Felis_catus Locus Q0QEN3_FELCA
snOPY snoRNA Orthological Gene Database
Felis_catus Q0QEN3_FELCA
Felis_catus
Q0QEN3_FELCA
GeneScaffold_2055
SNORD59, SNORD59
1850..1924, 3446..3516
20814
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTCACCTGCAGTTAAAACAAA
AGGAGCATACGGTTTCATGCAAACGTGTGCTTTGGAATAGTCTTCCTACTTTATCCTAGG
AATTTCTACTCGGTTTCACAACAGGTATATCCATCTCCTACTGTTAGAGGCAATTCCCCT
ACATCTCTAGGTGACCCATATTTATCCCCTCTTTCGTGCACCCACTTAACCCTGTACTAA
TCAAGACCCATCACATTTTACTGCATTGTTTTCTGTTTTTAAAAGGGAGGTCTTATCTTT
TGTTTCCTCAGTGCCTAGCACACATCTGTTAAGTGACTGGGTTCCATCAATTTCTTTCAT
TGTACGGTTTAAAGTGATTTAGATTGTCCGGATTCATGACATGCTGAACGGCCTGGAAGC
TTCCAAGAGTACTACTGCAAAAGAAAAACCGAGTTCTGAGTCTGGAGAAGTCTCCGGACT
TTTCCAAGGTCACCGTCAGTGGTGTCTCCCCAGGCTACTACTTCCCCAACCCCCGCCCCT
GAGACTGTCAACCTACTTCAAAGTCCTATCTAAGGTGAGAGCCCAAGGACAGTCAAAAAC
AGCCCACGTGCTTCACAACAGGAACTCTGCCCCTTTCTTAAACGTAGTTCCGCCAAGTAC
TCTCTCCAATTGACATCGCTGTTGTCCAATTACATTTCGAGTTTCTGAGGGTTGTCCCTT
ACCAGACAATATCCAATGAAAAAGAAGGAATTCAGATTGGCACCAATTTTGGCCAATGGT
TGAAAAGATCAGAGATTATTAACCTATAGGAGCAGCACTGAGAGTGATATTCAGCAAACT
CATCCAATGGACTTGCTTACTGAAGAGTAGGCCTCTCCCCAACGGCGGGGGAGTTGGCGG
CCCGGACCGCAGCAGCGCTCAGTCCCCACCCGAGCTCCGCCATGTTGGGTTTCGTGGGCC
GTGTGGCCGCTACCTCGGCCTCCGGGGCCTTGCGGGGACTCAGCTCTTCAGCGCCGCTAC
CCCAAGCCCAGGTCTTACTGCGGGCCACCCCGGCGGTGCTCCAGCCTGGTAAGTGCCTTC
CTCTAGGAGCTAGGGTTTTTTCTGCCGCCCCATGACCTTGAGCCGGGGGCAGATTTTCAC
TTGGGCCTAAAAGCTGTCTCTGGTGTTAGAAGGACGTCAGGGCCAGCGACCTGCCCTCTA
ATGGCGGGAGAACCAGAATAGGACGCCCACGGGAGCTTTCTTAGACCTAATTCGTCTCAT
TTTGGAAAAGGAGTTCTCTGTGACGGAAAAGTGCGGGCAGGTGCACTGACCTTCCTGTGA
ATGGGGGCACTGAGCTCTCGAATCATGGGGTTTTGTGCATGGGAAAATTGTGCAGACGCA
TTCTCGGTTGTTGCGCGGCCTTCCCTCCGGACTCGTCTTACTAGCAAGCGAGACGAGGCC
GGTCATGGGCCGAATTTACCAGTTCTTGGGGGTTAAGACGGGGCTTCCGATTACCACTAA
CAGCCCTGACCCCGATTTCTTCCAATCTTTTTTGTTTGTTAGCTAGAGACTATGCCGCCC
AAACATCTCCTTCGCCGAAGGCAGGCGCTGCCACCGGGCGCATCGTGGCAGTCATCGGTG
CTGTGGTGGATGTCCAGTTTGATGAGGGACTACCACCCATCCTAAATGCCCTAGAAGTGC
AAGGCAGGGACACCAGACTGGTTTTGGAGGTGGCTCAGCATTTGGGTAAGTAGAATTTGT
TAGAAATAGTAAAGAGCTTGTTTAGTCCAAATATCCCCCACATCAGTCTTCCTTCTATGA
TGATTTTATCAAAATGACTTTCGTTCTTCTGAGTATGCTGAAGCCACATTTAGGTACTGA
GAAGGAGTCTTGGTTGATTTAGGCCTTTCAGCCAGCTGAACTTCATCATATGAAGCCAAC
TTGTCCTTCTGTATAACCTGCAATGCCTTTAACAGGTGAGAGCACGGTAAGGACTATTGC
CATGGATGGTACAGAAGGCTTGGTTAGGGGCCAGAAAGTCCTGGATTCTGGTGCACCAAT
CAAAATTCCTGTTGGTCCTGAGACCTTGGGCAGAATCATGAATGTCATTGGAGAACCTAT
TGATGAGAGAGGTCCCATCAAAACCAAACAGTAAGTATGCCTCCTCCTGTATCTACATGC
AAAGGAACTGCTTTTTCTGTAGGTTGTTTTGGGGTTTTTGTTTTGTTTTAAGTAAGCTCT
ACATCATACCTGGGGCTTGAACTCCAGAGGCACATGCTCAAGTAGACTGAGCCAGTCAGA
CACCCCTCTTGCAGTTTTGTACATTAAGGCAACACCTAGTGTAGCAAAATTTTCCTGCAG
AGAATACTTAAAATGCTGATACTGTTATTAAAACCACAAATGTAGTTTTTTCTGAGGAAA
ATTGAGAATGTAGAAGTTCTAATTTTAGAAAACTTGATTCTTCGACTCAAATTGATTAAG
TGACTTTTAATACCAATGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCTTTATTGCAGAACATTAGGCTAGGTGCCACATGACAACTT
GTCTGGAGTGTTATATAAGAAGTGAGAGGGGCACCTGGGTGGCTCAGTCGGTTGAGCGGC
TGACTTCTGCTCGGGTCATGATCTCGCAGTCCGTGAGTTTGAGCCCCACATCAGGCTCTG
TGCTGACAGCTCGGAGTCTGGAGCCTGTTTCAGATTCTGTGTCTCCTTCTCTCTGACCCT
CCCCTATTCATGCTTTGTCTGTCTCTGTCTCAAAAATAAATAAACGTTAAAAAAAAATTT
AAAAAAAAAATAAGAGGTGAGACTATGAGACTATGAGAGGTGAGAGGTAAAGGGTTAGAA
TTGGGAGGAAACTTTCAACAGGATGAATAGACCCTGCTCCTCTTTTCCAACCTTTACAGA
TTTGCAGCTATTCATGCTGAGGCTCCTGAGTTCATGGAGATGAGTGTTGAGCAGGAAATT
CTGGTTACTGGTATCAAGGTTGTGGATCTGCTGGCTCCCTATGCCAAGGGTGGCAAAATT
GGTATGTTACTGGTGGTACCTATTTTCCAAACCTAACGTGGGAAGAAAAAATCCTATCAT
GTAATGAGTGGGTACTGAGATCTATCCCTCACTGATGAGTAGCTTCTGACTTTCGTTCTT
CTGAGTTTGCTGAAGCCAGATGCCATTCCTGAGAAGGGAAAAGAGCAAAAAGGGGTTTTT
TTTTGTTTTTTGAAGTTTGCTTAATTGGGAACACAGCACTCAAATATTGCTTCTTTTCAA
CCTCTTCCAGGGCTGTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTA
ATCAACAATGTGGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGG
ACCCGTGAAGGCAATGACTTATACCATGAAATGATTGAGTCTGGTGTTATCAACTTAAAA
GATGCTACCTCCAAGGTAAGGAGTAAGCTGATTTATGTTCACATAGTAGTTGTGCCAGGA
AACCATTTTAGTTGACTGCAATGCTAGCTGAAACCCTGTGTTAGAGTTTCATTTTAGTGT
CCTAGGACACTTTTTTTTTTTTTAAACTTTTTTGTAATGTTTATTTTTGAGAGAGAGACA
GTGTGAGCAGGGGAGGGGCAGAGAGAAAGGGAGACACAGAATCTGAAGCAGGCTCCATCC
AGGCTCTGAGCTGTCAGCAGAGCCCGACGCAGGGCTCGAACTCACAGACCGTGAGATCAT
AACCTGAGCTGAGGTCAGAAACTTAACCCGACTGAGCCAACCCAGGCGACCCACAAAGGA
AATTCTTGACAGTGTTTTCCCCCAACAGTCTAATACATTAACACACATTTTCTTTTCTCT
TTGATATCAGATTACATTTTCAGACTTTGTTTTTAGTAGTCCCATCATTTGAAAGTTAAT
TTTGGGAAGCTGGAGGTAATTCAGATATCTCAAATAGCCCTATTTTGTGCCCTTCACTTA
GTCTTATTTCCTATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACCACCT
GGTGCTCGCGCCCGGGTAGCTCTGACTGGACTGACGGTTGCTGAAATACTTCAGAGACCA
AGAGGGTCAAGATGTACTGCTCTTTATCGATAACATCTTTCGTTGCACCCAGGGCTGGCT
CTGAGGTAAGAGAAGAAGGTTTGGGAGGATCTGTTTCATTTGACCTTTTTATGGAATGAT
GCAGATGAGGCTAAAGATGTAGACACCTAAAACCTGTGTTCTCATTCCCCCTTCTTTTCT
TTTTTTTTTCCTATAGGTGTCTGCTCTATTGGGTAGAATCCCTTCTGCGGTGGGCTATCA
GCCTACCCTGGCCACTGACATGGGTACCATGCAGGAAAGAATCACCACCACCAAGAAGGG
ATCTATTACCTCTGTGCAGGTAAGAAAAATGAAATGGATGAAGGTCTAATTTATGTAAAG
TTAGATACAGAGAAATATAAAACCTAGTTACTTCTCTCTCGAGGTTTGTTTTTATTTTTT
TTAATGTTTATTTATTTTTGAGAGAGAGACAGCACGAGTGGGGGAGGGGCAGAGAGAAAG
GGAAACACAGAATCTGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGATGCAGGGCTC
GAACTCACAGATCGTGAGATCATGACCTAAGCCCAAGTCAGACGCTTAGCCAACTGAGCC
ACCCAGGTGTCCCTCAAGGTTTTTAACAAGGTTAATGAGCTCCCTGAAATAATGTGTAAT
ATTCTATGGATTCATGTTAGAGACTAAAAAGTTAAGAAATGCTCCTTTAAGGTAGTTAAA
GGCATGTATGTGAATGTAGATTACAGAGTGTAGTGGTTTCCTAGCCTGAGGAGTCTGGGA
GATGCATGGAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAATG
CTAAGAAGTTGTAATGAGATAATGAGGAGAGGTCAGAAAGGCGGCGTGGCTTTTGAACAG
AATTATTTGGCTTCCTGCTGTTCTTCATGGGTTCTTGACTCACTCTAGGCTATCTATGTG
CCTGCTGATGACTTGACGGACCCTGCCCCTGCCACTACCTTTGCCCATTTGGATGCTACC
ACTGTGCTGTCCCGTGCTATTGCTGAGTTGGGCATCTATCCAGCTGTGGATCCTCTGGAT
TCCACCTCTCGAATTATGGATCCCAACATTGTTGGAAATGAGCATTATGATGTTGCCCGT
GGGGTACAAAAGATCCTACAGGTGAGTACTGCAGGTGAGATCAGTGACTAGAAAATCATA
TAGTGGGTATATGGGTACTATATTAAGACCAAAGCCTTCCTGGTGACTTGTGTGATTTGC
TTTGGAGCAAAGAGGAGACCTGCAATTTCTATTAAAGAGTATTAATGAGGGTCTCTTGGG
TTTCCAGGTACTTAGATTTAGAACCCATTTTTTCCTAATGGCAGTAGACTAGAAGTGGGG
AGAATAAGACACTGATCTTAGCTGAGGGCCCTCATGCTTCCAAGCGTGTAATTTCACCAC
TATTTCACTTGCAAAGTGAGGTAATGTGCTAAAATGCTTTGTACTAAGCTCAGTGTGAAT
ACAACGTGGTATTAACCCTGAGGTTTTTGTCCAAATTTAAAAGAATCTGAATATTTATTC
AGGCCTCCTGTTTTCTCACAGGACTACAAATCTCTCCAGGACATCATTGCAATCCTGGGT
ATGGATGAACTTTCGAGAAGACAAGTGACTGTGTCCCGTGCACGGAAAATACAGCGTTTC
TGTCTCAGCCATTCCAGGTTGCTGAGGTTTTCACAGGTCATATGGGGAAGCTGGTACCTC
TGAAGGAGACCATCAAAGGTTTCCAGCAGATTTTGGCAGGTGAGACTGCCAGTATAAAGC
TGAATATAAAATAGCAGAGAAGCTGAAATCTCTTTAATGTTCACTGTGCTATGTTCCCAT
GCCAGCCATCATCAAGCAATGTATAAGCATGTTGTGCCTAAAGAATTTTTTTAGTTAAAA
ACTATCGTCTGTCAGTGTTCTTTGGAAATAGTCTACTTCTGAGAGTGAAACTTGTATCAC
TTGATTGTTGTCATCCAATACTCAATACTTACTGAGTGCTTTCAGTCCTAGCTACTCTTC
TGAGTGAATTACAGATCCTTGTTTTTACAAATTAGGAAAATTGAAGCACAGAAAAGTTTA
AAATAACAGGTTTTGATACCATCCAGCCAAGGTAGAGAGCAAGAATTTGAACCCAGATTA
TGTGGCCAGGACCATTTATTCTTAATCCCTGCTATATCGTCTTGTAAATTGGATTTAAGA
CAGAAGTTTGTTAAAAGATTTCTTGGATGACACAAATTTACCGTATTCTGACTGGTCGCC
CCAAGTGGTGAAGTATTTATATACCACAAAAAGTTTATCTTTCCACTTCTCACCATTGAA
TTTTTTTCCCATACAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGA
CCCATTGAGGAAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCTGAAGAGTATTTAAAGGTTTCCAATAAAATGTACACCTGTCAGAATTGG
TCTGTTTTTCTTGGTCCTGACAACATAACCAACACTGAACATTAGAGTGGCTGTAAGAAA
CAGCACAAAGTAGACCACATATGTTTGAAATGGGGTCATCAAAAATGAAAAGCCATTGTC
TTGATGGACAGCTGTGGGTCTTGTGAGGGGTTCCCTGTAGATGATGTGATCTCAATAGTA
GGGCCTCAGCTTTGGCCTTTTTGTTATTTGTCAAAGCAAATTATTTGCTTCTTGAATATT
CTATGTAGTTTATTCCTGCTGGTTAAAAAGCACGTATTTTTTATTTTTAGAAGAGTATAT
TGTGGAAAAATGGGTCTGGAGGGGACTATTCTAAGACAAAGCAGGGGTTAATGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1602..1784, 2015..2189, 3239..3360, 3610..3794, 17274..17324, 17326..17392, 17394..17404, 17536..17658, 18348..18560, 18981..19031, 19036..19044, 19047..19079, 19082..19178, 19756..19814
1001..1127, 1602..1784, 2015..2189, 3239..3360, 3610..3794, 17274..17324, 17326..17392, 17394..17404, 17536..17658, 18348..18560, 18981..19031, 19036..19044, 19047..19079, 19082..19178, 19756..19814
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved