Felis_catus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Felis_catus NOL5A
Felis_catus
NOL5A
GeneScaffold_1514
SNORD86, SNORD56, SNORD57
7223..7307, 7742..7812, 8075..8146
10438
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCG
GTCTCTGATTGGCCGGCGGCGCGGAGGCGTGGCTTCCGGAGCCCGGTTCCGCGCGCCGGA
GCCCACTCGCCGCATTGCGAGCCGGGCCAGGAGCGGGCGCCATGGTGAGGAGTGGTAGCG
GGTGCGGGTGAGGCGAAGGCCGAGGTTTGGGCCTGAGTTCGGGCGGGAGCCCGGGCCGGG
GCGGGAATCTGCCCTGGGAGCGGGGCCGGGTGAACTCGGGAACCACGCTGACGCTCGCGC
CCCGGCTCCCGTTCCAGGTGCTGCTGCACGTGCTATTCGAGCACGCGGTCGGCTACGCGC
TGCTGGCGCTGAAGGAGGTGGAGGAGATCAGCCTGCTGCTGCCGCAGGTGGGTGGAAGCG
GTGGGCTTGCCGGCCGCGCCACAGCTCCTGGGGCCGCCGGGCCCCGGCATGCACCGCGCG
CTCCCACGTGGCCGGTCGCGCTTTGGGGGGGTGCGCTGGGCCTGAAAGCTCCCGACCTGG
CGGTGGGTGGGTGGGTGTGTGTGTGGGGGGGGGGTCCTTATCTGCGTTCGTAATTAGTGT
CGCGTTAGAAGCACTTGCAAGTAAGCCCCCCCGGATTGCACCCCGTACGATGAAGCCGAC
CGGGATTCAGGGCCTATACTCGGCTCGTTTTCAAAGCGTTCGGTTGGTTCTTAAACATGC
GTGCAGGGCTGAGAACCGCTGCTTTACTGCGCCCTAGAGGCAAGAGCCAGGGAAGAAAAC
CGCTCATCCTGTTTCTTCCCCAAGGTGGAAGAGTGCGTGCTCAACCTGGGCAAGTTCCAC
AATATCGTTCGTCTCGTGGCCTTTTGTCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAAT
GCCAACGCTGTGTCTGAAGGTGAGTCGGCCACCAGCAAGTATTTTACGGAGATAAGTCGA
TGTGATTTCTTTGTGGGCCTTCTAGAGATAAATGCTCCATAGGTGAAATCCGGTAGGGAG
GCATGGTTTGATGGTAAAGGTGGTTCTCTGGTAATTGTTGAAGTGCTTGGAAAAAGCGGT
TTTGATACAGAAGAGCCAAGAAAAAAAGATTATTCCAGAAGGCAAATCAGGCACTAAATG
CTTATTTACACAGCGCCCTAGGGTGTGTTGGAGGCTTCAATTATATATTGCACACGCTTG
CATTTGGACCTGAGTCCTGTTCCTTCCATGGTTGATGCGGGCTTTGCGGTGATGACGTGA
ATCTGTCAATCCCCTGAGTGCAATCACTGATGTCTCCATGTCTCTGAGCAAAGCCTGAAG
CAAGGAAGGATCTAGGTGTGCCATCCCAGCATGCCCTGTGGGACCAACATAGGATAAGTC
TATCACTTAATCAGCATTTAGGGTGACAGGATCCCTTTTATAGAGTTAAGCATTCTTCAG
TATGTTAGTGGAAGCTCTCTGTTCTCTGCCCTGAGGTGTTGTTCACGAGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGAGGGGGGATCT
GGAAACTTAACAGGGTGCTTAGCTTAAGGTTGCTTTTGGGAAGCCATTCTGTTTGGTTGG
TGCCTGTGAGTGCAGAGGTCCGCTTACAACCTTCCCTTGCTCACAGTCTCGCTCTCCTCC
AGGGGTTCGTTTGCACTTCCACAACCTGGTGAAGGGTTTGACAGATCTGTCTGCTTGTAA
AGCCCAGTTGGGGTTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAACGTGAACCG
GGTAGACAATATGATTATCCAATCCATTAGTCTCCTGGACCAGCTGGATAAGGACATCAA
TACTTTCTCCATGCGTGTCAGGTAAAGAGCCTGAGCAACCCCTGAGAAGGGGGTCTTTGG
CCTGTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNATGGGGTTAAGGGACTATTACAACAGAGGTCCATACTGCTGTATTTTCTGACCCATT
GTTAATCTTCCCCAGTTGCACTTGACGACAGGTGAAGCGGAATTATGCAGTTGGTAGAGT
GGCAATTCCGGCTTCTCTAATTCCTTGAATCCTTTTCTAGGTAGGTGCACGTCTCATTGC
TCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCGTCCACAGTGCAGATCCTTGG
GGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACACACCGGTGCCACTT
GCGGTGCCCACTGCTTGTTTGGGGATCACGGTGATGGCTGACCAGGGCTCCCTGACCTAT
ACAGACCTCTGCTATGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAG
CAAAGGGACCAGATTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGCTTCTGGGAGCT
GTGGGTTGGCATGAGGTGGGGGTGTAGAGACCCAGTCCAGCCTAAGGCTCACTTTGGAGA
CTGGGGGAACACGGGAGGGGAGGAGCTGCCTCGGCTGGTGGGGTTGAGATTTCTGATCTT
AAACTCCCCACTAAATATTCTTCTCCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAA
TATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGC
ATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTCTCTGGT
ATGGGTGGGGGGGTTGGAGGAGAAGGGGCTGGGAGGAGGGGAGGCTGACTACCTAGCAGC
TTCTACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGATACCT
TGGGTCTGAGTGAAGCTGAGGGTAGAGGGAAAACGGTGGGGAGTAGCTGGCCCTTTAGGA
GCTGACAGGCTTTGTTTACCCACACGCGCGCACACACACACATCCAGAGGTGCCCACAAG
TGTATTTGGGGAGAAGCTTCGAGAGCAAGTTGAGGAGCGGCTGTCCTTCTATGAGACAGG
AGAGATTCCACGAAAGAATCTGGATGTCATGAAGGAGGCGATGGTTCAGGTCAGTTTGGG
CTTTGCTGGGTGCGGGAAGGACCAGAGCTGGCTGTTGGAGGTGATGAACTGGCTAAGCCT
GACTTTGTAGAGTGGAGGCAAAAAAACTGATTTAATGAGCCTGATCCAATGAAGCCGGAA
AGGAGGCCTAGAGAACCTGCAGTCTTCGGGGCCTTTTCAGCACTTTTCTTTGGCCAGGCA
GAGGAAGCGGCTGCTGAGATGGCCAGGAAGCTGGAGAAGCAGGAGAAGAAACGCTTGAAG
AAGGAGAAGAAACGGCTGGCCGCCCTTGCCCTCGCGTCTTCGGAAAACAGCAGTAGTACC
CTGGAGGAATGTGAGGTCAGTGGGCAGGCCAACCCTCAGCCCAGGGTGAAGGCCCCGGGT
GTAGGGTTCTTGACAGCAGAACAGAGGATGTGCTACCTCACATCATGGTCTCGAGTCCAG
GCTTTTGGACTAAAATCAGGACCTGAAACATCTCAAACTACCTCTTGATTCTATAGGAAG
GAGATAGGTGCTGAGAGAACTGGCTCAGGAGCCCAGAGAGCTGGTTGTAACACACCCGGT
CCCTGGGCAAGTGTTCTGTCCTCGGCTGCCTCCCAGGAGTCCTCAACCGGGGGTAGTGTG
AATTCCTGCTCTGCGTGTTCTCAGCCGTGTTGTCCGGAGGTGGTAGCATTTCATAGTGGG
GCTTGGGGCAGGGAGGTCTCCATGATGTGTGCTAGGTTAGGGTCCTCCCCAGGATTTTCA
TGCAGCGCCCAGTTTGTCAAGTAGTCTTTCACGGTCCCCTTTGGAACATGGCATGATGGT
TCTATTGTGTGTTTTTCTATAGCTATTTCATGGGCTTAGACAGCAACATATCCTATCCTT
AAGTGGGAGTCCCCTTGGGGATGGGTTTGCAGCATCTTGCCTATAGTTAGAAATCCTTTC
TGAAACACTGGGTGATTTTCACACCATTTCCACCAGTTTCTCTGCCCTATTTAGTTGCTG
GAATTTTCAGAGGTGCGCATATTCGTACGATGGAAGATAGTTTCATGCCCATTTTTCTCT
TTAGGAGATAAGTGAGAGACCCAAGAAGAAGAAAAAGCAAAAGCCCCAGGAGACTCCTCA
GGAGAATGGAATGGAAGACCCATCGGTTTCTGTCTCCAAACCCAAGAAAAAGAAATCTTT
TTCCAAGGAGGAGCTGGTTAGTAGTGATCTTGAAGAGACCGCTGGCAGCGGAAGTCTTCC
TAAGAGGAAGAAATCTTTCCCCAAAGAGGAACCAGTTAGTGATGCCGAAGAGGCAGCAAA
CAGGAGCATCCCTAAGAAAAAGAGGAAATTCTCTTCCAAGGAGGAGCCACTCAGCAGTGG
ACCAGAAGAGGCTGTTGGCAGCAAGAGCAGCAGCTCCAAGAAAAAGAGAAAGCTCCAGAA
GTTCTCCCAGGAAGATTAGAGTGGACATTCTCCTGGTGGGGCATAACCCACATGGCATTT
CCCAACCCACCCCTTATATCCCAATAAAAACAAATTCACAGGAGTCCGTATATTTGTTTT
ATTGAACACCTTACATGGCTATGGGTGTGGATGGGACCTACTGGTGAGGCAGAGCACCAA
TGACCGCCTCAGTGAAGTCTCGGCAGGTGGCATAGCCACCCATGTCAGAAGTTCGAACCT
GTAGGGGAGAATGGTCATCATCCCTGTGGCCTAGGCCCCATCCCTAGGCGGCCCCCTACC
CCCACCTAGTAATACATGGGTCCCTAAGGAAGCCAGCCCCAGGACAACCTAGGCTCTGCC
CAGATGATTATGGTCTAAAAGGTTTAAGAGCTCTTCTCTGGTCCACTGTACTGAAGGGAG
GTGTAGGTAGTATGGTCCTTGTGAGGTTGGAGGGAATAAAGGGGTTTAGCCCCCGTGGGG
GTGCAGGTGGCCGATGACAGACTTGATGAAGTCGGTTGTGGTACTGTAGCCGCCCATGTC
TCGAGTCCGCACCTACAGCCACCACCGGCAAAAGCCGTGGGGAAGAAGAGAAGAGAGCCC
ATGAAGGGGGGATAGGGCAATGTGATGGGCATGGAATCCAAGAAGGAATGACAAGGCCAG
AAAGAAGATGCAATGCAGCAGAATCGCAAGGAGGTGGCCAGGTTTGGAAGAGCATGGGCT
CCCCCACTGCTGTCTGGGCCAGAGCCACTATCAGAGAGCTATGCTGCAGCCTGAGCAGGA
TGGGAGGGAGGCTGAGCGTGAAGTGAGATGGGAGATGCAAGTCCTGGAGGACTTCAGACC
ACGTGGGAGGACGGACGGCAGGAGAATGCAGATGAGGAAGGGCTTGCAGGTGTGGAGAAG
CAGACACCTGTGCCTCATCCTGCCTGCTATCTCCCTCTGCTCCTCTGGCCCCCACACCCT
CCCCCAGACAGCAGCCACCAAAGAGCCGATGGATGGAGCAGGAAAGAGAGCATAGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1157..1246, 1644..1758, 2315..2329, 4562..4758, 7060..7160, 7529..7677, 7907..8028, 8217..8354, 9064..9438
1001..1003, 1157..1246, 1644..1758, 2315..2329, 4562..4758, 7060..7160, 7529..7677, 7907..8028, 8217..8354, 9064..9435
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved