Felis_catus Locus Q670L1_FELCA
snOPY snoRNA Orthological Gene Database
Felis_catus Q670L1_FELCA
Felis_catus
Q670L1_FELCA
GeneScaffold_1009
SNORD14, SNORD14, SNORD14
2712..2799, 3140..3225, 4029..4117
5439
TGGGGTGGGATGGGGGCGGGAGTGGGCGAGGCCCGAGGGTAGAGCCGGCTTAGTCATTG
GGGCTCACAGAGATGGCCGCGTGCCCATTGGTCGAGGAAGTCATGATGGGCAGCCGGCAG
GGGTGGGCCCCTTCTGGAAGGTTCTGAGGCAGGGTATAAGAGACAGGGTGGCGGGCGGAA
ACCGGCCTCATTCAACGCGGCGTTAGCTCTCCGGATAGCTGTTTCTTTGGCAAGCGGGGC
CGGGCCCATATTGAAGGTAAGGCCTGTCTTCTGAGCTTTTGGGAGTTTCTAAGAAACGTG
CAACCTACCACCGGGCTGGTCGGGATTGCAGGGGCCCAGAGGCTTCTGATCATTTTCTTG
TAGGTGGGGGGCCCCCCAGGCCCCTGCCTGCCTGGGGCGCGCTCCTTACGGGGAGGCGGC
GGACCCGGCCTTGCGGGCAAGCGGGACGTGGGCTGCAGGCCGTGATGGTCGCCGCGGGGT
CAGGGCGGTGCCCGCGGGGAGGGCTGGGCGTGGGCCGCATCCGTTTGCGGGGCACTGGGA
GTCCAGCCGGCCCCCTGGAGCGGACCCTTCCCTAGGCTCTCAAAAAGAGGAAGCCGCTTT
TGGCACGGGCCCAACGTGGGGGGAGGGGGCTTCTGAGCACGCCACGCAGGCCGTATTGTG
TTGGCTCCGGAGCATGGGGTGGGGGGGTGGGGTTGGAGAAGGTTGCGCTGAGTCGAGGCC
ACGTGCTCCTGTCGCAGACCCTCCGGGCAGGTGCTTGATTCAGGGCCGGGCTCGCCCGCG
GTTGGCACGGTAACACCCCGATTGCAGCATTTTTCGCTCTGGCCCTCCCGCGTGGTTTCC
TCCGACAAGGGCAGTGTTTCTGGGGGGAGGTGCTGAGTGTAATCTTCTTACCAAAGTGTC
CATACCTGATAGCTTTAGGGGCAGGAAGCGTTTCCAAGTGCTGGTGTTTTTTTGTTTGTT
TTTTTTTTCCAAACCCTGGGCCTTTTTTTCTTTCAGCAACTATGTCTAAGGGACCTGCAG
TTGGCATTGATCTTGGCACCACCTACTCCTGTGTGGGTGTTTTCCAGCACGGGAAAGTGG
AAATAATTGCCAACGATCAGGGAAACCGAACCACTCCAAGTTATGTCGCCTTTACTGACA
CCGAACGATTGATCGGTGATGCTGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAG
TTTTTGGTAAGCTGTTAATTTTGAGCAACATGCCTTGAGTTTTAAGTGGTGTAGACTGAA
TGAGAAAGTTCAAAGTTTATCAATGTAAGGTAGCCATGAAAGTTTTGAAAATAGGAAAAG
CTTTTTTAAGAATTTACCTGGTAATTTTGTACTCTTAAATGCTAAAAATAGGGTATCAGA
TGAGGAAATCTGAGCAATTCTGCCAGAGAGAACTTGAGTCCATTTGACTAATCTGGAGTT
CGGTTGCTAGGTCTCTGATCTTCACATTTCAGTAATGGTGTACTAGGGTTCTTACTTGGT
AGATGCAATGTAACACTTGACCTGATAAACTTTTACAGATGCCAAACGCCTGATTGGACG
TAGATTCGACGACGCTGTTGTCCAATCTGATATGAAAGCATTGGCCCTTTCATGGTGGTG
AATGATGCTGGCAGCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCAGGGCCAGTATTGAGATTGATCTCTGTATGAAGGAA
TCGACTTCTATACCTCTATTACTCGTGCCCGGTTTGAAGAATTAAACGCTGACCTGTTCC
GTGGCACGCTGGACCCTGTAGAGAAAGCCCTTCGGGATGCCAAGCTAGACAAGTCTCAGA
TCCACGATATTGTCTTGGTGGGTGGCTCTACGCGTATCCCCAAGATTCAGAAACTTCTAC
AAGACTTTTTCAACGGGAAGGAACTGAATAAGAGCATCAACCCTGATGAGGCTGTTGCTT
ATGGTGCAGGTAATAATCCCACTATTCGAATTAAATGGTTCTAACAGGTGGTCTTGAAAG
CCCCACGCTGACTCGCTATGATGAGTGATTCTTAAACATTCGTAGTTTCCACCAAAAGCT
TAAGCTGATGATGGTCTAACTTCCTTGGATGTCTGAGCGATAGACGTTTGCTAGGTAACG
AGGTTGTTTTTATTTTATTTTTTTTTTAACTAAATGTTTTTGTTTTAGCTGTGCAGGCAG
CCATCCTTTCTGGAGACAAATCCGAAAATGTTCAAGATTTGCTGCTGTTGGATGTCACTC
CCCTTTCTCTCGGCATTGAAACCGCCGGTGGAGTCATGACTGTTCTCATCAAGCGCAATA
CTACCATTCCTACCAAACAGACCCAAACCTTCACTACCTACTCTGACAACCAGCCTGGTG
TGCTCATTCAGGTATGTTTTACTGTAAAGGTACCGATTCAGTTATGCTTCAGGTCCTATG
AGATTTTGGGAAGACTTGTCCTGCTATGATGATCGATTCCAAAACCATTCGTAGTTTCCA
CCAGAAGCCTTGTGTTGGCCAATTCCTTCCTTGGATGTCTGAGCGAGGTCTTTCCTGGTT
GACCTGAACGTCTGTAAACTGGTATGCTGTGATGCTTGCAACTCCTTAGTAATTCTCATT
TCCTACCAAGGTTTATGAAGGTGAGCGTGCCATGACCAAGGATAACAACCTACTGGGCAA
GTTTGAACTCACAGGCATACCTCCTGCCCCCCGTGGCGTTCCTCAGATCGAGGTCACCTT
TGATATTGATGCTAATGGCATTCTCAATGTCTCTGCTGTGGATAAGAGCACAGGAAAAGA
GAATAAGATCACCATCACAAATGACAAAGGTAGGCCCAACTTTGGCACTTTTTCCTTTGT
CTTAAAAGATCTGGTCTGGGGTCATAGGGACCATAGATGTTATAAAATCTGTCTAAGGGC
ATTGAACCCAAGAGCTCGCTTCTAATGGGCTTTGGAGCATTAACGGTTAAGGTTGGCAGG
ATAACTGAAGGTTCAATGTCAAAAGTCCTGTCTAAAAGACAGTTAACTTCCACAGGTCGC
TTGAGCAAGGAAGACATTGAGCGCATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGAT
GAGAAGCAGCGAGACAAGGTGTCCTCCAAGAATTCCCTTGAATCTTATGCGTTCAACATG
AAAGCAACTGTTGAAGATGAAAAGCTTCAGGGTAAAATCAACGATGAGGACAAACAGAAG
ATTCTGGACAAGTGTAATGAGATCATCAACTGGCTGGATAAGAACCAGGTTTGTAATTTC
TAATAAATTCAGAGTGGAGAGGGTATGGGGTTTCAGCAAGGTTAGATGGGATTTTACAAT
ACAAATCGGTCACAATGATGAATGGTCCATACATTCGCGGTTTCCACCAGAACTTCAGAT
GTTGGCAACTTAGATTCCTTCCTTGGATGTCTGAGTGACCCAAGAGTTCGTTGGTAATTA
AGACTCCTATGTGGTGGTAGGTTTTTGCATTTTAGGAACATCAGGTTGACTTGGTGTAGG
AAGTTTCCTCCTTTGAGGAACCTGTAGTAAAGAATCTTGTTTTTTCTTCTTCAGACTGCA
GAAAAAGAAGAATTCGAACATCAGCAGAAAGAGCTGGAGAAGGTCTGCAATCCCATCATT
ACGAAGCTGTACCAGAGTGCAGGAGGCATGCCTGGAGGAATGCCTGGAGGCTTCCCTGGT
GGTGGAGCTCCCCCCTCTGGTGGTGCCTCCTCTGGGCCCACCATTGAAGAGGTTGATTAA
GCCAACCTGAGAATAGGTCTAGCATTGTTCCACACAAAACATTTGAAGGACCCAAATTTG
TAGCAAATTCCACGGCAGTGAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGGGCTGGATGGATATTTATTGGCTACTGCAAATCACAAAATAGTATTGGGTAGT
TATATCTTTCAAAAGAGGCTCAGGTTAATGAATTCATGTTAATGTTGTATTTGGGGTTTG
AGATGAATAGTAAAGTGAACTTTGAATTTGCAGATTTTTCAGTGTTGGGAGAACTGTTGA
TGGGAAGGAAGTTTTGAAAATGTCTGAAGGGGTTTTTGTGCTTGGATGGTCAGTTTTTGA
ACAGTGAAATAGCCAGTCCATGGAAGTAGCATTAAGCATGTGAAACTGACCCACATGTGG
AACTGTAAAGCCCTGCGCCAGCACATTTGATAACAGTTCTGTTCCTTTTTCTCAACTTGG
CTGGGTGGGAACTTGAAGGGGGTGGCAATGGAGTTTGAGGAAGGTAGGGTTTATTTACCC
ATAGAATCAAACCATGAGCATCTAATTCTGACTTTAATATCTAAACACCGATTAACCTTC
AGGGACTTAGCTGAACAAACATTGCTACATTTCCACTTAAATCCACTTAACTGGATTGCC
TTTATGTGATCCTGGTTTTGGAGCAAAGCTGTGCATTCGTGGCCTTGGTTCTTGAGGAAT
GTTAGCCAAGGTGTTGGGCTACACAAAAAGTGCTGCCACGAAATTTCAGTCCCAAAATGT
CCTTGTGTGCAATGTATAGCTCTGTCCTGAGAACCCTCAAGTAAGGGAACAGGTAAAGGG
ATTGTTACCCACGGTGCCTGGTGACATACCTGCCATCTGGTGGTCCGTTTAGGAGAAACC
CTTCTGTGTGTTGGCGAGGTCTTAATGCTCCCAGTGGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1538..1596, 1598..1609, 1611..1634, 2364..2384, 2387..2648, 2868..3070, 3310..3508, 3715..3947, 4254..4439
1001..1205, 1538..1596, 1598..1609, 1611..1634, 2364..2384, 2387..2648, 2868..3070, 3310..3508, 3715..3947, 4254..4436
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved