGGTGAGCAG
GGCAAGGGCCGAGGGCCCGGCTGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACCCCGGGCTGGGCCAGGCTTTAGCCTTTTTCCTACCCTGCCCTAGTACATG
CTGCAGAGGACCCAGGACCACGATGAGAACGTGGCTCTGGAGGCCTGTGAGTTCTGGCTG
ACGCTGGCCGAGCAGCCCATCTGCAAGGAAGTCCTGGCCTCCCACCTGGTCCAGTGAGTG
CCACTGCTGCCCTCTGTCCCACCTCAGCCCCCACCCTACTCTGCCTTCCCTCTGGTTGTC
TCCTGTGTGAGTCTCGGTCTGTGTTCTCTGTCTCCGCTTACTTTCGATCCCTGTGCGTTT
CTGGTTGGCAGGCGATAAGAAGATAATTTCCAATGACTTAAAAATGTGGGGGCTCCTGGG
TGCCTCAGTGGGTTAAGCGTCCGACTTCAGCTCAGGTCACGATCTCACACTCTGTGAGTT
TGAGCCCCACGTCGGGCTCTGTGCTGTCAGTTCAGAGCCTGGAGCCTGCTTCGGATTCTG
TGTCTCCCTCTCTCTCTGCCCCTCCCCTACTCATGCTCTGTCTCTCTCTGTCTCTCAAAA
ATGAATGTTAAAAAAAAAAAAATTTTTTTTAAATGCGGTAAATTATAGGTGAAAGAAATG
AAAACTCAGCAGAGGCTGCAGGCATAGCTGGATCCAGGTGCTCAAAGGATATCAAAGATG
TCTGTGTAGTCTCAGACCTACTCCTGTGTTGGCTTTGTCCTCAGGCACGACCTTCCCTCA
TGGTAGTGCTGTGGTCTTCTGCTTACCTTCAAGCTTAGGAATCTCAGAATAAAGAAATTC
TCTCTCAACCAGTATCTCCAGCAAAAGTCCTAGGGCTCACCTTCCTTGGCCAACTTGGAT
CACTCGCCTATCCCCGAGTCATGAATCATTTTCTCCTGAGGTGCGTGGGCACCAGCTGAG
GGCGCCTGGCTGCCCTGCCTGTTTCTTCTCTAATCTGGCCCGTCCCGGGGAAGGGCCTCA
TGTCCTTGCCTTACAGCATGCTAGGGTTCGGCCACCGTTTGAAGCTCTCTGGCGTTTTCA
GGGGTCTGGACTTCATTGAGTGGCCAGGTCTGGGTCAAGAGCCCTCGTGGGGAGCCAGGA
GTCATGTCAGCTCTGTCCCAGGCACCATGGTTGACTAGGTTGGGATAGTGGCCCTAAGTT
CCACACACTGCCCCTTGGCTCCTTGTTGCTTCTGTTTTGCCCAGGCTGTGAGCCCTCCTG
GGGACCCCTGCGTCCCATCCCAGTGAACAGCCTCTCTCCCCACAGGTTGATCCCCATCCT
GGTAAACGGGATGAAGTACTCAGAAATCGACATCATTCTGCTCAAGGTCAGTCTGGGCCG
ACCGCTGGGTGTGAACAGGCAGGTGAGGGCTGGGGCGTCGGGGCTGCGGGCCCTGGTGGT
GCTTAGTGATCTGTCCGGCCTTCCACAGGGGGACGTGGAAGAGGACGAGGCGGTCCCCGA
CAGCGAGCAGGACATCAAGCCACGTTCCATAAGTCGCGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCCCCCCCACCCCTCCCGTCCCAGGG
AAGTGCTCGGCAGCTGCACTGGACGTCCTGGCCAACGTCTTCCGGGAGGAGCTGCTACCC
CACCTTCTCCCCCTGCTCAAGGGGCTCCTTTTCCACCCTGAGTGGGTGGTCAAAGAGTCG
GGCATCCTGGTGCTGGGCGCCATCGCGGAGGGTGAGTGCCTCTCCGGCCTGGTTGGGGCC
TGGCCCCTGAGCCCCTCAATGGTGCGGGACGGTACGGGGCGGCCCAGGCAGGGCTGTGTC
CGGGGTGTGGCCGCACGGCACGGGCGACGCCACCCCCAGGTTCTCTCTGAGGCCTGCCCT
GCGCCCTCCAGACAGCTCTGGGATGTGAGTCTTCCCCACGGCCCGTGGGCCTGAATGGAA
CCCCCGAACCCCACAGTGCACGCCCCCCCTTGAATTCTCACAGACAGCGGTTCTGCGAGG
CTGTCGGCACGGTTACAGTCGGAAAAGTGACAGGCAGCCTGCAACGCTTGCCCCGCGGCT
GGCAGCCCGGTCCCCCGGGCTCAGCGCCAGCCCGATGAGGTGGGGCGCATAGATGAAGAA
ACTGGGGTGCGGGGAGGTTGACGCCGTTTCCCCGGTCACCCAGGGCGCGGCTGGGCTTTA
GCCTGCCACCGGCTCCCCGGCCCGTGAGTCGGAAGTGTCCGCTGGTGGCGTTTACGCGGA
CCTCTGTCCTTTTCGCGCCTTTTGCGCTCCTTCGTCCCGGTGGGACGTACAGCTTGAGTT
ACAGGTGTCACCAGTGCCCGCCTCAGCCTCCAGGCCTCTCACAAAAGGTTCAGACACGAC
AACAGGAGCCGTGTGTTTAAAGTTTACCTAAGGAAAGATTTCCTCACATAACCGGCCCGA
CGTACGTTACGTTAGCACGGGGACGTGAATTAACGGGTCATGTCAGGCGTCCTAGCTTTT
AGCGGAAAAGGATCTCGAGGGATTGACCCATAACTGGTAAAAATGGTTCTTGGGTCTTGG
ATCATTAGATGGCGTGCTCTTATCTGTGTTCTCCGAACAAAGAGATTCAATTTGTGGCTT
TTTTTTCGTTTTTAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTTCGCCCTGGCCGTGGAC
GACGACCCTGAGGTGCGGAAGAACGTGTGCCGTGCCCTGGTGATGCTGCTGGAAGTGCGG
ATCGACAGGCTCATCCCCCACATGCACAGCATCATCCAGGTGTGCATGGCTAGCCCGGGC
GTGCCGTGGGGTGGGCGGCAGGTGGGGAGTCACCCCGGGCTGGGCCAGGCTTTAGCCTTT
TTCCTACCCTGCCCTAGTACATGCTGCAGAGGACCCAGGACCACGATGAGAACGTGGCTC
TGGAGGCCTGTGAGTTCTGGCTGACGCTGGCCGAGCAGCCCATCTGCAAGGAAGTCCTGG
CCTCCCACCTGGTCCAGTGAGTGCCACTGCTGCCCTCTGTCCCACCTCAGCCCCCACCCT
ACTCTGCCTTCCCTCTGGTTGTCTCCTGTGTGAGTCTCGGTCTGTGTTCTCTGTCTCCGC
TTACTTTCGATCCCTGTGCGTTTCTGGTTGACAGGCGATAAGAAGATAATTTCCAATGAC
TTAAAAATGTGGGGGCTCCTGGGTGCCTCAGTGGGTTAAGCGTCCGACTTCAGCTCAGGT
CACGATCTCACACTCTGTGAGTTTGAGCCCCGCGTCGGGCTCTGTGCTGTCAGTTCAGAG
CCTGGAGCCTGCTTCGGATTCTGTGTCTCCCTCTCTCTCTGCCCCTCCCCTACTCATGCT
CTGTCTCTCTCTGTCTCTCAAAAATGAATGTTAAAAAAAAAAAAATTTTTTTTAAATGCG
GTAAATTATAGGTGAAAGAAATGAAAACTCAGCAGAGGCTGCAGGCATAGCTGGATCCAG
GTGCTCAAAGGATATCAAAGATGTCTGTGTAGTCTCAGACCTACTCCTGTGTTGGCTTTG
TCCTCAGGCACGACCTTCCCTCATGGTAGTGCTGTGGTCTTCTGCTTACCTTCAAGCTTA
GGAATCTCAGAATAAAGAAATTCTCTCTCAACCAGTATCTCCAGCAAAAGTCCTAGGGCT
CACCTTCCTTGGCCAACTTGGATCACTCGCCTATCCCCGAGTCATGAATCATTTTCTCCT
GAGGTGCGTGGGCACCAGCTGAGGGCGCCTGGCTGCCCTGCCTGTTTCTTCTCTAATCTG
GCCCGTCCCGGGGAAGGGCCTCATGTCCTTGCCTTACAGCATGCTAGGGTTCGGCCACCG
TTTGAAGCTCTCTGGCGTTTTCAGGGGTCTGGACTTCATTGAGTGGCCAGGTCTGGGTCA
AGAGCCCTCGTGGGGAGCCAGGAGTCATGTCAGCTCTGTCCCAGGCACCATGGTTGACTA
GGTTGGGATAGTGGCCCTAAGTTCCACACACTGCCCCTTGGCTCCTTGTTGCTTCCGTTT
TGCCCAGGCTGTGAGCCCTCCTGGGGACCCCTGCGTCCCATCCCAGTGAACAGCCTCTCT
CCCCACAGGTTGATCCCCATCCTGGTAAACGGGATGAAGTACTCAGAAATCGACATCATT
CTGCTCAAGGTCAGTCTGGGCCGACCGCTGGGTGTGAACAGGCAGGTGAGGGCTGGGGCG
TCGGGGCTGCGGGCCCTGGTGGTGCTTAGTGATCTGTCCGGCCTTCCACAGGGGGACGTG
GAAGAGGACGAGGCGGTCCCCGACAGCGAGCAGGACATCAAGCCACGTTTCCATAAGTCG
CGCACAGTGACGCTGCCCCATGAGGCTGAGCGGCCTGATGGCTCGGAGGATGCAGAGGAC
GATGACGACGACGATGCTTTGTCCGACTGGAATCTGAGTGCGTGGCCTGGCCTGTGGGGC
CTGGGGGGTCGGGGGCAGGAAGCCCAGGGGCTGCCTCTTGGGAGGTGATGAGGGGCCTCC
TCAGAGCAGATCGTGACGACTCTAATTACGATCTCTGATCCTGGGGATACGGTCCAGGAG
GCTGGCAGCCACCCAAAGAGCCTCCCTGCTTCTCCCCCCCCCACACCCCACCCCTCCCGT
ACCAGGGAAGTGCTCGGCAGCTGCACTGGACGTCCTGGCCAATGTCTTCCGGGAGGAGCT
GCTACGCTTCCTTCTCCCCCAGCTCATGGGCTCCTTATCCACCCCTGAGTGGGTGGTCAA
GGAGTCGGGCATCCTGGAGCTGTGGCGCCTTCGAGGAAGGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCAGCCTGCAACGCTTGCCCCGCGGCTGGCAGCCCGGTCC
CCCGGGCTCAGCGCCAGCCCGATGAGGTGGGGCGCATAGATGAAGAAACTGGGGTGCGGG
GAGGTTGACGCCGTTTCCCCGGTCACCCAGGGCGCGGCTGGGCTTTAGCCTGCCACCGGC
TCCCCGGCCCGTGAGTCGGAAGTGTCCGCTGGTGGCGTTTACGCGGACCTCTGTCCTTTT
CGCGCCTTTTGCGCTCCTTCGTCCCGGTGGGACGTACAGCTTGAGTTACAGGTGTCACCA
GTGCCCGCCTCAGCCTCCAGGCCTCTCACAAAAGGTTCAGACACGACAACAGGAGCCGTG
TGTTTAAAGTTTACCTAAGGAAAGATTTCCTCACATAACCGGCCCGACGTACGTTACGTT
AGCACGGGGACGTGAATTAACGGGTCATGTCAGGCGTCCTAGCTTTTAGCGGAAAAGGAT
CTCGAGGGATTGACCCATAACTGGTAAAAATGGTTCTTGGGTCTTGGATCATTAGATGGC
GTGCTCTTATCTGTGTTCTCCGAACAAGAGATTCATTTGTGGCTTTTTTTCTTTTTAAAA
AAAAGATGAAAAATAGAAAAAGCACAAATACCCCAGAAATGTTTCAGAAGAAAAGTACTT
GGGGTGCCTGGCTGGCTTATTCAGTGGAGCGTGGAGCTCTCGATCTTGGGCTCGTGAGTT
CGAGCCCCACGTCGGGCGTAGAGTGCAGGTTGAAAAAGGCAAATTCCTTCCCGACCATTT
TGGTCACCATGCTGCCCGGCCATCTGTGAAGTGATGAGTGACTGTCACGGGGTGGAGCCA
GTGGAGGGGGAAGGCTGCTTCCATCGCGGTTCGGCCTTTCACCGTTTCTGTGACTGAGCT
ATCGTGTCTGTGATTCAACCTCCCAGCCTCAGTGTCCCCCCCCCCCCCCCCCATGGCGGG
TGCCACTGAGCTCTCTGCAGAGGGTGAGGTGTGGCCAGGCCCAGCTGGGCTCAGGCTTGC
CCTTGTGCCGGTGCCTGCAGGCTGCATGCAGGGCATGGTGCCCTACCTGCCCGAGCTGAT
CCCGCACCTCATCCAGTGCCTGTCGGACAAGAAGGCCCTGGTCCGCTCCATTGCCTGCTG
GACGCTGAGCCGCTATGCCCACTGGGTGGTCAGTCAGCCACCTGACATGCACCTCAAGCC
TCTGATGACAGAGCTGCTCAAGCGCATCCTGGATGGCAACAAGAGGGTGCAGGAGGCGGC
CTGCAGGTGACCCTCAAGCGCTGACCCCACGGCCCCCACCCCTGCCCCACTGGCCGCCTC
CTGGGAAGTGATGATACTCCCGACCCTTGACGTCACGCTGATCTCTCGCGTATTCGTACT
GGCTGATCCCGGGTGCATGCCCTCCCCACAACCCCACCCGGGGCCCAGCCCCGCCTGTGG
CCGCCCTCCTAAACCCCTTCCCCACTCCAGTGCCTTCGCCACCCTGGAGGAGGAGGCCTG
CACAGAGCTGGTGCCCTACCTCAGCTATATCCTCGACACCCTCGTCTTCGCCTTCGGCAA
GTACCAGCACAAGAACCTGCTCATCCTCTACGACGCCATCGGCACCCTGGCTGACTCTGT
GGGCCACCACCTCAACCAGCCGGTGAGGCCCCACGGCACCTCCCTCTCTTGATCCTCACG
CCCCTTTGCGTCCAGTGACCTGGCGGCAACCTCGTGTCGCCCGCCGGGGACGTGGCCGTG
ACCTCGAGAGGCAGACGGGAGGACCCGGCCCCCGCCCTCGCCCTGCTCCCGGTCTAGCGG
GGGAAACGGTTATGCGACAGTGTGGCAAGTGCTGTCCTGGGGAAACTCAGGGGCCTGCGG
GAACCAGGAGGCGCCGACCTGGGCTCCGAGGGGGGCGGAGAGGGGAGGCCGGGGCTAGGG
ACGAGAAGGGCCTGGGGGTCTGGCTGGATGGCAAGGCCCTGTAGGGCCCCGTGAGCCACA
GCAAGGAGCCCAGACCTCACCACTCAGCCGATAGGTGCCTCTGAGTCACGAAGAGCCCTG
CGGGTTCCAGGCTGCCACCCCCGTGTGGGGGGCCCCAACTTCACGCTTCCTTTTCAGGAA
TACATCCAGAAGCTGATGCCTCCGCTGATCCAGAAGTGGAACGAGCTCAAGGATGAAGAC
AAGGACCTCTTCCCTCTGCTAGAGGTGGGTGGGCTCCAGGCCCTCTCCCAAAGCCCTGCC
CCATCCTTCCTGAGTTCACCTCTCCTGCCTTCCGCCCGACCAGTGCCTGTCATCGGTGGC
CACCGCCCTGCAGAGCGGCTTCCTGCCCTACTGTGAGCCAGTCTACCAGCGCTGCGTCAC
CCTGGTGCAGAAGACCCTGGCCCAGGCCATGGTGAGCATCGCACCACCCCTGCCCCGCCG
CCCGCTCCTCTGCGGCTGCCCCAGCCCGGGCCCGCTCCCCTTACCCGCCTGCCCCATCTG
TGCCCAGATGTACACCCAGCACCCTGAGCAGTATGAGGCCCCCGACAAGGACTTCATGAT
CGTGGCACTGGACCTGCTCAGCGGCCTGGCCGAGGGCCTGGGCGGCCACGTGGAACAGCT
GGTGGCCCGCAGCAACATCATGACGCTGCTCTTCCAGTGCATGCAGGTGGGCGGGCCCTC
ACAAGCCTGACTTGCGGCCCGGGGTGTGCCCCGCGGACAACAGGAGAAAGGGACCCATAG
GGAAAAAAAAGCTTGTACTTATTTTAAAAAGTGATTCAAAGAAGACACGAGTAAAATCTC
GTTGAAAAACAAGGAGCTCCCGGCTGGCTCAGTCCGGGGAGCATGTGACTCTTGATCCCG
GGGTCGTGAGTTCGAGCCCCATGTTGGGCATAGAGATTACTAACAAAAACAAAGGTAGAA
AGAGGAGATAGGAAAGCATAAGCCCCTCCAACTTGACGTATGTGCGCACCCCCAGTGTCT
CCGGACGGGCAGCAGTTAACCCCTGCCCCTTCCTCTAGCGGTACCGTGAGCGAAGCCCTG
CAGTTCACGGGCCCCGAGTGCCCGTGATGGGGCCTTTAGCTTCCATGATGGGAAGTGGCA
GGGTCAGGCCGTTCTCCAGGGGCTGCTCCCCTAGCTGGCCTGCCGGAAGGGATTAGTTTG
GGACCCCTGCTGGTTGGGGGGAGGGGCATCTTGCCACGCCAGCCCTGCTCTGACCCCCCA
GGACTCCATGCCTGAGGTCCGGCAGAGTTCCTTCGCCCTCCTGGGAGATCTCACCAAAGC
CTGCTTCATCCACGTCAAGCCCTGTATCGGTATGACGCCCATCTTGTCACCCCCTTGACA
CCCCAGCCCTGGCCTCGAGTGATGGAGAAACGACCCTGGGAGGACAATGACCAAATCGGG
ATGTATTCGTACTGTCTGATGGGGTCTGCCCGGCCAGGCCCGGGAGCTCACCCTGGCTGG
CCCCCCTGCCCAGCACTCTTCTTTCTCCCCACCAGCCGAGTTCATGCCCATCCTGGGCAC
CAACCTGAACCCTGAGTTCATCTCTGTCTGCAACAATGCCACCTGGGCCATCGGCGAGAT
CTGCATGCAGATGGGTGAGTGTGCTGCAAGTTGACGGGCCCCGCGCTGCCACCCACATCG
GTCTGTTCCCTGCTGAGGGCAGGCCCCTGGCCGTGCCTGCCAGGCCCCTGGGGAGAGAGC
CCCGGTGCTCCTTGAGGATTGCCGCAGTTGGTCTGGCAAGAAGACCTCTCTGAGTGGTTT
CCGCCGGGAGACTCCCAAATGGCTGAAAGGCCGTCTGTGATTGGTCTTCCTAAAGAGGCA
GGACAGGCGGCCTGTTCTGACTGGACTTTTGGCGACCTCCCGCCCCCACGCAGTCGGCCC
ACTGGGATTGGTTGGGAGACTTTGGCGGCTTTCTCCCTCCCCACCTACCCCCACAGGGAA
TCTGGGCAATGCGGTCTCGCCCCGGTGTTGGAGCTGTGACTCCAAGGAAGCTTCTGGCGT
TTGGAAGGCTTGGGTCTGCCCCTGGTTGGCCACGGGTCCTGAGCGGGGGACCAGCTGGAG
AATGTTCTCCGTTCCCTCGGCGGTTGCAGGGGGTCAGTGCGTAGCTGCAGCTGAGGTCAG
CATGGGTGGTCTGGGCTGTGCGGGGCTCTGACTGACCGGTCCCCCAGGGGCAGAGATGCA
GCCCTACGTGCAGATGGTCCTCAACAACCTGGTGGAGATCATCAACCGGCCCAACACCCC
CAAGACGCTGCTGGAAAACACAGGTGGGCACCAGGCCTGAGCTGTTGCCGTCCCCTTACC
TGGATGGGGTTCCCAGCCGGGAGGGTAATGGGAAAGAAGCAGGGAAGGTTTCTGGGAAGA
CGTGGAAGGGGGTTCTGAGGAGAGCCCCGAGAAGGATGTGGGCCTCGGGGGAGACCCCGG
TTGGGCCTGTTCCCTTGGGGCCCGTGGGGCGGGGCTGGTGCCTCGTGCCAGAGGCCCCGC
CACGTACCGTCCCGGGGCCGCTCGGGGTTGCAGGTCGCCTGACGAGTCCCTCTGCCATTC
CAGCCATCACCATCGGCCGCCTGGGCTACGTGTGCCCACAGGAGGTGGCACCCATGCTGC
AGCAGTTCATCCGGCCTTGGTGTGTGCCCCCCTGCGTGGGGCCTGCGTACGGTGGGCCGG
GCGGCAGGGCGGGGGGGGGGGGGCAGGCCCGCCCCTAAGTGCACGCGTCCTGGCCCATCG
CCCGCCGAACCCTCGCTCCCGCCACCCTGCGTAGAAACACAGCGCACCCCGGCCCCACCA
CCCGCTGACCTGCCGCTCCCCACTGACCCCCCTGCCCCCCTCCACCACAGATGCCCATCC
TGCGCCGGCCCTGCCGGCTCACTGCCTGCTGCTCACCTCCCCCACAGGTGCACGTCCCTC
AGGAACATCAGGGACAACGAGGAGAAGGACTCGGCCTTCCGAGGCATCTGCATGATGATA
GGCGTCAACCCCGGGGGCGTCGTGCAGGTTGGGGCAGCTGGGCCTGGGGGGAAGGCGCGG
GGGCCGGGCCCGGCGGCCCCTCACACGGGACCTGTCTTGTTTACAGGACTTTATTTTCTT
CTGCGACGCCGTGGCTTCCTGGGTGAGCCCGAAGGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCCTCACCCCCCTGCCCCCCCGGCCTCCCCACAGATTCTCCACG
GCTTCAAAGACCAAGTCGGGGAGGAGAACTGGCAGCAGTTTTCTGAGCAGTTCCCGCCTC
TGCTCAAGGAGAGGCTGGCCGCCTTCTATGGGGTCTAGATGAGCCTCGCGACCGCCAGGT
GAGGAGGCTGCCCGCGAGGGCGCTGTGGCTGTTGTAGGGGGGCGGAGGGGTGCAGGCCCT
GACCCCCGCCTTTCCCCACAGGTTTCTGTCTGCGTCGTTGGAGGGGTTGCTGGGGAGCAC
GCTGCGTCCGGAAGTCGCCGTGCCCTGGTCGAGGGGGGTTAGGGAGGAGTGAGCGGGACC
CAAATCCAGACGCCTTCCCCGTCCACCTACCTGCCACGGGTGTGTGTGGCCTGCCGGCCA
GCGGGCGAGTGGGTGGGGTCTCCACACTCATCCTACAAACAGGGGAGGGGGGTGGGACTT
CTTGGCAGCAAGGGCCCTTTGCTCAATCGGGGTCACCTCGGGCAGCCCACCTGGGCCAGC
CTCGTGGGAGGGAAGATTCAACACGGCCGACGGAATCCGGCTTAGGATGAGGCGAGGGGA
AAGCAGGCGGGGAGGGGGGTCCTTGTAGAGACACGTACACTCACATGTACACACGTGGCC
ACACGCATGTGCGGCGCTGCAGCCAGCCAGGCTGGGCCAGCCGCCCCACCATTTCCCCGA
CTGCATGGAGACAGTAGAATTAGTGAACCCCTGAGTTAACCCGTAAGGCCTTCCGTGTAA
CCTGCATCTAGAGTTTAAGAAGCTTCTGCTGTTTTGCCGGAATTGGTGACTGGGGAGGGC
TGGGTGGGTTGGGGGGCCTCCGCCGGGACCCTGGGGCGGGGGAAGAGGACGGCTGTCTTC
AGGCCGCCCGAGTCAGCTCGCGCACGCTTCGGACCTGCTCCGCACACTTCCTGCCGGCTC
TGTGGCATCCACAGCCTGTGCGTCCCCCTCCTTGTTGTGTCCCAGCCAGAAGAGTGGGGA
CTGCCGGAGTGGCCGAGGCTGGCCAGAGGTTGCCCTTTCTCCCCCTCACTGTGCTCCAGT
GACTTTTGAAGACGCTGGGCCAGGACCTTTTTCCTGAAGAGGGCTGGGGGCAGCCAGAGC
TGCTGACCTCTGCTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 1717..1792, 1875..2024, 4511..4617, 4704..4837, 4931..5012, 5059..5067, 5170..5178, 5214..5332, 6405..6465, 6568..6621, 6624..6638, 7260..7410, 25580..25805, 26010..26181, 26637..26723, 26803..26910, 27007..27165, 27721..27808, 27995..28093, 28667..28762, 29013..29118, 29387..29486, 29566..29613, 29750..29857
1001..1099, 1717..1792, 1875..2024, 4511..4617, 4704..4837, 4931..5012, 5059..5067, 5170..5178, 5214..5332, 6405..6465, 6568..6621, 6624..6638, 7260..7410, 25580..25805, 26010..26181, 26637..26723, 26803..26910, 27007..27165, 27721..27808, 27995..28093, 28667..28762, 29013..29118, 29387..29486, 29566..29613, 29750..29854
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved