Felis_catus Locus UBAP2L
snOPY snoRNA Orthological Gene Database
Felis_catus UBAP2L
Felis_catus
UBAP2L
GeneScaffold_2204
SNORA58
45778..45913
56933
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GGGGTTGCATGCAATTTACATATTGTAAGGGAGGTAGGGCTGTTTTCATAGGTAGATTGA
GTTTCTCTATTTTAAATTGTTTTTATTTGTTTGGAGTATAGATTAAGTTCCCTTCCTGGA
AGGCTTTTGTTTCCAGGTTTTGCTGATTAGCTTTCCTTTTGTCAAAGGGGCTTTAGATAT
TTGTGTGTAGAAAGCTTTCGATTATTAACATTGTTTTGCGAAACTTCACAAAGCTGCATA
TAGGGACTAGTAACCAAACCATGCGCATGACTTAAACCGGCAGTCACCTATGCTTTATAT
ATTTCTTCTATAAAAATGGACTACTAACAATTGTTCCTTAAGGAATTTATCAAATTGAGT
ATGTCTCAAGAACAGATGACTCTTCTTGGTTGGTGAACATGTTTGGTGAAGGTGCTGATG
AAAGAGGTTGAAAACCTGTTTTGCCCATATTTAATATCTGAATTTTTTTTTAATCTTTCA
GTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACGTCGGTGGGCA
CGAACCGAGCCCGGGGAAACTGGGAACAACCTCAGAACCAAAACCAGACACAGCACAAGC
AGCGGCCACAGGTAAAGAACCCAAGGGATGCATTGCCAGCATTGCTGATTGATACTGGTT
CCCATCCAGCGCAGCATCATTCTCTGCTCTGGATTATTGGTTTGCATTTTTTATTTTTTT
TCTAGTCCTGCCTCTCCTCTTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGTGACGTCAGGCTGGCCCCTTTCCTCGTTCTCCCGCGATGGCAGTCCAGCGTGCG
TCCTCCTGGCTTTGGACTTAGCTGTGCCACAAAGCTAGGCGGTAGCATCGAGGCTGCGCA
CTGCAGGGGAAGCCTACGCAAGTCTTTCTCCGTGGATGAAACCCCACGTTCAGCAATTAC
TTGCTGAGAACACCATGAACCGTGACCTCCGCCAGGCACCGGGACACACAGATGGCGACC
TGCTGGCGACCGGGTTCTCCCGGGAGAGAGGGGCTCTGAGAGGCAGGTGCTGGGCACGGA
CACGAGGGGAGCGAGGACTAGTCCGCGCCCCGGGACTGGAGGCCGGGTCACCTGCAGCCG
GACGCAAAGAGCCACTTGACGAGACCCGGTACTGCTCCAGTGTAATGCTGAAAACCTCAG
AGGCAGATACACTGGGCAAGTACTGGCAGCAGTGAAGAGCTTGGGACCCCGGCGGACTCT
GCAGGGCAGTGAGGGTGAGGCTTCAGGTCACTCTTGCGAGAACTCACCATCAGCAGCTGC
TTGTTGGCCAGTGCCAACTCCTGTCCCCTGGTGTCCTGCGTCCTTAGGGCAGCATACAGG
TTTCTCCTCTGGCCCAGCGGCGTCTGCCACATACAGTGGGTGTGTGAATTCTGCCACCTG
CCCCAGGTACAGAGGAAGGAGCTGACTGGGTCAGTTAGGAGTGGTGACACAAACCCCATC
ACTGGAACCTCTGTGCCCATGTCAGAACACGGGCCAGCTCCTTGAAGGGTAACTAGAACT
GAGAACCTAGTATGCGTTGAATACACAGGACGCTGAATCATCATAACCGTGCATCAGAGA
TACTAATTTTGCACGGCACACACGGAAACAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGTCCGA
CGCTCAACCGACTGGGCCACCCAGGCGCCCCAAACTCTTTATTCTAAATAAAAAGTTTTT
GGGGCGCCTGGGTGGCTCAGTCGGTTGAGCGTCCGACTTCGGCTCAGGTCACGATCTCAC
GGTCCGTGAGTTCGAGCCCCGCGTCGGGCTCTGGGCTGATGGCTCAGAGCCTGGAGCCTG
CTTCCGATTCTGTGTCTCCCTCTCTCTCTGCCCCTCCCCCGTTCATGCTCTGTCTCTGTC
TCAAAAATAAATAAACGTTAAAAAAAAAAAAAAAAATAAATAAAAATAAAAAAAATAAAA
AAATCCTGGGGCACCTGGGTAGCTCACTGGATTAAGAGTCCGACTCTTGATTGCGGCTCA
GGTCGCGATCTCACGGTTTGGGGGTTCGACCTCGGTGCGGCTCTGCACTGACAGCGTGGA
GCCTGGCCGGGATTCTCTCTCCCTCTCTCTGCCCTACTGCATGTGCTCACTCTCTCTCGG
GATAAACAAACAAACAAACAAAATATATATATATACACCAAATGAAAACTGAAAGCTTTG
TTCTTCTGCCCCAGTTCTCAAAGTTACCAGTTTGTGTATTTTTCCAGAAAGTTTTTCTAT
CATATACTAGGAAGTATATTTTTTTATTACCATGCACTCATACATTTGTTAGTAGAAGTA
GTTAACAGTTGGACTTTCCCATCAACACATACACACTTGCTTCATTCTGTGTAAAGGCTG
CCTAGTATTTTTATATCATCACTTAACAAGGTAGGCTGTTCCTAGTTTTTAAAATTTAAA
GTAATCTCTCCACCCAACAGGCGGCTGCAACGCAAGACCCCGAGATCAAGAGTCACTTGC
CCTTCGACTAAGCGCACCAGGTGCCCTGGTTTACTTTTGTAAACAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTTCATTTTTGCTGGTGCTGCTTGGAGGTCACAGACTCTTTTAA
GCTATTTTTCCCCACACCCTCAGAACCTTTAACCCAGCTGATTACGCAGAACCGGCCAAT
ACCGATGACAACTATGGCAATAATAGCGGGAATACGTGGAACAACACTGGCCACTTCGAA
CCAGATGATGGGACGAGTGAGTGACTGCTTATTGTTTCTGGTCTTTAAAAACCTAAGGAA
ATAACTATTTTGAGGTTATGGTCATATTAAAAAGTGGAGGAATAGTTTTTGGTGCAGAGA
TAAGGGAGGAAGGGATGGCGATCGAAATACTGTGTGTTCTCCTTGCTGTGTGCCTGTGGG
CACTTTACACGTGCTGGTTCTCTTGGTCTTCATCACTCACCTGTGAAATTGACACTGTTC
GTCATCTCCACATGCCAGACCTTACACTCAAAGGGTGGTCATGAAATTTGCTAGTATTTG
AACTCAGAATTGTTTGACCCTAAGAGCCCATGCTCTTTCTGTTACACCGTGTGGCTGCCA
TTAGCTCCAGGTGCGTTTCCTAGTGTTTCTGTTAGGGTTTCTAGCTTTGCCTTTTGGAAA
AGTATTCTTAATTAGTTAATTAGTTAATTATGTCACCACTTGTAGAGATGAACAAGGCCC
AGAATCAAAGCCCACTGTCAGTTTGTTTTCTGGCACTGAGATAATACCTTTTTTACCTTC
ATTTTTGGAAAAATCTCAGTATCTGGGCAAGAAGGAAGCCGCAGCTTTCTAGCTGTTTAT
TGAATAGTTTTCTGGGTGTGGAAGAATATTATGGGATTTGAATAAGGTTGCTTTTTTGGT
TAGCTGACTTTTGGTGTTTGTGTCTGAGTAGGCTATATATATTTAAGGCTATGTTAGGCT
TGTGGGACAGACAACCCACAATGTGTTTGGGAGTGAAAGATACTTTTACCCCTTTAAGTA
AGAACAGTCCCTGGGCTGCGGAGTATTGTATTCTCACGAGATTCCCTGCTTCTTTGTGGC
TGAGCCAGCACAGGAAGAACTTGAGACTTTTTTCCCTTATAAAGGGGGGAATGAGTTAAT
AGTAGAGTGTGAATTCAGCTTTTTAACCCCTTATCTATTTATTTGCTTTGCCCCTTTTCA
AAGATCATTGATGTTTCTCTCTCTCTTTAGGAGGGTCTCTGGCACAAACAGTTCATCTAT
TGCCCACAAGACGTTATACCTCAGGTCCTGAATGTTATGTGCTTTTAATTTACCAGCTAT
TCTACAAATTCGTTTTAAATACAGTTATCCCATTGATGGAGGCTGAAGTTGAGTTATTGA
CAAGATGGAAATCTGTTTTAATTCCCGGACCATTTGGCTATGAACTGTCTTTTTGTTATT
TTAGGAGGTATAACGCCACTCTTGATGGCTTGTAGAGGCAGTGTGGTAGCAGTCTGAATA
CCAGAAGTGACTGCTTTTGAGCACTAGTTTTTGGGTATTTGGCTTTTTTCTCATTGGCAG
AAAAGATAATAGACATTAAGGGATTTGTTTTCAGTTGTGGATAGAAAATCAGGCATGGAG
TCCCAGTCCTAGATTGCAAGCCTTAGCTGTTTTCAGCAAGGATCTGGTTTGGAAAGCAAG
GAAGGATGAGGTGTGTGTTTATTTATACTGAGGAGAGAACAGCAGATTTGGGAGGTTAGA
ATCCGAAATCGGATTTGTGGCTGAATGAAAAGCTGTGTGATGCTGATCTCGTCTTGTGCG
TGTGAACGTGTTGGGTGTAGCTTCATGCATTCCTGCTGTTGTTAATTTCACAATATGAAG
TGACATTCATGCATGATCTCTTTTTGTGTTTTCATGATAGCAAACTTCAAATTCCCTTTT
TTATTTAAAAAGAAATTGAAACCTACCCTTAAAATATCCACAGGTACAGTGGGAATTGTT
TTGGGGCAAATGTTCTCATTCAGAAGCAAAATTTCACTGCTTGTGTTCTTTTTCTTTTTT
GTTTCAGGACTTGATTTCAGTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACT
GCTCCTGGTATGATACATCCAGGTGCCTAACTGCCCCGGATATTTTTATAGATTTTTATG
AATTGGAATATCTGTGGATATGTCATTTTTCTGTTTCCCTGCTTTTTTTTTCTTTTTCTG
CCTTTTTTTCTCATAGTCTGTACCTGTTTTTTCTTAAAAATTTTTGATCATTTAATGACT
AACATTTACATTGACTGCTTTCTGCTGACAGAATGGAAACCCTTACCTATCGCTCAGAGC
CTTAGCACTCCTACTGTTCTTTCGTGCCTTTTCAGTACAGCCTTCTTGGCCATGACTGTG
CATCTTGTCTTGGATCAAGTAGGCATCTGCATTCTTCCTTTGCGTCTTAGACTAGTCACG
AGAGTGCAGGAGAACATTGCTGCCTTGACAGAGAGCCCGTCAATAGGAGATAACTTCTCA
GGTCACTTCCAACTCCAGGATTATGTATATGTGTTAACCCAGATCTTGGGTTCCATTTAT
CCAAGGCAGGTTGGATGTCAATGGAGAGGAAGAGTAGTGTCACCAAAGAGGGAGAGAAGA
ATATGGTTTGTAATTTGTCTGAACTGAAATTGGACTTTAGTGTGATTTGGAGAACGTTGC
CATTATTAAGTGGTTCGGAATTTCCCTTGTGCGGTTATAAGTGGTCCTGGAAGAAGCATT
ATAATGACTATCTTTTTCTTTATGAAATAGGGTTCTAAAGATTTTATTTTTAAGAAATCT
CCACACCCAATGTAGGGCTTTGAACTCAATCCTGAGATGAGGAATCTCTTGTTGTACTGA
CTGAGCCTACCAGGGGCCCCTAGAAGAATTTCATATGGGAATATAGGTATTAGAATATTT
CTCTTCGGTGACAGTGAATATCTGAATGCCAGATTTTCATTCTTTTTTCTTTTTCTTAAA
ATTTTTTAATGTTTATTTCTGAGAGAGGGAGAGTGTGCATGAGCAAGTGGGGGAGGGGCA
GAAAGAGGGAGACAGAACCTGAAACAGGCTCCAGGCTCCGAGCCATCAGCACAGAGCCCG
ATGAGGGGCTCAAACTTGTGAACTGCGAGATCATGACCTGAGCCGAAATCGGACTCCCAA
CCCACTGAGCCACCCAAGAGCTCCAGACTATAATTCTTAAAAGAAGTTTTCTCCATTTGG
AGAGAAGGCTTGAAGAATTGATCAACATGTACTGTTGTTTTAGAGAAGAAAATAAGGAGT
GTTCTTGTCCTTTGCAGTAGTCAGGTGTTACTTCTTACTGTGGTCCTTCAGTTGAAGGGA
AGAATCCTGCTTCTCGTAGAACAGTTTCCTTTTCTGAGGATATACGTACACATGAAGCAA
AACAAGGGGAGTGTGGAAGGTGGTTTTACTGCTGATGGAACTTGCCTATAGAAACCATCC
TGACTTTGTTATGACCAACATGGGGCGAGTATACGACTGCGTTGTCTGCGCTGTGCCCTT
GGCAGGTTAGAGGTCACGTTCTGTAGGATTAGGACTAGGATAATAACAGACGTGTTTGCT
TTTTCAGTTTTGTTCAATGTCTTCTGAAAAGGCGTGGAAAAGAACAGACTCATGAGGGTT
TCTTACGGTTTGACCAGTGAGATCGATACACTTGACTTCTGCTGAGTATGCATTTTTACA
TTGAGTTCTGATAGCAGGTAGTTGTCAGTGCCCGCAGTTTGGAAGCCTGTCTTCCGCTGC
CCTTCCACTGCCACATGGCAGCCATTCGTGTTCCCCCCGTCACCGCCACTCTCTCTCTCT
CTGCCCGTCGTGCTGTCTCCTACCAGGTGAGAAGGCGTAGTGTACGTTCTGGTGTAAATT
GGCTGCTGCTGTCACTTGAGTTGACCACTAAGGCAGAGGGCTTGAGGGGTCTTCAGAGGT
TGCCTGGAGCATTGGACCCGTTGCCCCTCGCTCCCCCACTCCCCACTATCTCTGCTGTTA
AAGCTGCGTAACAAAGCCTGGAAGTAGGTGTGAAGTCATAATCTCATGAAAAACCCTGGT
CTTCTGACGTATCCCTTTCTAAATAGTCTTTTCCTCCCCCCTGGAACCTAGGAATCTCTT
TTGATTACTAAAATCTGGTTACTCTTTCGGCTGCCGGAACTATTAATACATTAGTGTTTT
TGCACATGCTGTGTACTGGCACTTAAGTTACTTCACTGTTTTTCCTTTATTGCCAGGTGC
GTGGAGGACCGCGGCAGAGGAGTGGGGGACTGAAGACTGGAATGAAGACGTAGGTATTCC
CCAGTCACTCCTCACTAGTGCTTTCTATCCCTTAGTGGTGTTTAGGGATAGAAAATGGGT
ATATTTCTACCCCTTCAAAATTCACCCTTAAGATTCTGACCCAAAACTTTTACATCCAAA
ATAGTGTTCTGAGCCAGAACATTTCACATATGTTATATGAAGGAGACTGGGCATGAACAG
GACTCTATGGAACCAGACTATGGAAAGGGCAAGTGCACCTGTGTAAGTCCAATATCTGAT
TGTCGGATTTATCCCAGCAAGAGATGGTGGTTGGGTAGAGCACCAGAAATGGAGTTAGGC
AGGTAGTGCCTTGAGTAACAGCTGCTGGTAGCCCATGACTTCTCTTGAGCCAGTTCGGCT
ATTTAGTTCCTATTCGGGCACTGGTGTTTGGTCCTGTGATTGGCTTAGAGGTGGGTGCGA
AGTGAGAGAGTACCGCGTCCTCGAATTCACAATCTGGTTGGTTCTGAAGCCCAGCTTCAT
AGTTGAGATGAAAGTATAGATCTTCCAGCGTGACTCAACGTGGACAGCTCAGTCATGGGT
GTCACAGAGGTGGCACATAAGCCAGCACTCTGAGCTCACTGGAGTAGCACTTGAGTAAAA
GAATTCTGCTCGTTCTTGGTCACAGTCAGGATTTTGTTGTGAATTGTAGTTTTCAGTGAT
CATGGATTAAATCCTGTTTTAACATTTTTTCAGTCTGCTTTCTATACTTACATATATTTA
GGCAAGGCAGCTTTTATGGTGACATGGTGACCAAACTTTGGGTTTGCCAGACCTGAGTGT
TTAAAATTTCAGATGCATCAGCATTAGAGGATGATTTCTTTTCTGTTGTAACTGAGCTAG
ACTGCCTCGTGAATACTTTCTAGGATTTGGTTTGGTCTGTTTAGCAACTTTCAGAGAATG
ATATATTTGGGGAAGTGGATTCCCTGTTTTTGGAGAAGAGATTTTAGTCAAAAAGTGAAA
ACAAAACCAAAGCACGTTTTGAATGGTGGAATGAGCTATTCCCTACAATTGTTTACCTAA
TTTTAGGGTCTTAGAATGCAAAGGGTAGGTGTAGTAAAGTCACTATTAAGGCAAAAATTG
CATATAGTTGAAATCATCCCTACAGAGACCCTAATTCACCAGCACTTGGGTCCTTACTGC
TCAAAAGCCAAGAATGAATTTCTTTCATTTTGTCTTTGTCTTGGCTGTAACCTTTCTTTG
AGAGGAGCAGTGGAAGATAAAGTTTGGTTTGGGTAAGGGTGTGAGTTGGGAACTCTAATG
GGAAAGTATAAAAGGGTTTTCTCTCTTTTTTGTAGCATGTGTATTCAGCTTTCTGTAAGT
TCAGTGTGCATAGCATGTGACTCCCATTGTATTTCATAGGCTTTCTTGATTTTACACCTT
TGATAAAGTCATATCTAGAAGGGGAATGGAGGTCAGTCCGTGTAGGTTCCTCCGGCTAGG
TGGTTTTCTCTTCTGAGCGTTTTTCCTTTTCCTTGGTGTTAAGTTCCCCTTACCTGAGCC
AGGTTTCTGACTGTAGTCCACTTAACACCAGAAGTGACTAATCCTTCTGTTTTCCAGCTT
TCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCGGAGAAT
GTGACAATCACTGCTGGTCAGAGGCAAGTGTGTGGTAAAGTGCAGGGTCCTTTCCCAAAT
GGGCCTGGTGAGAAGGGGCTGTAAGGAAGAGCAGCAGTGGGCCTTCTCGAGCTCCCATGG
TGCTGGCAGTAACGGGAAGCAAGCATGTGAGGCTGATCGGGTTATAAGAGTTGGTCTACT
GAACGGGAGTCCATTTTTTACAATTTTAAAGATGATTCTTTCCAAAATAGCCCCTTTCAT
TACATAGGTCAACCTGAATTAAAACTTAGCACGATTGAGCTTGTCTGGTAGTAAGGTAAA
GTTAAACATGGAAATGTTTTCATTTATTTCAGTTTGCAGAACTGTTCAGTAGCTGCTTCT
CTTGCTTTATAATAATGATCTTTGTCTGCCAAGCCTACTGAGTAAAATGGTCATTTTTCC
CCTAGGATCTGGCTAATGAATTTTTTAGAACTTGAACCTTAGTTATTGGGTTTAGTAGAG
GGAGGTGCACTTACTAGGAATATTTTTATTCCCAGAAAGCCTCTTGGATTATTTCTAGAC
CTGGGTATGATAGCTGATAACTCAGAAGCCCGAAGCGTGCTAGGAATAGGACATTAGGGG
CATCAGAGGCGATGTGTGTTGTTTTTCTGACACCAGTATCTCATTTTACTGACATCAGTC
CTTCAATTCTCTGAACACCGACAAGGTATTTAGTAATTCAGTTCAGTTCTGCCACTTGCC
AGAGTTAGCACAGACCCTGATTGATGCCTCCATCCCAGAAGACTGCCCTTGCTTCCGAGG
TGTGAGGTCCACTGCAGATGAGTGCCCAGGCTGCCCACACCCTTCTGCCTGGCGGACTGC
AGATTTGGGGATTCTCACAGCCTACCCCACCCCTCACCCCCTGCTTAGGTTCAGAAATCT
GCTAGAATGACTCGGAACCCAGGGAAGAGTTACTTGCCATAACTGGTTTGTTATAACCAG
TACTCAGGTACAGTGGCCAGTTGGAAGAGATGCACACACAGGGCAGGGCGTGGGGTGCCT
TCCCAGTACATTCATCAACATTCAGTGCATCCACTAACCCAGAAGCTCACTGAATCTCCC
TGTTCTAGAGTTTTAATCAAAGTTTCATTACTTAGATAGGCCTGATTGACTAAGCCATTG
GCTGTCGAAGGCAGTCTCCAAGCTCGTTCTGATTCTAGAAGTGGGTAAAGAGAGAGTGCT
GGGGCTGAAAGTTCTAACCCTCTAATCCCATTGCTGGTATTCCTGGTGGCAGCCCACTTC
CTGCAGCTCTGGGGGGGTGGGGCTCCCACCCTGAGTAACCTCGTTAGCGTGGACTTTGGT
TGAAAGAGGCTCATTACGAATAACAAGAGACACTTAGGAAATTTTAAGGGTTTTAGGAGC
TCTGTGCTGAGAACTAGAGGCAAAGCGGAACTATATGTGTGCTCCTTAGACCACAGGTGA
CTTGGGAAGTTCTACGGAAGTTTGGGGGTCAATTCCAAAGATACTTGAAGGTGCCGGTGC
TCTGGCAAGTTTTTGTGTATTAGGTATTGGTAATGGCAGGTATTCATTATTAAAATATTC
ATTAAAAATTTTGTAAATTTTGGCCCCAATGTGAAGCTGTTGCATTAAAACTAACATTTG
CTATTCCATTAAATTAATTTAACTAAATTGAAATATTTAACATTATGGTTGACAGTGCCA
TTAGAACACAGCTAGATCCTGTAGTGGTTCTCACACATCATTTATTTTGGTCAATTAAGC
ATTTCTGGTCTTTGTGTTTTTGATGAGTGACTTTATTTTGATCTGACCATACTCTGGGAG
TTGGGAATGCTAGAATGTTCTGTCATTATTCATGAGTATATTCTGTCTCTCCACTAGAAT
CGACCTTGCTGTTCTGTTGGGGAAGACACCATCTTCAATGGAGAATGATTCCTCTAATCT
GGATCCATCTCAGGCTCCTTCTCTTGCGCAGCCTCTGGTGTTCAGTAATTCAAAGCAGAG
TGCCATAACACAGCCTGCTTCAGGAAACTCATTCTCTCATCACAGTATGGTAAGTAAGAG
ACCCAGTGCCCTTTAACTCCGGCACGTACATGGAGTACTGCCTTCCGGTGACAGGTTTGG
GGTGGGGTAAAACATCCCCTTTAAGTAGCCTTAAGTAGCCCCCACTAAGTAGCCTTGGTG
GTAGGGACACAGAGTTGGGTAGTAGGGTGCTGTGCAGTAGGAGGACTTAGTTTTGGACAG
ACTGAATCTTCTTCTAAAAGTGAGTCCATATCACTTACCAGACACTCACTGTGCCAAGTG
TTAATTTACTGTTGAAGAGGAAAAAAAATGACATCAAATTTTAATCCTTTTTCAATTCTA
GTTAAACTTTGATGGGAAGTTGTAGCACTTGCCTATTTCTCGATAGCAGAATTGCCATAT
AAATCTGTTTAAACCAGATGTTTCTGGACTCAGCTTCCAAAAACTTGGGGTTTTACTGAA
TGTTTCTGTTTACTTGCTGCCCCTCCCCTTCTCTGTAGGTGGGGATAAGAGCGCTTGCTC
TGCCTGCCATACAGGGCTGTAGGAACATGAAATAAGATTGTGGATAAGGCCACACAAATG
GGGGAGCAGCAGTGGTATTAGTTATTAACACCTAGAGTACTTCAGGCATGTGAATTGTTG
ACTCAGTTAAGAAATTCAAGGTCGTTAGTTAACGACCAAAGCAAAGGAATCATTTAAGGG
TAAACAGTGATGCAAGGACCAGTGTTTTTTTTTTAACAAATCATAAGAAAAACTTTCTCT
TTTTTTCTTTTTGCATATAATTTTATTTTTCCAGTAGTAGGATTATAACGATTACTTCAT
TTTTATTATTTTTAAATGTCTGTTTATTTTGAGAGAAAGTGCACACGAGTGTGCAGGGAG
GAGCAGAGAGAGAGGGAGACTCCAAGCAGGCTCCACACTGTCATCGCAGAGCTCAGTGTT
GGGCTCGATCCCATGACTTTGAGATCACAACCTGAGCTGCTATCAAGAGTCAGATGCTTG
AGCGCCTAGGTGGCTCGCTCAGTTGAGCGTCCAACTCTTGGTTTTGGCTCAGGTCCTGAT
TGCAGTGTCGTGGGATCAAGCCTCATGTCAGGCTCTGTGCTGAGCATGGAGCCTGCTTAA
GATTCTTTCTCCCTCTGCCCCTCTCCCCTGCTTGTGCTTTTTCTCTCTTTAAAAAAAAAA
AAAAAAAAGAAAGAAAGAAACATTAGAGAACCAGTTTTTTCTAAAACTTAATAGATGTAA
AACAAAATTTTAATATAAATAACATAGGAGCTCGCTATACACGGACATTACATAATATGC
TGTATCTTTAAAGCTTTGCACTTGTAGAATATCTGATAATCGTTACCGTGTGGGATCATC
TCCCTGCCATAGTCCTATACTTTTAACTCAACTTCGGGTGTTTGTGTTTTTGTTCGTATA
ATTTTGTGACATAGACTGAAGTGGGAAAAATGTCTTCCCTTGAGTTGGACTGAGTGGTTT
CATTTAAGAGAGCGCTGCTCATTGATGGTGATGAGGAAGGATATGGTTGAATAAGAACCT
AACGGAAACTAGATCGAATCTCCCTGAAGATGTTTTGGAGTAGTCAAAGCCATGTGGTTC
ATCTGCTGGACTAGGCTGGCGGTCTTACCTAGCAGTAGGGAGTGGGGGAAATCCCCCAAA
AGCATAAGAGTAAATTTTGTTTTCTTATTAGTGATTGTCCTATAGAACTTGGATACACAC
AGAGAAAATGAATCATACGGACTCATTATTTGATTGTGTGGTGCAGAGATGTTGACAGGC
CCTTAGCTTTCTTTTCTTTGTCTTGAAGTGAGGCTCCGGTTAGCTCTCCTTGTTACTTTT
GAGCTGTTCAGTGGAAGGGGCAAAATGAGTCTTAATGGCTGAACTGAAATTTCGTATTAG
CCTTCGTATTAATTTAGTAATCAAGTACTGCTTGGAGCGCCTGGGCAGTTAAGTGTCCGA
CTTCAGCTTAGGTCATGACCTCACAGTTCGTGGGTTTGAGCCCCCACGTTGGGCTCTGTG
CTGACAGCTCGGACCCTGGAGCCTGGTTTGGATTCTATGTCTCCCTCTCTCTCTGCCCCT
ACCCCATTCACACTCTGTCTCTCTCTCAAAAATAAACAAACATTAAAAAACAGTTTAAAA
AAATAATCAAATACTGGTTGATGTAAGCCTTTTTATTTATTTACTTATTTTTGAGAGTGT
GCGTGTGCAAGTGAGTGAGGGGCAGAGGGAGAAAGAGAGAAGCAGGGCTCACCCAAAGTA
GGGTTTGTGTTTGTCCGAAGTGGGGCTCTTGCTCACCCGACATAGGGCTCGAACTCATGA
ACCGTGAGATCATGACCTGAGCTGAGGTCAGATGCTTAACAACTGAGCCACCTAGATGCC
TGATGTAAACCTTTAAAAGGAAAAAAATTCCGGGGTGCCTGGGTAGCTCAATTGGTTGTG
TCCAACTTTTGATTTGGGCTCAGGTCATGTTGTGAGATCGAGCCTTACATTGGGCTCCAT
GCTGAGTGTGGAGCCTGCTTGGGATTCTCTCCCCCTCTCCCTTTCCCCTGCTGCTCTCTC
AAAATAAATAAATAAGCGTTTGAAAAAAAAAACCTTACAAAAAAATAAAAAAAAATTTTT
TAAAGGAGAAAAATTCCACCAGTCGTTAGATCTTTATACCTGAGGAGGGAGGAAGTAATG
GTGTAAATTTCAATGATGCTTATTATGTACCATACACATATTAAATGCTTTAATACATTA
TTTCATCCCCCTACAGCTTTATGCAATACTATTTTCATTTGCTTTCAGGTGAGGAAAATG
AAGTACAGAGAAATCACAAATAGGTTTTTCCACAATTACATAGCCAGGATTTGGACCTAG
GCAGTCTGACTCCAGAGACTGTGCTCTAATGGACTAGACTGTGTACTCAGTCTGGTGATA
TTCTTTACTTGTCGGGTCTCTCCTGGCTCCCCCTGTGTCTGAGTGACTTTCCAAGTGTTT
CCAAGTGGTGAACACATCTGCTTGCCGTAGGTCTCTCTCATCCCTCTCTGTGTCGGTCTG
CAGTGAGCATGTTGGGGAAAGGGTTTTGGCGATGTCAGCGAAGCCAAAGGTGGCAGCACC
ACGGGCTCTCAGTTTCTTGGAGCAGTTCAAGACTGCTCAGGCCCTGACCCAGCTTGCGGC
ACAGCATTCTCAGCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
TTTCGCTCTAAACATGGACAGTTTGTAGGTTCCTGTCTACACAAGCAGGCTAATAGTGCT
GATTTGATTAGGCTGTACTTAGAACAGATACGATGTGTGATTCTCACTTTAAGAAATGAG
AGTGAGTCCTAGATGAGGACTTGTTTATGTGACGTACTGATTCTTGAGGGCCTTGTTTAT
GGCTCGAGAGAGGATAATAGCGTTTCACTGACGTTCATCAGCATCCCTGACCCCATACAT
ACCGGGACTCTCCGTGCAGATTTGAAGAACCCAGACGATTCCACAGTACACAGCCCCTTC
AGCAAACGCCAGGCTTTCACCCCGTCTTCGGCCATGATGGAGGTGTTCCTTCAGGAGAAG
CCGCCCACGGTGGCCACCTCCACGGCTGCACCTCCACCGCCCTCTTCTCCTCTGCCGAGC
AAATCCACCTCGGCCCCACAGATGTCTCCCGGGTCTTCAGATAACCAGTCCTCCAGCCCT
CAGCCGGCTCAGCAGAAATTGAAACAGCAGAAGAAAAAGGCCTCCTTGACTTCTAAGGTA
CTTGAACTTTGTGATGGGTGTCATTTTAGGGCAAAGGGGATGCGGGATTTGGGAATCAAG
ATCGTGAGGGGATAGTTTGCAAATTTGAAACAGGTTTTTTTTTTTATCAGTCTTAAAGTA
AGATTGTAATAAAACCATTACCTTCTCGTTACAGATTCCTGCTCTGGCTGTGGAGATGCC
TGGCTCAGCAGATATCTCAGGGCTAAACCTGCAGTTTGGGGCATTGCAGTTTGGGTCAGA
GCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCC
AAGTAGCCTCTATACCAGCACAGCCAGGTAGAGGGGAAACCTCAATCAAGACTTTTTTTT
GTCAGGCTTTTACCACTTTTTCTGTCTCTTGCCGATTCCTAGAACTCCAAAGAGGCCCAA
GCCTCTGATTGAAGGAAAAGTGGCCGATTGTAGCATTTTGTTAAGCATTTCAAAATACTG
TTACTAAGATAATCTGTAACACTAAACAGATGGAAATATACCTCTTGCATACTTCTGGAG
TGTCCACGCCTAGTTCTTGTTTTTTGTTTTTTTGGTTTTTTAACAGAAGCATCCACCACT
TTGTTTTTGTTTTTAAGTTTTTATTTGAGAGAGAGCACATGTCCGTGTGCTGTTCCTTTG
GGGGGGGGGGGGGCTGGGGGGGCAGGGCAGAGAAAGAGAAAAATTCGAAGCAGGCTCCAC
GCTGGAACTCTTGAACCATGAGATCATGACCTGAGCCCAAATCAAGAGTCGGACGCACAA
CTGGCTGAGCCTCCCAGGCGTCCCCACGCCCAGTTCTTAAGAGGTGCGTATAGCACCTCT
AACAGGAGGACCTTGGCATCTGGCTAAAAATGCTTTGACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTCT
GTATCGATAGACACCTTGCCGTGTCTCGGCCCGGGGAGGGGACAGCATATGCCAGAGGTG
CTGTGGAGCGGACTGACAGTCCCGTGCAGCCAGAACAGTGGGTGCTTTGGCTGAACGGTC
CTCCTTCCCCAACCTCCCCCAGGGACCCCCAGGCCTTTCCTGTGTCTCTTCTGGGTTTGG
GATCTCTTGAGCGGTTTGGGGGCGCTGCCTTCTGTTGCTTTGGGTCACATGGGGTTGGTC
TATCTTGTTGCCATTTTAAATTCGTTTTGTTTAGATCGTCTGCATTATGTTAATCCTTTG
GTTAGCTTACAGAATGTCTCTGAAAGATTTGTTGGTTGAAGTTAAGCTGAGTCTGTGCTA
ACTCGACTTTTCACTTGAGTTTGTTTTTTACGCTTCTGTTTTTTGTTCCAGAATGGCTTC
AGCTCTGTGCAGGCCACACAGTTACAGACCACGCAATCTGTTGAAGGTGAGGCTTTTTCC
TCTATGTTGTAGTGGTTTTCCTCTCCTTTTCATATGTTTGCGTTTCTTCGATCATAGTGG
GAAGCGCCCTGGCTTCTCTGGTCACAGTCTTCGTGTGGTCCTGCCCTGCTGTTTTCTCTC
AGACCTGTCTCAGGGCTCTCTGACTTAGAAGAGTGATGGTACCCTTGGTTCCCTTCACTG
GATAAGTGAGATCAGTGCTCTGAAATGTTGGAAATAAGAGAGTCTAGGGGCACCTGGGTG
GTTCAGTCGGTCAAGCGTCCCGACTTCGGCTCAGGTCATGATCTCACGATTCATTGGTTC
AAGCCTCGTGTCAGGCTCTGTGCTAACAGCTCGGAGCCTGGAGCCTGCTTCAGATTCTGT
GTCTCCCTCTCTCTGTGCCCCTCCCACACTCAGCTTTGTCTTTGTCCATCTCTCTCTCTC
TCAAAAATAAATGTCCAAAAAGTTTAAAATAATAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGGTCTCCGGTCTTCCTGGTCCCATATACCGCCGCACGTCCTCGT
CAGTGTTCTTGATGGAAGCTCCAGGTCAGTCACCACTCCACCGTGACTGATGGCTGCCTC
TTCTTTGCAGCACGTTATCGACGCAGCAGAATACCCTCTCGTCATCCACGTCTTCGGGGC
GCACTTCTACATCCACTCTTTTGGTAAGTGTGATGCGGCTGAAGAGGAAGGGCAGTGTTC
TTACACTTAGAGGAGTCTAGCGGCGAGACTCCCGAGAAGAGATTCTTGGAAATCCCTTCG
TGCGGTGGCTGAGTGATCGTTGATCTGAGGTTGCAGGAATGGACTAAAAGGATGTTGGAA
GGCAGGAGAGGCAGAAGAACCTAGAGATACTGCTGAGCTGTGGGCCAATTCTCAAAGCCC
TGGACGTGACTTCTGAAGCTTTGCCTTTTTTTATTCCTTCTTAACACTGAGGTGTGCAGG
GCTTCATAGCTCTGATAGAGCCTGTGAGGGCCTCTGTACAGCCGTTCTCACTCGGTGGTG
GGGGTATGTTGGACAGGGCTGCTGAAGATGATCAGGGTCCGGGTATCCTCTGAAAGTTAA
GGCCAGAGGAAAGCTTTTGATCCGAGAATTAAGTTCACTATGGTGATTTAGGACAAGCAT
TTGTGGGGTTAAGCTGAGACGGTGAGGAAGACCCATTTGGGGCAAAGGTGTCTAGTTTGC
CAGAAACCCAGGGGAAGAGGAGTGCTCAGGCTTCCCTAGAAGACTCTTTTTCCTCAGGTA
TACTGTTTCTGGTTTAAGTTCATTAGAACTTGCTGAACTACTGAAGGAGAACGTGGGAGA
GAAGGCTAGGCTGTATTTCCCTGACCCGAACTGTTCGCTGGCCAGCCAGCATTGGTTCCT
GGCGTGTTTGTCCGCATGTGCTCTGACGGGAGGGCGTGCAGCCGGTGTTGTTAACTAGAT
CCCTGCCTGACGCCGCCTCTGGGGGAACAGGCAGCCGGAGCAAACTGCGTGATTTCTTCT
AACTCCTTTGGTGGAGGACACCCAGGTCTCTGCCTCGGCCGTTTTAATTGGGAGGCTGAT
GTGCTCTCGCCTGCAGAAGGGGCTGTGCCTCTCTCCTGACCTGTCTGGCTGATCACTATT
TCCTCTTCTCATCCACTGCTCCCCCTTTTTGAAGCACACAAGCGTGGACAGTGAGGCGAA
CCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCGCCTCCCCC
AGTGGTCAGTGTCTCCTCCAGTCTCCACAGCGGCAGCAGCTTAGGCCTCAGCCTCAGCAG
CAACTCCACCGTCACAGCCTCGACTCGGAGCTCGGTCGCTACGACTTCAGGTAGAAGGTG
GACGGCATTCCTCTGGGATGGAGGAGAGGAGTGATCGTGTGACTGGGTAAAAATGGGATC
TCTCTTTTAGGAAAAGCTCCTCCCAACCTCCCTCCTGGGGTCCCGCCGTTGTTGCCTAAT
CCGTACATCATGGCTCCAGGGCTGTTACACGCCTACCCGGTAAGTGAGGCCGAAGCAGCT
TCTGCAAAAGATGAAGATGGTGTGGCTACTCTTTACAGCTCCAGCTTCGGGTGGAAGACT
GTAATTAAAATAGAGAATAAATGAGTGGTTGTCGCACGTAAGCAAACCAGTTTTTGATCT
TCATAGTTTGGGGCAAAAATCGTCATTTCTAGAGGGGAAGGACTAAACGGAGGCCACTCC
TCCTATTGTGTATTTTCTCTGTGTGAAACAAATTCTAGGCTTCGGAAGCTGAAGGCCAGA
GTGCCCACCTGGAATCCCTTTCAGTTTCTCAGAGAATTATTTTCTTGGGTAGGATTGAGT
CCCTGTCTGTGAGGTTCTCAGCTGGCTGTGACCTGGGAAGAACAGAGCTCCCTGACCTGA
TCTGGGACTGCTGGAGAGTAGGTGGTTTGACAAGTGGTAGCTTTGTGTCCCGGTGTATCT
TCTGTCAAATTCATAGATTTGGTGCCAATTAAGGTAAAGGCTATTCATTTGAAATGTTTA
AAAAGACACCCGTTCTGGCCTCTCAGAAAGTGTCTAAGCGAGCATCATACACAGGAAACG
TTCAATAATGGTTTGCACATTTTTTAACAATCAGCATAACGTCTTAGTCCCCATATGTTA
GAGAAAACAAGTAAGATGTGAATCCTTTCTGAAAGAGATGAGTCTTAAGCTGTGTATCTG
ACGGCCGTTCCTACCTGGCTCCTGTTGCCCCACCGCTGCCTCTGGGTTGGATCGGTGGTA
TGTGGCTCATGGCAAGTTTCGAGACCTTTCATAAATCACCCAGTCTGTACTTCACTTCTT
TCTTCCTAAAGGCAACTGCCGGAAGTAACCTATGTTCTGTTCTTCCTAAGAATGAGGATG
GATGTTCTGTTGACTGACTTTGTCCCTTGGCACCTTGGCTGGCTTCTGTGGTAGCCAATC
CCTGTGAACACTGTTACATGCTTGTGTCTTCCAGCCGCAAGTATATGGTTACGATGACTT
ACAGATGCTTCAGACGAGATTCCCCTTGGTGAGTGTGTGCTTAGGGCAGGAGGAGAGAGC
GACCTTACAGCCTTGAGGGGGTTGTTTCAGGTGCTCAGTTGATAAGTCCCCCCCATTAGC
TCTTTCCCAACCTATACATCCAGATGCAAACCCTGATTCAAGATCAGGGACTGGGGGAGT
GGGTCAGCTCTCAGGTAGCTTTTTTTTTTTCATCAGTTGTGACCTCCTTAAAATAAACAA
GTTTTAACCTTAAAAATAGCTCAGAATACCCTAGAGCTCTCTGGATGCTTTTTCTGACAC
GTCAGACACTTTGAATTACAGAAAGAGAATCTATTTTTTGGTAGCAGTGGACTGTTGGGG
ACGACACTTAATGGTTTGAGAGCATTATTGTTCCGATGGTCCCGACCTGTTTCCCGGTGG
GCACACCCGTAGACCTCGCCTGACTCTGCCCGTGGCCGGGCGAGGGGGACAGTGTGTGCA
AGAGTCACGGGGAGTTCTTACCAGCTCCAGCCAGCTCGCTCGCCGGCTGGATAAATGCAG
TGCTCCCAACATTCCGCCTCTCACCTTGCGCTGAGCAGATGAGTGGTATCCAGTCTGTGC
CCTTTGTCTCTTCTAGGATTACTACAGCATCCCATTTCCCACGCCCACCACACCGCTGAC
GGGGAGGGACGGTAGCCTGGCCAGCAACCCCTACTCTGGTACGGCTTGGGGGGGGGGGGG
TGCAGATGACAGGAGTGTGTGCTGGGACTGGTGGCAAAAACCTGGTTAATGGCGAGCAGG
GACCCAGTTCTAACTTTAATGAAGACCTTTGGCGGAAGGTCTGGAACAGATGTGATGAAT
CCGGGTTGGTAGATTTGGGATGCTACTGAAGACGGACATTTCCTTCTCGTCCTACTTTGT
TGTCTCCCGGTGGTTCCAGATGACCCCCTGACAGGCTTCTCCGCCATTCTCCAGTGTTTT
CCGGGAAGTGCAGGGGTTGAAATGGCCTTCCTCCGCTTGTCTCTGCTCCTGTTCCCTGCT
CACAGCGGCAATCTGGTTGCCTCACTAGGCTGTGATCCTTCTTTTTATGCCTGACCTCTT
TGACGTATCATTTTCCTTGACCTGTCCTTGTCTGCTGAGTGCAGCATGGAGTGTTCTTGT
GGAGGGAAAGCAGGGGAAGGCAGGGAGGGTGGGGCTGAAATCATGCTTTACTCTGGGAGC
CTGTCTCCCACATCGTTGCCCAGGCATTTGACATCAGGCTTGACTAGCACAGTGCAGAGT
GTGTGCTCAGCAATGCCAAATGGAGCCAGAGAGAAAATGTAATTCAAAGAATTGACCTTT
AACAGTCTTTAATCGGGGTCTTCTGGAGTCCTGTGAAACCAGGAGAAGTAATTGTGCCCT
GGGGTCGGGGGTGAAATAGACAGCAGGTATATTTACTCTCTCCTGTCATAGGTGACCTCA
CGAAGTTCGGCCGCGGGGATGCCTCCTCCCCAGCCCCGGCCACAACCTTGGCCCAACCCC
AACAGAACCAGACGCAGACTCACCACACGACGCAGCAGACATTCCTGAACCCGGCGCTGC
CTCCTGGCTACAGTTACACCAGCCTGCCATACTACACAGGGGTTCCGGGCCTCCCCAGCA
CCTTCCAGTATGGGCCTGCTGTGTTCCCTGTGAGTACCTGGGTTTGGCTTCCTTTTGGTG
AAGAAGCCCAGCCCCTGGACCCTATCCTAGCTGCCTTCATGGCTAAATGATTTTTTAATA
ATGGATGAGGAAAAACCATTCCCCCTCTGTCCTGGGAGAGGTGGGGGCTGGAATTGGAGG
TACTGGGATAGAGATGACCTGTTCTTAGAGTTCTCTAAAGAGGGGAGATGATACAGTCCA
GCTTTGGACCCTAGACTGTCATTCATTCCCTCCTGCCACTTGGCACTTGCCCTTCCTTCA
AACTACCGTTTCTTGACTTCACTGGTAGATTTTCTAAAGCTCCGTAGGGAACCCATTTTA
CTAAGCAGATTGTGGTCAGCTTGCCTCAAGACCATAGCCATCTGAGTGCCTAGTTCCTGG
GGCAGGTTGGTGACGGTTCTCTGTCACTATCTCACCTCCCTTCTGGCCCTGTTGCTCTCC
AGGTGGCTCCTACCTCTTCCAAGCAGCATGGTGTGAATGTCAGTGTGAACGCATCAGCCA
CCCCTTTCCAACAGCCAAGTGGATATGGGTCTCACGGATACAACACTGGTAAGCACCCCT
TGACCCCAGCTGTCCGTGGTTTCCGCAGGATGTGACTAAAGGAGTTTTGGGGGAGGAGGA
TGTGCTTGAGAGAACAGGGTTGGTGAGGTGTGCGTGCTAGCATCTGTACGTAGGGTTGTC
CACGTTTGACCGACATGGGTGTCCGAGCGGCACCAGCAGACGTGCTTGGTGTCGGGACAT
GTGTCCAGCCCTCACGATGGGAGTGCCCCGGGGCCTGCATTGGCTGTCAGAATATGTTGG
CTGGCCTAAACTTCGGGTGGGACGCAGGACAAGGGGCCCCAAGACGTTACTGTGCTGTCA
GTGGGGACAGGCGTGAGAACGTCTGGTACCGGTAGTTCTCAAGGAGAATCACTGCCCAGC
AGCGTTGGGTGGGTTCTTAGCCAGTGTGCCCCGGCGGGTTGGGCTTAAACCTTTCGGTAG
CACTGCTTTTCTCACACAGCCCCTTTTCGTTCCCTAGCTGGGAGCCCTAGGGTATGGAGA
GAAAGGTGTGGGGTGCGAGAGCTCAACAGAGGGAGAGGGTCCTTCGTTTGTATGGCTGGT
CTCTTGGCAAAGTCTGCATATCTGATGGCAGGGCAGAGATGTAGGAACTGACCTGAAAGA
TAACTAGTTTGTCCCCTGCTCCTCTAGTGAGGCCTGTACCCCACTTGTGGAGGACAGTTC
CATCGGCTTTTTTCAGTGACTTGTAAATGAATGTGGGGAGGAGGATTTTGCAGTTGAAAG
AGTTGGGATTGAGGGCTCTTCAAAATTCTAAGCTCACGTGTGGTGTCATGGTGGTTTGGA
GGGGGCTGCATCTGTGTTCTTCACCACTGTGTGGGCCCCAGGTGGGTCAATTGCCCGAGG
GTTTCAATCATCGGGGAACTCTGAGCTGAGCACAGAGGGCAGTAGGTCTGGGAGCTAATA
ACCAGATGGAGCTTTGAACTGTTGGAGCACTTGGAGTGAGTCCGGATTCAACCTGGAGAA
ATCCTGAGATGCCCCGCTCCTCGTGGCTGCCCCTCTCACCGGGCGAGGTGCACCCTAATC
CTTGGTGGGGACGATTGTCAGCTTTCTGACTTGGCGCGGCCCCATTCTGAGAACGTTAGA
TTTAGGTTTTAGCTGGACCAGGTTCAAGAATTTTAAGAGGTAGGTGATTGATAATAGAAG
AGAATGGCATTACCTGATTCTGGAAATCCAAGGCTCTTATCTACCTTAAGAGTTCAGAAA
TCCGCTGTAACAGTCTTTTGAGAAGCCCCAGTTCCCAACCCCACGGAGGGCTCTTGTCAT
CCCGTGCCTCATCAACCTCTAAATTCATTTATTTTTATGTATTTGATTCCTTTTAGGAAG
AAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCT
GGGGGCTGTGTTTTGTGTGTGTGTATAAATTTGCACTGAAGTCTTGTTTCAGAAACCAGA
CCACTGAGGAGAGCCTGCCGAGCTGAGGCCATGGCCTGCGTGGCTTGGGGAAATGAGTTG
GTGGATACCTTCTGGGCTTTGAACTTGCCCTGCCCCCGTTTCCCTCTCCCCCACGTGTCT
GACCCTGTCTTACCCATTCCGAGTCCAAGCGGTGCAGCGCCTCCGAAGCATCAATGCACA
CACCTGCCGTTGCTCTTGATTTCTGGAAGGATGTAGTTTCACCTTGTAACAAAATATTTG
TAGTCTTCAATAAACTGTGGTATTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCATGTC
TTTCTGGACACTAGGAGCCAATGTTGTGCTGTGGACGAAGGGTGGAGGGGGGCCTTCTCA
ATCAAACCCCAGTGTAGCCAAAGGATGGAGAACTGTTACCTTCTCGGCGTGGTGATTTTA
TCAAGTGAGAGAGGGGGAGGCAGCGTCAGTTTTCAGCCCTTTGATTGAATGATAAAGAAA
AGTTATTTGCAGAAAAATCCCTGATTCTCCATGCTTAGTACAGCGCTTCACTTTTCACTC
AGATCTTTCCTGTGCCTCTGACGGAAGCAGAGGGAAAGGACAAAAACAGCTTGGAGTGTC
AGGTCATGGTGAAAGGCAGAAAGAGGTGGCGTTTGGAGCTGGTTTAGGGAAGTGGCTTCC
AAGGCCCTGGGCCAGATGGCTGCTTGAGAGCTGATTGGGTCTTTAGTGACCAGCTAGTTG
ATGACTCCGGCTGTGACAACCGTGCTGGCCTGCAGCACTGTTCTCAGTCCCTCGAGACTG
CTCGGGGGTTGTGGACTACTCGTTGCTTTGCACTTGTGGGTGTAGCTAAGGATGTGCGGG
AGAGGTTTCGTTCCACTTCTCCGTGACGACGGGAGCTCTCCCTACTCGATCCAGCTGCTG
GCACACCGTCGCCCCCTTTGTTTACAGAGTTAACTCGTCCGGCGAGAGCATCATCCTTCG
TTAAGTGCAAACCTGGATACTCCACTTCCTCTGTATTTGTCCCCAGCCCTCCGGGGCTGC
CATGCTGGGAGGCATTGGTTCTCGTTTCTCCTCCCTGCTGTCCACCTCCTGTCAGTGTGC
TTGTAGCTGCTTGGGAGCGGGGAAGGTGGGGGGGCGGATAGGCAGGGCGTTGACTGTTGG
AAAGCCAGAGAACTCTGGTCTGAGGAGCTTTCTCGCCGCAGGTGCAGGGGAAGTGGGGCA
GCCACACAGGTCACGTCTAGGGCCTCTAGTGCTCACACTCAGGCTGTTAGGGCTGCTGCG
GTGTTCTCTCGTCTGTTCCTGCGTCTCCAGTCCTTTCGCCCAACACCCGGACCACGGTCT
CAGGACTAGAAGCTGGATTTTAGCTGGTCCAGCCTCTGGGAAGACTGAGCCCAGGTGTGT
GTGGCAGGGGCACTCCGGAGCTAAATTGCTCCCTACCACCCAGCTCGAGAAACCAGTTAG
CCATTTGTCCTGTCCTGCATGGGGTGGCCCAGGGTGTCCACAAGGTATTAGAACCTTTGC
AGTAAAGATCAATCATCGTCTCTCGTTTCCCTCAAAAACGTTTGTATCCCGTCCGTCCCA
CCTCACTGTCGGCCCTCCGCACAAATCTCCTCGGTGCTGTAGCAAATAAACTGTCCTTAA
AGTCAGGTCCACCACCAGTGACTGGCACACGGGCACCTGGGGTTTGAGAAGGGAAGGGAA
GGCACTACCCTGTTAGTCCCTGTATCATCCCTTCTTCTCCTTCAGGGCCTTTGAGGGGAG
AATTGCTGCTTGAGAAGGGGTGGTATTTTCCATGCTGTTTCTGCAGTTGTGCGATTTTTC
TTTGGCACCTTCTTGGAGTGATCTAGGTTTGTGCTATGGGCGGGGCTTCCAGGTGAAGAA
ACCACACGTACCGGGAAGATCCTGAAGTGGTTGTCCAAGGTGGACTCCACCTTGGGAGGC
TGCCTCCATCCTAGGCATTGGGAGGATCTGGGTTCTGGACTCTGACGGGGGAATTGCTCT
TGAGTTGTGGGGGGACTTGTGATTTGGTCACTTTGGCACGGTGCTTCTGAGAAGCTCTTG
CATCCGAGGGCCTCGAACAGCAGGAGGAGGATCCAGGGACACAGGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAGGACTA
GAAATCGAGACGAGGAATATGCTGTCCTGGTTTCCTTGGAGTGGCCCTGGTGGCAGGGAG
TTTTTACCCGGGGAACACAAGTCATTGGGAGTATGGATGAGGACGTCGGATTTTGTGTTC
CACCTGGACTGGAGGAGACAACATACTCCACTCCCTTCCTTACCCTCCCCACCTCCCCGT
GCTTGGGCCTCAGTTACTTAGCTGGAAATGCACCTTTGTGTGGGCTCTTTAAATCCTAAG
TACGTGGCCTAGAAGCGCCAGAATTGGAGACGCGGGGCCAGGTGAGCCAAGACTGACAAC
GGGCCGTGCTCTTGGGGTTGGACTGGAATGCTCCTTGGGTGCTTACCTTAGGCTGCGAAA
GCATGCAGTCCTGAGCCCAAAAGTGTCTCTTGGTGAACAGGAAGATCCCAGACTACCTGT
CTTCAGGAGCAGGACCGAGTGGAGTCTGGGTGCGTTGATTTGAAACGGATGTTAAACATT
TAATACATTTCTTTTGGGCTTTGGCACAAAAGCGTCTTGAAAGGTATATGCTGGTGAGGC
TTGCCTGTAGCCTTGCCCCACAAAAAGCAGCTCCCCTCACTCGCCCCCTCACATACATAC
TCAGTACGCACCTGGAAAGGGCAGACTCGGGGCATGAACCCTCATCTCTCAGGACTGACC
TGAGCTGGAAACACAGCAGGACCCCTTGCAGTGCTCTAGCTAGAGGCTGTGCACACCGTC
TCCCCCCGAGAGGGGGGCCAGGCAGCCAGCTGAGCTAACTCCTGTTTCCTCCTCCCCCAG
GTGTGTCAGTCACCTCCAGTAACACGGGCGTGCCAGATATCTCGGGTTCTGTGTACTCCA
AGACCCAGGTAGGTGCCTTGCTCGAGGTACAGGTGGAAAGATAACGGACGCAGAGGAGGT
GGCATTGCAATGACAGAAGCTCAGTGAACAAGAACAACCTGAGAGATGTCAGGAAGCCCA
TCCCAGAAAACGAGTGGTCTCTAGATTTCAATTTCTAGAAGTTTGGAGTTAGCCCTCTGA
GAACAAGCAAGAGAAGTGTTCAGGAAGGGGAGGTGTGGCCGGTCGCTGTGAGGCGGGATT
TACCGTGCAGCTGTCCTGACTTTGCCCACCGCCAGCCTTCTTGTAACTTTCCAAGATGAC
GAGTACGGACTGAAGGGAAGCTGGTGCGATCCAGTCTTTGTAAAGGCACAGTGGGAGCGA
CCGTGAAGTATCAGGAGTCCTGGCGGAGCGCTTCGTGGCCGAGCTCCAGGGTGGCAGTAG
GGGAGCAGCTGCAGATGGTCTGCGACTGTAGAGTCACAGGGCAGCCTCACACCCGTCCTG
TCGTGTGGTCCCCACGGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATCGTTGCCCAGGCATTTGACATCAGGCTTGACTAGCACAGTGCAGAGTGTGTGCTCAG
CAATGCCAAATGGAGCCAGAGAGAAAATGTAATTCAAAGAATTGACCTTTAACAGTCTTT
AATCGGGGTCTTCTGGAGTCCTGTGAAACCAGGAGAAGTAATTGTGCCCTGGGGTCGGGG
GTGAAATAGACAGCAGGTATATTTACTCTCTCCTGTCATAGGTGACCTCACGAAGTTCGG
CCGCGGGGATGCCTCCTCCCCAGCCCCGGCCACAACCTTGGCCCAACCCCAACAGAACCA
GACGCAGACTCACCACACGACGCAGCAGACATTCCTGAACCCGGCGCTGCCTCCTGGCTA
CAGTTACACCAGCCTGCCATACTACACAGGGGTTCCGGGCCTCCCCAGCACCTTCCAGTA
TGGGCCTGCTGTGTTCCCTGTGAGTACCTGGGTTTGGCTTCCTTTTGGTGAAGAAGCCCA
GCCCCTGGACCCTATCCTAGCTGCCTTCATGGCTAAATGATTTTTTAATAATGGATGAGG
AAAAACCATTCCCCCTCTGTCCTGGGAGAGGTGGGGGCTGGAATTGGAGGTACTGGGATA
GAGATGACCTGTTCTTAGAGTTCTCTAAAGAGGGGAGATGATACAGTCCAGCTTTGGACC
CTAGACTGTCATTCATTCCCTCCTGCCACTTGGCACTTGCCCTTCCTTCAAACTACCGTT
TCTTGACTTCACTGGTAGATTTTCTAAAGCTCCGTAGGGAACCCATTTTACTAAGCAGAT
TGTGGTCAGCTTGCCTCAAGACCATAGCCATCTGAGTGCCTAGTTCCTGGGGCAGGTTGG
TGACGGTTCTCTGTCACTATCTCACCTCCCTTCTGGCCCTGTTGCTCTCCAGGTGGCTCC
TACCTCTTCCAAGCAGCATGGTGTGAATGTCAGTGTGAACGCATCAGCCACCCCTTTCCA
ACAGCCAAGTGGATATGGGGTCTCACGGATACACACTGGTAGCACCTCTTGACCCCAGCT
GTCCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCCCTAGGAA
GTGGGGGCCCATCAATCCAGCCACAGGTGCTGCCTACCCACCTTGCCCCCTTTAATGCAC
ATCTGACCCCCCATCAGCAGCCGCACTCCCAGATCCTCCACCACCACGTGCAGCAGGACG
GCCAGGTAATAGCTCTCCCCTCTCCTTTCCCTTCCTCTTCCTTCCTGTCCCCTGAAACTC
CCCCCTTTCCTTCTCTTACCCTTCCTCACCACCACCTTCACCCACCCCTCCCAGCGCCAG
CCATGGGCACACAGCACAGACAGACACAAGCGCACACGACACAAGCTGCCGGCAGAGGAG
CGGTCAGAGAAGGGGCCGGGCTGAAACCTTCTTCGCCCGGTTCCTTCGGTGCCTTTCTCC
TCTACCTCCTGTAGCACAGCTGCCCTCATCCCATCAGACCTGGGTCACACCTACCCTCTG
ACCTCTCCCGGCCTCCCCCCTTCCCAACATTGTAGCTTTCCCTTCTAATGGTGGAGTTCT
ATTGTCAAAGTTTGTCCCTTTATTTTCCATATATCCTGGTTCTGCCTCAGCTACCATATT
TGCAGATGATTCTGTGTTGCCCGCGCCAGCAGGAGGAGCAGGTAATGAAACTGAATGATG
ATGTGCTTGAACCCACTCCTTCCCGGCCCCCACTTCACCTCCACAGCCTCAGGGAACTCG
AAGACAAAAAGCTGCACCGTCACAGATCAGGACACACAGACACAGACACCTTGCTGAGCT
CTCTGGCCTCCTGTTCCTCTCTTGCCCTCCCCTCCCCAGTGCCCTCTTTTTCTTTCTGCC
CTTCCGCGACTCTGGAAACACTTGGTTACTGGAACGGAACGGATCCTTGGGGCAGCTTCT
GGAGCCTGGGGCCTCAGACTGTCTCTCCTGCCTTTTGGCTGAAATGGGCTCTCCGCTGTG
CAATGGGGGGAGCGGGGGGGCATGGGCTGGTACAGGTGACCTCTCCTGCGTCCCAGGGAG
CTGGGGAGCTGGGATAAGTAAGGGCTGCCTTGCTGTCAGAGACAGCCTTCCCAGTTGAGG
TATTCGTGGGATCAACGAAAACGAAATCATCTTGTGGTCACTCATCTCCAAGAGGCCATA
ACTCTCTAGAGAGAGTAGCCTTTTCTCAGAGCAGTGGGGGTAGGGGAGAAGGTGGGGTGG
AAAGTGGGTAGAACTCATTCACAGTCTTGTCTCTAAAAGGTCCTGCCGTCTTGTCATCGT
TCCCCTGTTTAAAGGCTGGAAATGCTTTCTTCCCTGTCCGAGGCACCCTAGCACCTATAG
AAATTAAATGTTCTGTGGTTTGGAAGTAAACTTCAGAGCAGTTTCTCTAAGCAAGGGGAG
AGCAAGAGTTTCCAGATCTGCATGTGAAGATGTCACAGATCTGTCCCACTAACTAGACAC
CTTTCTCCTCCTCCTCATCGTCCCATTCCCTGCAGACGGGCAGCGGGCAACGTAGCCAGA
CCAGCTCCATCCCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 28404..28515, 32516..32568, 34137..34228, 36057..36228, 39245..39265, 39267..39313, 39315..39375, 39741..40016, 40174..40344, 42231..42284, 42971..43042, 44014..44209, 44290..44378, 45334..45387, 45976..46057, 46791..47008, 47462..47567, 52680..52747, 54467..54487, 54490..54522, 54524..54533, 54535..54539, 54542..54604, 55895..55933
1001..1090, 28404..28515, 32516..32568, 34137..34228, 36057..36228, 39245..39265, 39267..39313, 39315..39375, 39741..40016, 40174..40344, 42231..42284, 42971..43042, 44014..44209, 44290..44378, 45334..45387, 45976..46057, 46791..47008, 47462..47567, 52680..52747, 54467..54487, 54490..54522, 54524..54533, 54535..54539, 54542..54604, 55895..55933
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved