Felis_catus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Felis_catus CWF19L1
Felis_catus
CWF19L1
GeneScaffold_564
SNORA12
28953..29100
30420
TTAGTTGTTCAGGAATGTGCTGTTTAATTTCCATGTATTTTTTAAACTTTCTAATTTTC
TTCCTTATTTTTCATTTAATTTTAGTTTCATATCATTTAATTAAAAGTATTTTTTATTTT
GAGAGAGCGAGATCTCATGCATGAGCAGGGGAGGGACAGAGAGAGTTGGAGAGAGAGAGA
ATCCTAAGTAGGCCCCATGCTGTCAGCACAGAGCCCAATGTGGGGCTGGATCTCATTAAC
CTCAAGATCATGACCTGAGCTGAAATCAAGAGTTGGACACTTAACCAACTAAACCACCAA
AGGTGCCCAAGTTTTGTATCGTTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACTGCTGTCCCTCGCGCTCTCCGTAGATAAGCGAACCCTCATTGGC
TGGGCGCGCCCACGTCTTAGTGCTGTGCCGCCGCGTTTTCGAGGAGTACGGGTTCAGGGT
CCCGTTTTCGGTGGTCGCCCGGACTCAGGCTGTTGGCACAAATGGCTCAGAAACCGCTGC
GCCTGTGAGTGACCACAGATCAGATCAGATCAGAACCGTGCGCGCGCGCCTCTGTGTGTG
TGTGTGTGTGTGTGTGTGTGAGTGTGTGCGCGCGCGCGTGTCTGCTCCCTGGGTCTTTCT
CGTGACTGGAAGGGAGGAGGAAAAGGCGGGGGTGGGAGGGTGGTGGCGGCTGGTGAGCTC
CGATCACGTCTTTGCCTGGCTGGGGCCGGTCTCCTCGCTTCCGAGAGGAGGCTGTCCTGG
CGACCCAGGCTAGGAGAGGCGGAAACTGCCAGCGTTAGGTCTCCTCCATCTTAGGCCGCC
CTGGCCTCTGACACATTTACACTTCACTTCTCCCCACAGCCCATTTATTAATGAAATCTC
CTAGGCGTGGGGCCCATCGGTGGGTCCTGGTCAGTTACGAATAGACTAGATAGATAGGGC
TCGTGCGCTGGCACACTTTTTTGCGAGGAGGCGCCGGGGTGAAGAGTGTACATCGATCCA
TCCATCCATTCATCCACTCAACAAATATTTATTGAACAATTACAGTATGCCAGGCACTGT
GCTAGACGTTGCACAGATGGAGTTCCTGCCTTAATGGAGCCTAGAGTTTTGAGCTAATAT
TAATCAGAGAATCCAGATTAATGTATAATTACGGTCTATAAAAGGAAGAGAAACTTCACG
GTCATGGGAGGGAGTATAATAGGAGTATTTGGCCTATTGTGAGGAATCGGGGGAGGGAGG
ATTGAGCGTTGGTTAATATTTTTGTCTTTATCCTAAAGTCATTGAAATGTTTAAGAACTC
CTTGGCGGGATCATATTTTTGTTTTGGAAAGCGATTCTGGCCGCAGTGTAAGAACAAATC
AGAGCCAAAGAAGAAGACAGCGAGGATTAGCTAGAGTGATAGCAGAAGAAAAGTGCAGGG
ATTCAAGGCTTATCAAGGAGATGAGATTAACAGGGTTTGGAGAAGGTTTGGCTGTGAGAA
AGAGTCGGCACTGTGAGGTCCTAAATTTCTGCCCTTCAGCAGGATAGAAAACACTGGAAA
AGGGCCCCGGTAGTGGGGTTCTCTTAATGTTTTTGAGGAAAGAACATTAAACTGTTGGCT
TTATATAGGTTGGTTAGGAAGAAGAGATGGCATTAGAGGAAATAAACGTAAGCATGCTAC
TTACTTTGTATCCAGTACTAGATTCATTAGATCTCTCTCTGATTCTGCCTCTTTTCTATC
ACAGGACTCTTGGTTGCTCTGCCTTGGAGTGTCCTGCATTCCTCTTCCTCCCTCATTTCT
CACCCTACTTCACCATTCAAATTGTGTTCAGGTGTTCAGAATTCTAAATTTTTCATCTGT
TTCTGTCCTTTTCGTCTTCATTGAGTATTGCCCTTTTTGGTGATATTCTTGCTTGTAATC
ACTTGTTCCTCCAGACCATCCTTCACTCTGTTACTAAAATGAACTTTCTGAAACGTGTCA
TTACCCAGCTTGAAAACGTTCAGTGATGGGGTGCCTGGATGCCTCAGTCAGTTAAGCGTC
CGACTCTTAGTTTCATCTCAGGTAATGATCTCACAGCGTGGGCTTGAGCCCTGCATCGGG
CTCTGTGCTGACATCATGGAGCCTGCTTGGAATTCTCTGCCTCTGTCTCTGCCCCTCCCC
TGCTTGCTCTCCAGCTCTCAAAATAAATATAAATAAACTAAAAAAAAAAAAAATGTTAAG
TGATATGGACATACCAGAAAGACATACTGACAAAACAATAAGAACTATATTTCATGATGA
GTTCAAAAGCTTTAAAAAATGGTATGAGAAATAGAAAAACTTAGGTCAGATTACAAAAAC
TCAGAAATGAGATGATAGAACAAGTTACGTCACAATTTAAGGCCAGTTCTTCTTTATAAA
CTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAGGTGGAGCTGC
CCACTGGTCAGTAATAGTTCACATGCACTGAACCTCTCTGGTAACCTCTGGTAACCCAGA
GACTGAACCTCTGGTGACCCAGAGACTGGGTCACATATCTGCCTGATCCAGAAAGACTAA
CATGTTACAAACCCAGCTGGCCCATTCAAGTTTCCTCAATTGCCCTAACATTTGTCTCGT
TTGCAGCTTGGCTTGTGGAGATGTTGAAGGAAAGTTTGATGTTTTATTCAATAGAGTTCG
AGCAATTCAGAAGAAAAGTGGAAACTTTGACGTAAGACATTTCCTTTTACTGAATCTAAT
TTTACTGTTATAGTCAAACATAGTAAAATAAAGTGTGGACTTCTTTTTTCATTTCTCGAC
TGAACACATACTCTCCCTTTTTGGTTAGATTGAGTTCCTTTCGTGAGCACAGGAACTTAG
TAGCTACAGAATGATAGGGAAAGGGAGACCTCTTTACCTTTTTATACTTTTTGAATTTTT
TAATACTCCCCCCCCCTTTAATACTTTTTATACTTTTATACTTGTTACTTTCTTACTACC
CACAAAACTGAAAACAGATGAGCAAAACGTTCCTAGGTGATTCTGATCACTGGGTTTGGG
AATCGCAGATATATTTCCTGAGGGTATGGTATGGATTAAGTCAGATAACATGTGCAGATG
CTTCACAGACCGAAGAGCCTTATCTAAATGTTACATGGGGTTGCCAACTAGACTGCAGAC
CCCTAGCATACAGAGAGTATTCTGGGTGTGGCGATAATCTATTCATGGGGTTAAAGATTG
AGTAAAGATAACAGGCAAGAAATGTGTTTTTTGTACCCTGTATCTTCCCAGGGTATCTAA
TACTTAAAAATTTGTATTTGGAGAGAGACTCGTGGAAGTAGATTTCTCCATCTTTCCCTG
ACCCCCTCTTCCCCATCCCTAATTTGAATTTGATAGCCAGTGAGCCAAAATTTATTAATT
TATAGATTCAAATTAACTTCTGAAATTGCTGCTAAAGAATTATGTGTTGAGATTCTGCAG
ACTGATTAAGGAAAAAAAAAACCTAGCGTGAGGCCATTAAGTAGGATAATTAGCTGAATT
ATGTTAACTATCAATTATGTACTATTTGATAAAAAAAAAATCTCATATATCTGTTTAAAA
AACTCATTTTAGCTGCTGTTGTGTGTAGGAAATTTCTTTGGCTCCACTCCAGATGCTGAA
TGGGAGGAGTATAAAACTGGCATCAAGAAAGGTATAGAAATTATTTTTATTTAACAAATG
AGTTCTAACAAAGCTTTAAAGTTACACAGTTCTTGATGGGTTGTTTTTCACATGTAGTAG
TTATTTAAGAATTTCCCTCTGAGCTCCACGTTGAGCTGGGAAGGATGCCTGTGCATCTAA
ATGTTCACATTTTGGGGGCGCCTGGGTGGCTCAGTCATTTGAGTGTCCAACTCTTAATTT
TGACTCAGGTCATGATCCCAGGGTTGTGGGATTGAGCCCTGTATCAAACTATGCACTGAG
CATGGAGCCTGCTTAAGATTCTCTCTCGGGGTGCATGGGTGGCTCAGTTGGTTAAGTGAC
CCGCTCTTGATTTCAGCTCAGGTCATGCTCTCACAGTTCATGAGATCGAGCCCCCAAGTC
AGGCTCTGGGCTTACAGTGCAGAGCCTACTTTGGATTCTCTCTCTCTCTCTTTCTGTCCC
TCTCCTCTCCTCTCCTCATGCAGCATACTCTATCGAAATAAACATTTTTTTTTTAATTTT
TTTTTTTCAACGTTTATTTATTTTTGGGACAGAGAGAGACAGAGCATGAACGGGGGAGGG
GCAGAGAGAGAGGGAGACACAGAATCGGAAACAGGCTCCAGGCTCTGAGCCATCAGCCCA
GAGCCTGACGCGGGGCTCGAACTCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAAATAAATAAAAACATTGAAAAAAAAAA
TTAAAAAAAATAAAATAAAATGTTCACATTTTGAGTTTGGGTGGATTTGGTTTAAAGAAA
TAATTCTCTTCTAAGGCAGGAATTGAAGAAATGGACCATATGTGTCCTTTCCTTTTTCTA
GTTTGAGTGTTTCTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTAT
GAAGCTCTTTAGGGATTTGTGTTTTCCTTATTCTACATTAACCATTCTCTTTAAGATGTC
ACTTCGTCAACCTAGTGACACTAATAGGCCACAGGTTGGGTAGGATATGTTCCACAGATA
GGATTGCAGACTCCTTACTTTTGCTGTGATTATTTTTTCTGTGGGGAAATACTTCTCAAA
TTCCAAATCAGATCTGGTAACTATATGGTGTCATGTCTGTTTCTCTCACTAGCTCCTATT
CAGACATATGTGCTGGGTGCTAATAACCAGGAAACAGTGAAATATTTCCAAGATGCTGAT
GGGTGTGAATTAGCTGAAAACATTACTTATCTGGGTAAGTTCATATTTTTTGTGTTTGTA
ATGAATATAATAAAGTGTCCCCAGGAATTAGTCTCCTGGGAAATTTGTGGCTGAATTCTT
CTGTCATTACTGCTGAGAAAATGGGGTTCTTTCCCCAAATCTGTGTCTATACCCTTAAGA
CTCTGACATTTTTTTCTTTGTAGTCTCTCCCACCTCCTCCCAATCTCCTTGTACTCCCAC
AACCCAATATATACTTGTGTGGCCAACTAGAGGAATAAACTACTTGACTGTGGTATAGGG
ACTACTTAGGGTATAAATTATGTTGAAAAAAATTCCATGTATGTTGTCTCACCATGTAAC
ATTGCTAGATATATACAACTTGTTTATTAGGATCCTCACTAGCTGTAGCTCTGTGTCTCA
TTAAACTTTTGGTGCTGATTTTAAGTTTTCGGTGCTGATCCTCACATTTTTTCACTCCTT
TTGTCCTTTCTCTGGTTCTTGGTCCACTTTTGAATTGTGGGTTAAAGTCGTTCCCTTTTG
ACCCTCCTGAATCTCTTTTAGTGATTCTTTTAATGCCTGGCCATTTAAAAAAGCACTGTC
AGATTTTGTTTTTGCTTTCCCCTCACCTGCTGTCAGTCTATGACTTCTTGGATCATTCAA
CTTACTTTTTCCTAAAATGACTCCACTGCTCTTCACAGTTCTTTTTTCTTGGTCTCTTAC
TTCTCTGGAAAGCTTCTACATTTCCTTTGCTGTAGTGTCCTCCCCATCCTTCCCCACCAT
AGTCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGAACTTGATAGTGAACATG
TGATAGTGAGCTTGAAGTGTTGGCGGTACATCCAACATGTCATTGGAAGTGATCTTTCTA
GAGTATATCAACAAGGTCAGTGTGGAAAAATGGGTTTTGGGGAGTTGGTCCCTTAAAGAT
GGAAAACAAAGCTGAGAAGGATCAAATTGTTTCAGGGGAAATAAAATGAGAAGGAAAGCA
CCACGCTGTGGTGGGGGTATATATCTTCATCTAGGCAGCAGGCAGGATCGCTGAAAGCGA
TTAGAGCAGTGTTTGGGGAGGTAAAGATATTGTCAAGTTCATAGACTCTAAGTGAAGAGA
GACTGATTTGGGAGGAGAGACCATTGACAGTTACAGGGTGATTCATGACCTTTCCGAGAA
TGGTGGGAGATGGAAACCAGAGTACAGTGGGTTCAGGAACTAAGAGGTAAAGCACTTAGA
GAGCATGGGCTGCTCTTTTGAGAAATTGGAAACAGAAGAGAAAGGAGTTTTCAGTTAGTG
TGTGAGTTCTTTTATTAGTTTTTTATTAGTATCTGTGTTCCTTTATCAGTTAGTATGTGT
GTTAATTGGCATGTTCCTTTAGTAATTAGTATGTCTATTAGTATGTTTAATACTTTATTC
TTTTCTGAGTGGAAAGAGCCAGCTGAGAAGAGGAGACTGAGTAGGTGAAAGGAAGGTGAA
AATTGACAGAGCGAGGTCTTGAAGGCAGCAGGAAGAAACAGGATCAAGGGCCCAAGCCAG
GAATAAATTTAAAAAAGGGTAGAGTCTCAAGTTTTTCCCAGTTGCTCTTTCCAGATGTTT
TCCATCCATTGGAAGCCGCTGCCTGCATGAAGAGTATGTGTATTCTAGACTGAACTTTCC
TCAGAACTGCAGTTCCTTTTTCTTATTATGTCTCTCTGGGTCCAAGTGTCTGGGTTTCTT
TCTTTTTCTTTTTTTCTTCTTTTTCTTTTAAAGTTTATTTATTTATTTAGAGAGAGAGAC
AGTTTGAGTGGGGGAGGAGCAGAGAGAGAGAATCCCAAATAGGCTCTGCACTGTTGGTGC
AGAGCCCCATGCAGGGTTCGAACTCATGAACTATGAGATCATGATCTGAGCTGAAATCAA
GAGTCAGGTACTTAACTGACTGAGCCATCCGGGTGCCCCTCTTTTTTTTTTTTTTTTTTT
AATGTTTATTTATTTTGAGAGAGATAGTGAGAATGAGGGGTGGGGCAGAGAGAGAGGGAG
AGAGAGAATCCCGAGAAGGCTCTGCACTGTCAGTGCAGAGCCCGATGCGAGGCTCAATCC
CACAAACTGTGAGATAATGACCTGAGCCAAAATCAGGAGTCGGACACTTAACTGACTGAG
CCACCCAGGCACCCCTGGGTTTCTTTTAATCCATGTAGAATTTCTTCCAGAAGACAGGAA
GGCTTTTTCTTAATCACTGCTTCCCAACTTTTTTCATTTGTAAGGCATCTGAGGTAAACA
GACTGGCCCATGGGCTCCAGTGGCCTCCACATAAGGGCTGCTGTCCCTGAACAGGAACAC
AGTTGTAGCCATCCACCACTGAGACCCTGCAGCCAGAAGAGGGACTCTAGAAGAGTCTGT
GCTTATTTAGACATGCAGAATGGCAGGGAGGTAGGCAAGTCATGGCGGGGAGAGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAGGGTGTTGATATCTTGCTCA
CATCCCCATGGGCCCAAGTATGTGGGGAACTTTGGGAATTCTTCTGTGAGTAGTGCTTGT
TCAGTTGGAATTTCTGTAAGCAAATTGCACTGGCTTATTTTGGGCTCTTTTTGCTCTTTG
TATTGAATATTTCAGCTCTTAGGACCTTTCAGTAGAAATTTTTTGTAAATTGTTTCAGGA
TACTTAAAAGTATATCAATTAACCAAAGCAAAAACTTTAAAACAGATTGATCTTATGAAA
GCACCATTCACAGATGAGATTGCTAAAATTCTAATTATAAGTGAGTTATTCTTTAAATTA
TTTTCTCTGCATCAAGTGCCTTCTTTCAAGCTTCCTCTTAATGTGTTTTGAGGGATTACT
AATTTTTAGTTAAAAGATTTACAGCTAGTGGCAGCTCTTTAGTTGTATCCCCCCTCTCCT
CCCCACATTCCATTGCACATTGTAGTATTTTGGCTTTTAAAATATTTTTTTATTTCCTAG
TTTAAATTTTTCCTAGTTTAAATTTTTTTAACTAGTTAAAAAAAATTTTTTTTTTCCAAC
GTTTATTTATTTTTGGGATAGAGAGAGACAGAGCATGAACGGGGGAGGGGCAGAGAGAGA
GGGAGACACAGAATCGGAAACAGGCTCCAGGCTCTGAGCCATCAGCCCAGAGCCCGACGC
GGGGCTCGAACTCACGGACTGCGAGATCGTGACCTGGCTGAAGCCGGACGCTTAACCGAC
TGCGCCACCCAGGCGCCCCAATTAACTAGTTTAAATTTAACTAGTTTAAATTTAACTAGT
TTAATTTAACTAGTTTTTTCCTAGTTTAAATTTTATTTATTTTTGAGAGAGAGAGAGAGA
AAGGGGTGGGGGAGGGGCAGAGAGAGAAGGAGAGAGAGAGTCCCAAGTAGGTTCCATCCT
TCACACCAAACCTAACATAGGGTTCAAAGCCACAACCGGGAGATCATGACTTAGCCAAAA
TCAAGAGTTGGACACTCACTGACTTAGCCATTCAGGCACACTTCAAATATTTTTTTAATG
GATTCATTATGAGATCAAAGATAGCTGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGTGTATGAGGGCAGAAAGCATCAGCTGAGTTTCAGTGAAGGGAAACGTA
AGAATGCATTTAGAGACAAGCGTCAATTAGTAGATGCAGAGTTATCGGTAATGATCCAGA
AAAGGTCTTGTAGACCACTCTCTGCCAACTTCACGATGTGTCTGGACCAAAATAGCCAAC
AAGATACCAGGCCTTGTCAGGGGTGGGGTGTTGAAAGGAAAAGGGACAGTGCTGTCTTCC
CCTGCCATCAATCCATGGCTGTTTTCATCTAGAATTCAAGGGGCAGTGCTGGTTGCAGTG
AGAAGGTATGGCAAAGCTAGGGAAGATAGGAGGAGGACTAAGTTGCCGGTGGAAGGGAGG
AAGACACGTATAATACTCTGTGAGGAAGGATGAGAAAAATGAGGCCCCTTCATTTTGGGG
GTGCTAACAAAAGGATTTGATTAAAGTTTATAAAAGACTACATATCATCTTTATAGGGGA
GAAAACAATACAGTTTATCAGTCTCTGAGATACTACAACTAACCTCGAGGCTGATTCCCT
TCACTTCAGCAGAAACTTGAAGGAAGTGAGCATAAGTAAAAGGAATTTCTTGCTTTACTT
AGTAGAAAACTAATTTTGGTAATTTCTTTATTTGCAGCTAATACCTTCTCAAGTTCATAA
GTAATATGAATGAGACATCACATAATTTGTTGTTAATGAAAGCTAGGGATGTTTGGGGAA
TAAAGTTGATATTTTTGATGAACTTTATGTTACAAACTTTGACCAGGGTGTGGTTGTGCC
TTCCACAAACCACACCTTTCTTGACTGAAGCAAAATAAAGGATTGCATGCTTATGTCATG
AGGTCATTGAATATTCCATTCCAGATGTTCTATGGATCCTAAGGACCCTGGAAGCTAGCT
TTTAATTTTTATTTTTTTGCATTGACTCTGAATGTCTGCATTGTCAGAACTATGGATGTG
TAACAACGCAGATTATAGAAGCATAGTCTGTGGGCTCCAGAGGAGAGAGCTTGCTTTCCA
AAAAGATTAGAATAAACCCTGTTTTGGGTATTAGTATGGAGGGCTCACCTTACCTTTTAC
CCCCTGCTTCCTGCAGTTGTCCTCTCTGCACTTAACAATAGCCTGCTTCCTCTTCTGTGT
TTGAGGTTTCTCTGATTGCCACAAGTTGTGGCTATTACTCTCCAAATCCTACTGCCTACA
TTTGTATCGACATAAAAATTTCAAAGACATTTAAATTGTCCTATTTCTTTGCATTTCTTG
ATAACTCCTAGGTCTGTTATGATGACTGAGTTTCTTTTTCCTAGGGAGAAGTGGATACCA
AAAAATGTGGCTCTGCTTTGATCTCCGGTCTTGCCACAGACTTGAAACCAAGATACCATT
TTGCTGCTTTGGAAAAGACCTATTATGAGAGACTTCCCTATCGGTGAGTAGCATTTCATT
ATTTTGGCTTTTTGAAGAATTTGCCTTGGATCTTCTATGGGAACTTCTCTTGTTCGTTTT
AGCCATGTAACATCTTCGTTCCTTTTGGTTACTCAGGCACCGAAGTGAGTGGCTCTCAAA
TTACTCAGCTTTTCTGAGTTTGTTTCCTAATTAGAAATACAAGGGATTGGACTGTATACA
GCCCCTTAACAGTTTGAGCGTCTGAAGTAATAATACTGTTATCATAGTATTAATCATCAC
TGCTTTATGTAGCACAGCACATTAGGTCAAACCGGTACTCCTTGTACAGTCTTGAAAACT
CATTTCTCAGCATAAGCATGTCAGCAGTATTTCAGTTTAAGAATCAAGAACTTGTATCAA
TTTGTTTTTTGCTTTTTCATAGTTTGCGTTTGGAGGTCGGTTTTTTTTTTTTTAACCTAT
CCAACTTTTAAGGATCTGAATACACATTTCCTGAAAAACATACCAGTGGACCAATAGGCA
CATGAAAGATGCTCTTATCATTATCGATTAGGGTAATCCAAATCCAGACCACAGTGAGAT
ACCACTTAACATCCCCTAAGATGGCTACAAGCAAAAAGGCAAGTAATAAGTGTTAGCAAG
GATGTGGAAGCATCTGAACCCTGATGCGTTGCTGGTGTCATTGCTGGTGCAGGCGCTTTG
CCAAACTGTTGGCAGTTCTTCAAAAGATTTAAATATAGAGTTACTGTCTGACCCAGGAAT
TCCACTCTTGTTCCAAGTGAAATAAAAACACTAGCCCATGCAATAATTTGTACACAAATG
ATCATAACAGCTTTATTCATAATAGTCAGAAAGTGGAAACAACCCAAATATCCATCATGT
GATGAATGAGTAAAGAAAAAGTGATACATCCATACTTTGGAATGTTATTCAAGAAAAAGG
AATGGAATACTGATAGGCTACATGGGTGAACCTTGAAAACACTATGCTAAATCAAAGAAG
CCACACACACAGAAGACCGCATATTATATGATTCCACTTATTATAAAATGTCCAGAGTAG
GCAAATACATAGAGATAGAAAGTAGAGTCGTGTTTGCCAGGGGCTGGTTGGAGGGAAATG
GGAGTGACTGCTAATAGGTACAGGGTTTCTTTTACCGGTGATAAAAGTTTTCTAAAATTA
GATTGTGTTGATGGTTGCACAGCTCTGTGAATATGCTAAAAACTATTGAATTGTATACTT
TAGATGGCTGAATTATATAGTATTTGAATTAGATCTTAATAAAGCTGTTAAAAAAAAAAA
AAGACAAGCCTGTACAAGTTTTCAACCAGAGCAATAACAAAACCCCATAACCAGCACGAT
ACAAATACTAACATAGGTAAATTTCCACTAACATTTGCACCTGGTATTACAGTCAGTCCA
TGCTTTGCATTCCTGTGTTGTGGGTGTTACTGTGAGTGTTTTGCTTCCCTTGAGGAACAG
TTTATCATTAAAAACACCATTCAGAGGTAGCAACCTTCATTAGTCATTATTATTTTAAAA
TAAATGAGGGAAGCATCTTCACAGCTTTTTATGGGTACTTGCAGTTTCCCTGTAGTATTG
GTTTTCTATTGCTGTTGTAAAAATTGTCACACACTTTGTAGCTTAAAACAATATAGTTTA
TCATCTTACAGTTCTGTAGGTCAGACGTTTGACCCGGGTTTCACTGGGCTAAACTCAAAG
TGTTGGCCAGGTTATGTTCATTTCTGGAGGCTCTACAGGAGAATGGTTTTTTCCCTTCTT
AAGCTTGTAGAGATCATCTGTGTTCCATGGCTCATGGCCCCCTTACTCCATCTTAAAGCC
AGTAACTGTGGTTGAATGTTGTCACTCTTAACCTTCTGTAGTCACTCTCCCTCTGACTTT
TCCTCTTCCCTCATCTACTCTTTGTAAAAAATCCTAGCGTAATTAACATACAGTGTTATG
TTAGTTTCAGTGTACAATATGATTCAGCATTTCTATACATTATTCAGTGCTCATTGCAAT
AAGTGTACTCTTAATCCCCTTCACCTGTTTTACCCATCTCCCCACCTACTTCTTTGTAAC
TATCAGTTCTCTGTATTTAAGAGTCTGGTTTTTTGTCTCTCTTTTTTTTTCTTTGTTCGT
TTGTTTTGTTTCCTAAATTGCAACATGGGTGAAATCATTTGGTATTGTCTTCTCTGGCTT
ATTTCAATTAGCATAATACACTCTAGCTCCATCCATGTTGTTGCAAATGGCAAGATTTCA
ATTTTTTTAATGGTTGAGTGATATTCCATTGTATATATGTATACCACATCTTCTTTATTC
ATTAATTAACCAATGGACACTGGGTTGCTTCCATATTTTGGCTATTGTCAATAATGCTAC
AATAAACGAAGAAGTGCATATATCTTTTTGAATTAGTATTTTTGTATTCTTTGGGTAAAT
ATCCATTAGGGGAATTACTAGATCATGTAATAAATCGACTTCACATTTTTTGAGGAACTG
TTATACTGTTTTCCACAGTGGCTGCACCAGCTTGCATTCCTACCAGCATTGCATGAGGAT
TCCTTTTTCTCTACATCCTTGCCAATGCTTTTTTCTTGTGTTTTTGATTTTAGCCATTCT
GACAGGTATAAGGTACTCGTATGAAGGTACAGGTATAAAGAACTCGTTGTGGTTTTGATT
TGCCTTTCCCTGATGATGAGTGATGTTGAGCATCTTTACATGTGTCTGTTGGCCATCTGT
ACGTCTTCTTTGGAGAAATGTCTGTTCATACGGAGAAATGTCTGTTTTAAATTGGATTGT
GTTTTTGGTGTTGAGTTGTGTAACTTTTTTATATATTTTATCAGATAAGTCATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCCTAGGTATTTTATCATTTTTGG
TGTAATTATAAGTGGGATTATTTTCTTAATTTCTCTTTCTGCTGCTTCATTGTTAGTATA
TAGAAACACAAATGACTTCTGTACATTGATTTTGTGTCCTGTGATTTTACTGACTTCATC
AGTTAGTAGTTTTTTTGGTGGAGTCTTTAGGGTTTTATACACAGAGTATCATGTCATCTG
CAAATAGTGAGTTTTACTTCTTCCTTACCAATTTGGATGCCTTTTATTTTTTTGCTGTTG
TCTGACTGCTGTGGCTAGGACTTCCAGTGCTATGTTGAATAAAAGTGGTGAGTGGGCATC
TTGTTCCTGACCTTAAGGGAAAAGCTCTCAAATTTTCCCTATTGAGGATCATGTTTGCTG
TGGGTTTTTCATATGTTGAGGTATGTTCCCTCTAAACCTACTTTTTTGAGGGTTTTTATC
ATGAATGGATGTTGTACTTTGTCAAATGCTTTTTCTGCATCTACTGAAATGATCCTATGG
TTTTTGTCTTTTCTCTTGTTGATACGATGTATCACACGGATTGATTTGCAAATTTTGAAC
CATCCTTGCATGGGAGGAATAAATCCCACTTGATAATGGTGAATTATTTTTTAATGTGTT
GTTGGATTCGATTTGCTGATAATTCTGTTGAGAAATTTTGCATCTGTGTTCAGAGTTATT
GGCCTGTAGTTTTCTTTTTTTGTAGTGTCTATATCTGGTTTTGGTATCAGGGTAATGCTG
GCCTCATAGAATGAATTTGGAAGCTTTTTTTTGAAATAGTTTGACAAGAATAGGTATTAA
CTCTTCTTTAATGTTTGATAGAATTCATCTGTGAAGCCATCTGGTCCTGGATGTTTCGTT
TGTTGGGAGTTTTTTGATTATTGATTCAATTTCATTGCTGGTAATCAATCTATTCAAATT
TTCTATTTCTTCTTGATTCAGTTTTGGGAGGCTATATGTTTCTAGGAATTTATGCATTTT
TTTGGTTATCCAGTTTGTTGGTATATAATTTTTCATAATATTCTCTTATAATCCTTTGTA
TTTCTGTGGTGTTGGTTGTTATTTTTCTTCTTTCATTTTTGATTTTGTTTATTTGAGTCC
TTTTTTTTTTTTGATGAGTCTGGCTAAAGGTTTATCAATTTTTTGATCTTTTCAAAGAAC
CAGCTCCTGGTTTCATTGATCTGTTTCACTGGTTTTTTAGTTTCTATTTTGTTTATTTCT
TCTCTAATTTTTGTTATTCCCTTTCTTCTACTGGTTTGGGGTTTTGTTTGTTCTTCTTTT
TCTAGCTCCTTTAGTTGTAAGTTTAGGTTGTGTATTTGAGATTTTTCTTGCTTCTTGAGG
TAGGCCTGTGTTTTCCTCTTCCACTTTTTTTTTTTTTAATTTTTTAATGTTTATTTATTA
TTGAGAGAGAGAGAGACAGAGCATGAGCAGGGGAGGGGCAGAGAGAGGGAGACACAGAAT
CTGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAAAGCCCGACACGGGGCTCAAACCCA
CAAACGCGAGATCATGACCTGAGCAAAGTCGGAAGCTCAACCAACTGAGCCACTCAGGCG
CCCCTCCTCTTCCACTTTTTTTTTTTTAATTTATTGTCAAATTGGTTTCCATACAACACC
CAGTGCTCATCCCAACAGGTACCCTCCTCAATACCCATCACCCACCCTCCCCTCCTTCGC
ACCCCCCATCAGTCCTCAGTTTGTTCTCAGTTTTTAAGGGTCTCTTATGCTTTGGCTCTC
TCCCACTCTAATCTCTTTTTTTTTTCCCCCCCTTCCCCTCCCCCATGGGAGTTTCTCCTG
TTAAGTTTCTCAGGATCCACATAGCTCCTCTTCCACTTTTTTTTTTTTTAATTTTTTTTT
TCCAACGTTTTTATTTATTTTTGGGACAGAGAGAGACAGAGCATGAACGGGGGAGGGGCA
GAGAGAGAGGGAGACACAGAATCGGAAACAGGCTCCAGGCTCTGAGCCATCAGCCCAGAG
CCTGATGCGGGGCTCGAACTCACGGACCGCGAGATCGTGACCTGGCTGAAGTCGGACGCT
TAACCGACCGCGCCACCCAGGCGCCCCATCCTCTTCCACTTTTAAGGAGCCTTGTGATTA
TGTAGGGTTTGCCGAGGTAGTTCAGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTAGTATAATGAACCCTCCTATACCCATTACCCAATTTAAGCAATTATCAAC
ATTTTGCCAATCTTACAACTCTTTTAAAACCAAATATTGGAGTTTTTGTGCTTTTCAGAT
ATATGATCTCATTTTTTTCTAACAATAGCCCTGTGAAGTAGGGGTGAGTATCTTACTAGA
TTTATAGGTAACCTCTGAGATTATGTTATTGGTGGTGATAGACTTACAATCTGTGCTCTC
TTGTGGTCCTGTGGAGTGTACATATTTCATAACTGTAAGTCAGAAGTAAAGTTTGTTGCT
AATCTGTTATCTGTCAAATATATTATAGAAACCACATCGTTCTGCAGGAAACTGCACAGC
ATGCCACCAGGTTCATAGCTTTGGCAAGTGTTGGAAATCCCGAAAAGAAAAAGGTAAAGA
TTTGAGTATTTGATGGTAGGTTAATATTCATTGTCTGCCTGATAAATGTTTTTCTTGCCA
GTTTAGCATTCAGATCTTTCTTCTCCCCAATTGCAAGGTTCCAGCACTTTAGTGACTCCT
TTCTAAAGATTTGATAATAAAAAGTCAGGTTTCCTTGGGTCCTTTGTAGGAGATTTTAGA
GAAGGGTTTGGGAAAATAGGCCCGGTGGAACAAAGGCAAAATTTCAAATGAATGAAGTTC
CTTTCTTCCCATATCCATGTAGTTGTCTTTGTAAGTATTCATGAGTTTGCCCTCAGATGG
TACTCTTGCTTTGTTTCTTTTAGAAACTTCATTTAGCAGAAATAATAGAAGCCTTTATAG
GATTTACCTAACCGCTCCTTGGCTTTGGAAAATCTTAGTGATACCTGGAATCTATCTTTG
TACTGGAAAACAGTGCAGGTGAATGAAAGAGAATATACCAGAAAAGTATGTTATTTTTCT
CACTTCCCTGTGAGCATTTCTGATTCTCTAGGGTCAAAAGCAGGATATTGTAGATTGAGA
CAGCTAAAATCAGAATAATCAGGCAAGGGAAGAATAGCCAGATAAATAATGTGAAGATTA
TTCTGTAACGTGTCATAAACCACATGCACAGAAGAGATAAGCAAGTACATATTTTTTTTT
CCCATAGTTTCTTAAACTTTTAAGCCCAACGTGTTCTTAGTAAGTTTAGATTTGTGATTT
TTTTTTTATTGTAGCACTCACAGTATTTTCACTATTTTTATGATAGCGATATTTTACTAT
GCTTTATCTCAGGCCACGTTAGCCTCGCCCTAGCAGTCAAGTCTTTTGACTATAGTCAAA
AGTAGGACATTTTAATTTGGCAGCATTATTAAATTCATCTCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTCTCA
TCTAAAGATTTCAGTATCTGTGCCATTAGCATGAGTGTCTAGATACCTGTATGAATATTT
ACTTCTTTGCTATTAGTCCCTAAGAAAACCCATCAGCATATGCAGCAGAAATTGTATAAT
ATCAGAGGGAAACATCAAGGTGTCTAATTTAATTTTCATCAGAAAAAAAGAATGGCAGTG
CCACAATTCTGTTAACAAAAAGTACACAAAGATAAAGGAATCAGAGACAGAAGCAGGGTG
TCTGCAAGGGTTATGGAACAAGTCCCACCTGAGCCTTGTAGTTTTGTGTAAAAGCTGATT
TTTGTAAGGACTAGGGCTTTGATTTGTTTCTTCATCAGCCCTTGGTTAGCTTCTACGGAG
ATCACTAAATTGACATTTGATTTATTGTGTATTCTCTGAGCCATAAACAGGCCAGTTGCT
GTTCTTTTACTTTTACTCAGTTTCTGAAGCTTCTGTGAATAAATTAGGTTGGTTACATTT
GGATAAATGGTATTTTCCCTAATCTTATGTTTGTTTGTTTTTTCCTCCACAGTATCTTTA
TGCATTCAGTATTGTTCCCATGAAACTAATGGATGCAGCAGAACTGGTAAAACAGCCTCC
TGATGTTACTGAAAACCCTTACAGAAAATCTGGGAAGGAAGCATCCATGGGAAAGCCAAT
TCCTGCCCCAGAGGTATGTTCTGATTGAGAGGTGGTATTTTCCGGGCAGGACTGCCTATT
ACATACGTGCTTTTCCTGGTTATAGTTTAGCTCATGAGACCAGTTTAATCCCTAGAATCT
AAATCTTTTTTTTTTCCTTGGGAAATTATGATGGTGTTTAGAAAGGCTTAGTAGATTTCA
CGTAAGTGCAGTGTTTTTTATTGTAGCTTGGGGTTAACAGTTTCATATTTTACGTCCTTG
TCTAAACTTGGCTCGGGTGTTAGCATTGCAAATGTTGAGTCTTTCTTTGTCAAAGTTGAG
ACTTTAACTTTTCAGGCAAGGATCCAACAGCTTGGAAGCAATGTAATTTGTGATTTTATA
ACAAGTGCTAGCTGGTAAATAGGACTCACTCTGAAGAAATTTCCTAATAGCAGACTTTTC
TGAAATTAATTTTTCCCGCATTAAAGCAAGGAGTGTCAAGTTCCCTGACTAGTATGCATT
GTCCACTTTCTTAGACCTTTTTCTTTTCTTTTTTTTTTTTTTTTAACATTTATTTACTTC
TGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTAGCATATACTGCA
ACAATAATTCCGATTCCTTAATGCCCCTTACCCATTTAGCCCATCCCCCTCCCACAACTC
CTCCAGTAACCCTCTGTTTGTTCTCCATATTTATGAGTCTCTTCTGTTTTCGTCCCCCTT
CCTGGTTTTATATTATTTTTGCTTCCCTTCCCTTATGTTCATCTGTTTTGTATCTTAAAG
TCCTCATATGAGTGAAATCATATATTTGTCTTTCTCTGACTGACTAATTTCACTTAGCAT
AATACCCTCTAGTTCCTTCCACGTAGTTGCAAATGGCAAGATTTCATTCTTTTTGATTGC
CGAGTAATATTCTATTGTGTATCTATACCACGTCTTCTTTATGTATTCATCCATTGATGG
ACATTTTGGCTCTTTCCATACTTTGGCTGTTGTTGATAGTGCTGCTATAAACATTGGGGT
GCATTTTCCCCTTCAAACTAGCACACCTGTATCCCTTGAATAAATACCTAGTAGGGTAAT
TGCTGGGTCGTAGGGTAGTTCTATTTTTAATTTCTTTTGAGGAACCTCCATTTGTTTTCC
AGAGTGACTGCACCAGTTTGCATTCTCACCAGCAGTGCAAAAGAGATCTCTTTCTCTGCA
TCCTCACCAACATCTCTTGTTGCCTGAGTTGTTAATGTTAGCCATTCTGACAGGTGTAAG
GGGTTATCTCATGGTGGTTTTGATTTGTGTTTCCCTGATGATGAGTGATGTTGAGCATTT
TTTCATGTGTCAGTTGGCTACCTGGATGTCTTCTTTGGAGAAGTGTCTAGTCATGTCTTT
TGCCCATTTCTTCACTATATTATTTGTTTTTTGTGTGTTGAGTTTGATAAGTTTTATAGA
TTTTGGATACTGACTCTTTATCTGATATGTTGTTTGCAAATATCTTCTCCCATTCCGTTG
GTTGCCTTTTAGTTTTGCTGATTGTTTCCTTTGCTGTGCAGAAGCTTTTTATTTTGATGA
GGTCCCAATAGCTCATATCTGCTTTTGTTTCCCTTGCCTCCAGAGATGTGTTGAGTAAGA
AGTTGCTGCGGCCAAGGTCAAAGAGGTTTTTGCCTGCTTTCTCCTCGAGGATTTTGATGG
CTTCCTGTCTTACATTTAGGTTTTTCATCCACTTTGAGTTTATTTTTGTGTATAGTGTAA
GAAAGGGGTTGAGGTTCATTTTTCTGCATGTTGCTGTCCAGTTTTCCCAGCACCACTTGC
TGAAGAGACAGTCTTTATTCCATTGGATATTCTTTCCTGCTTTGTCAAAATTAGTTGGCT
GTACGTTTGTGGGTCCATTTCTGGATTCTCTATTCTGTTCCGTTGATCTGAGTATCTGTT
GTTTTGCCAGTATCATACTGTCTTGATGATTACAGCTTTGTAATACAGCTTGAAGTCCGG
GATTGCGATGCCTCCTGGTTTGGTTTTCTTTTTCAAGATTGCTTTGGCTATTCGGGATCT
TTTCTGGTTCCATACAAATTTTAGGGTTGTTTGTTCTAGCTCTGTGAAGAATGCTGGTGT
TATTTTGATAGGGATTGCTTTGAATATGTAGATTGCTTTGGGTAGTATTGACCTTTGAAC
AATATTTGTTCTTCCTATCCAGGAGCATGGAATCTTTTTCCATTTTTTTGTGTCTTCAAC
TTCTTACATAAGCTTTCTATAGTTTTCAGTGTGTAGATTTTTCACCTCTTTGACAGCCTC
CTCATCTTTTTAATTAAAGCTCAGTTTGACTTGATTGACCTGTGAGATTGTAGGGCTACA
CCAACGCACTACTAAGAGAGAGGAAAAGGCATTTGGAGGGCTTTGTATTGCTCTGTTTTA
GGCAAGAATTGCTCTATAACTTGCATTTTAACTTGCTTTTACAAAAAGATGGATTTGGTG
CTATTTTGGGTATGTGTTGAGAAGTATGACTGAGAGTCCAGGCATCAGGATTAGGAAGAT
ATTTTTCTTATCTAGAGTAGGTAGCAAGGGCCAGGAGGCAAGATAGATATGACATGGCAA
GAATGTTCCCTTGTGTGTGAATGGTTGACTCCTTGTCTAAAGATTAGTTTAATAACATTT
ACTCTTCTGCCTTTGGCCATTTCAGGAAGAATCAGCCTGTCAGTTTTTCTTTGATTTAAA
TGAAAAGCAGGGAAGGAAGCGTTCATCTACAGGCAGAGATAGCAAGTCTTCTCCTCACCC
AAAGCAGCCTCGCAAACCTCGTAAGTATCTTGGTTCCTGAAGTCTCCTGTGTGAGCAGTG
ACTTATTTCAGATCTTGTGTGCGACATGGCATTGCTAAGAGAGCTTCTTCTGGCAGAGGA
AAACTGTACAATGGGTCATTAAGACCAAAAATAAAATACTACTAAGATGGCCTGATTTTG
AGAATGTCTGAGCTGTTCTTGAAAGAACTGCGGGGAAAGTTCCTTCCCTTCCCTGGATGT
CTATAAAACATATGAGGTAAAGAGCCTACAAAACCCACGAGGTTCATAAAATAATAGAAT
AATCAAACTGGCAAAAAAGGAATTTAAGGTTATTTCATTGATACCCTCTTTCTCCACCCC
TTGTTTCAAAGTTGAAGAAGCTGACCTTGTTGGAGTAAACTTATTACCCAGAGTCATGTG
GCGAGCCAGTGGCATAGTTGGGGCTAGAATTGGGACTCCTGACATCCAGTTCAGTGGTCT
GTCATTGCAGCCTGTTGCCAGTTAAATGCTACTTTGGTCAGTATGTGGTCATCCACTTGT
GGTTATCCACCTGTGAATCGATTGCAGATTCAGAGCTTTTCTAATACAGGTTAGTTTCAT
TGATAAAAGTGCTGGGATCGCGGGGGTCACAGTAGAAGCACAGCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCCTGTGGTTTTGCAGTGCCAGTTTCACAAGATT
GCCCCCTCCCTACCTCCCTTTCTGACAAATAGGTGTATCTCCTAGGGCAATGGTTTCGTA
TACTTCTTGACCTTCTTACTGATTCATACTAAATAATTACATAAAAGACTAGTGATAAAT
TCTCAGTTTTGCCTTGTAATAGAGGATATAGCTTCCTAAGAGAAGAATACCCATATCCAC
ATTCTTAGTGTGGGTAACTGGGAACCCAGGATAATAATTACAGGGTTGCTTGGTAAGCAC
TGAATCAAATAACTGGATGATCTTGAGGATGATTTTATTCAGGCTATGGAAACTCTGATG
AATTATGTGTGTCTTACTGTAAAGTGGTCCTATCTGAGACTTCCCCAGATACTTTTCCTT
GGGCAGGACTTGTTTAGATGTTGAACAATACTGGTCTTTGACCGATTTTCCTGGGATCTG
TGTAGACCCTTATCGTTCTTCTTCATTCACTTAGAATGAAGAAAGCTTAGTTCTTAGGGT
TACAGTTACACCCTAGTCACCTGAAACAGGAATTGGCTGTTTCTTGTGGCCTTTGATGGC
AATATTTACAGACCATTTCTTAGTGTGTAGTGCTTCTGCAAAATAGAGACTTTCATCTCT
TTTTCATTGATTTATTCTAATTTTGGTTTCTGAGGGTGACCATTTCCTCAGCTTATCCTA
TCTGAGGGCCCTTTATCGTGGCCTCCTACAGACTGACCAGAGTCTCGATTTCATCATTCT
TTACTTCTTTAGTCACATCTCTGTCTGCCTTTATAGTTTCAGACTGAAGAGTCCCAGTCT
TCTACGTTTAAATTTTTGTCTTGATTATCGGCACACTCCCCTGTCTCTAGGGGGAGCCCT
AATGGGGTCAAGGCCTGTGACCTAATTGGGTCATGGAGTCTGTGGATGAACTCTTCAGTG
GGAAGAAAAGCAAACTTGAAAAGTTTTTGGTTTTACAGGAATGCCCTTTATGGATTATCT
CTCTTGGCCCTTGTTTTCCTCTTTGGATTAGTTCATGCCATTCTTCTCGCCCATACAACT
TGTAAGGTAGGCAGGCTTTGGACTGCCTTCTGTTTGGGAAGCTTCAATAGTTCAAAATGG
CACACAGGGGAAGAGAGATTTGGAATACGTGACTTAGCTCAGGGCTGCTGTAGGCCTCAG
GGAAAATTGATCTTTCCTTTCCATTCACCTTTTAATTGCCCAGGGTTATCTAGCCTAGGG
TATGTGCATAGGGGATGATCAAGGAAACCTTTTTCCTTTTCATCTAGGCCTGAAGCTGGA
GAGGCAAAAAATATCTCAGGTCTTATTTGTGGCCCAGCCCAGCACCCCAAGTAGGAGGCC
ATATGAAAATTTTAGCCTAGAGCCTGCCCAGTATTCAAGTCTGCACTTCATTGCTCTTAC
ATTGCTCTTTGTCTAGTAGAAACTTCTTGGGAACCTCTGGGACCTTTGGGTATCTGGCAG
AGGATTTAGAATCTCCTCCCTGCAACCATTCCTCTTGATCTCCTCTCACTACATTTTTGT
CTTGGCTTTCTCTGTCTTTGCTATGCCTTCCTCAAGGGATATACATGGAACTGTGCTAAT
GGCCCATGACCACAAACTAGTAAAGTGAGGGAAGCACTGCTAAGAGTCCAAAATAATTGA
TGTATTTTACTTATGGGAGAAACATTTATTCAGGTCTTATTTACACATTTTTAGAGATAA
TTCAAGTACAGAACAAAAGGAGAGAAATTGAGAGGAGGAGGAGATTGGGCAAATATGAAA
TTGTTCACAAGAACTGGGAGGTACCGCATTGGGGCGAGGGGTGCTTTTTAGTCTGGACTA
GAAACCTGGTTGTTACAATATGAAAACTGATGTTTATGGTAGTGACCCTTTGACATAAAG
AAAAGGCTTGAAGACTCAGGCTTCAAGAGTAACCTTTTAAAGCATACAATCAAAAATAGT
TGTAAAAATGAAGAAAATGAGCACTTAATGAAGTTTCAATGAACCTTAGTCATCTGGAAA
ATTAAGTTTGTAGATGTGCTTGGTCCTCTATGCCAAGTAACTCAAGGATGATCATGCTTT
AGTTTGTTTCTGATACCTCTTCTGCCCTTCTATTAGATTTTCTCAGTGTTAATAATAAAT
TACTCCTTCCTTCAGTCTTAACTTTGAACTCACAGCACTAAAAGGAAATGTCAGATTGCT
TTTTCTAAAGCTCTAGTACATTCACCTACATTCACTGGCCATTTCTCTACTCATAATGTT
TTCCTTTCAGAGAGTGTCTAAGTGTGGAGAAGTCTTGCATGTTTGGTTTTGACAGAGATA
GTTTTAGTTGCTGTTTAGCTGCTGACATCCACTGTTGGGAACCATGGTTTTCTACCTCTT
TGGATATGTCCGAGTTTGAGGTTTCTGCTTCTTCCTTCCACCCCATTAGGTTATATGTTT
GCTTTAATTTTGTAGAGGTTAGGCAGCAGCTTAAGGCTGTAGGGACACTGGATGCTAATC
ATGACATCTTAGCCTTTTTTGTGAGCCCAGAGGGTGTATTTAGGAGTGGGGTGTGGGATT
CGATGTTAGCATAGGGAAAGTGGTCATTTTGAAATCAAGTGGTGTCTTTCTGTGGTTGAA
GGCCATAATAACTGAAAAATTGTTTTCCAGTTTGGAGCCTGGGAAGCCGACTATTTGTTG
TTCTGGTCTCCTTAAGTTTTGGGGGTTTTGAAGCCAAAAGCCCATTTGTGTGCCATTCAT
TTGCTCCCAGTTCATTTGATAGCTGGATAGAGATTTGTTACATCTAATCATCTTCGTCAC
CAGGTTCTTGTTATAACTTCTAAAAGCAGGTTTTTAATGTCAGAGAGTTTCTGTTAATAG
CCTCTCGACACTTCTTCTACACCCTCATGCTCACTCTTTGTATAGGCTTTTCTCCCTGAA
GAATCATACCTGTGGCATTGGTATCTTGATTCTGTGTGCTTTCTCTTTAGTGCTACCTTG
CCCTGGCCAAAGGAGGCTTATCTGATGACCACGTCCTCATCCTACCCATTGGGCACTACC
AGTCAGTGGTGGAGCTTTCAGCTGAGGTGGTGGAAGAGGTGGAGAAGTACAAGGTGACAC
TGAGGCGGTTCTTTAAGAGTCGAGGGAAACGGTGTGTTCTGTTTGAGAGAAATTATAAGA
GCCATCACCTCCAGCTACAGGTAGGTGGTCTCCACCCAGGAACTTGGAAGGACCCTATGA
AGACATGGATATTGACAAATATTTAAATGACATCTATTATTTGTTATTGAATATTTAAAT
ACAGGATTCCAATCTGAAATGAAATACTTAAAATTTTAATATTTAAGTGTTTAATATTGA
AAATACCTAATACAAATTTTCATATTAATATTTGAATAGTGTTCATTTAAAAGGTTAAAG
AGTCTCTGGTAATAAATCCAGAGATTCCACAGGGAAGGGCATGGTCCGTGTGAGTGGGCC
AACACAGTTTGTAAGTGCTTTGTTTAGAAAAGGAAGGGATAGCTGAGGAAGACCGCAAGA
AACATTTGGGCCTTGTTAGGTAGAGTTGGAACAGAGTAGGTATTTGCGTGAGGCCCAGCA
TAAGTGAAGTCTTAAAGGTGAGAAATAGTCCCAGGGCTTTGATGGGGCTGTCGGCTCAGA
AATTTGGAGACTGTTTGTGGATAATTCGTTTGTGGTTGTGGTGGTTTTCTTTCTGGCACA
TTTGTTAAATTTTCAAATGGGCCTGACGCCGCCACATATATTATATAGGAGCTGGCAAGG
GCTTGATGACAGAGAGATCTCTCTCTAGCCTTTCCTGCATCAGGGATTGGCTCCCACATG
TGGCAAGCTATCTCGTAAGTTTAAGTCCTTACAGACAGGCTGACACAAGCCTGGCCGGCT
TGAGGAAAATCTCTGCTGAGGGGTATTTGTCCACCCCTGTGATGGATTTGCTACTTCTCG
GGGACTGTGCAGGAGGCACTTCTTGTCTGGGACCTGTACAAAGAGTTTCTCCTATCTACC
CGCCTCACCCCCCCACCTCAGGTCATTCCTGTGCCACTCAGCCGCTGCACTACTGATGAC
ATTAAAGATGCCTTCGTTACCCAGGCAGAGCAACAACAGATAGAACTGTTGGAAATCCCA
GAACACTCTGACATCAAGCAGGTAAAACAGGAGGGGAAGGACGTTCCGGGAGTAGTAAAA
ATGTGGTTTCTGATATGTCGAGCCTGAGGTACTATCAAGGCATTCCACAAAATGTTCAAT
AGGCAGGTAGACAGTTTTGGACCTAGGGCATGGGATGCTGATTATACTGGTGATGAGGAT
GCCTTTAAAGCAATGCCTTAGTCATTCCTGGGTAGAGCAAAAAAATTAAATCTTTTCCTA
AGGCAGGAACTTCGAAGTTCCCCTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCTTT
AAGAAAAGGTTGACACTGAGCCCGAGAGATTTAGAGGGCAAATGTCGGGGTGTGGGCCTT
CTAGCCCAAAGGACTGAAGTGCTACCATTAATTGAGCATATGTACTGTGCCAAGAGCTTT
ACACGCATTTCCTCATTTAATCTTCCCAATTCTGTAAGATAGGTACTGTCATCCCACTTT
ACCAAAATGGAAAATGAGGCTCTAGAGCTGTATCCGTAGAGCTTGCCATGATGGAAATGC
TTTATATCTGTACTGTCCTATACAGTAATCACTAGCCACATGTGGCTACTGAGGAACTAA
ATTTTTAACTTGATTTTAATTAGGATTAAAATTTAAATTGCTACATCTGGCTAGTGATTC
CTGTAAGTGGACAATATGGCTCTAGAGGGATTAGGTAGCTTGCCCCTGAGCACATATGGT
AGGTTCGAACCCAGGTACGTTGATCTCCTAAACATGAGATTTTAACCTCCTTATTCTGTA
GTGTCCTAAGGCCTAGATGAGGCTTCATTTATGTTCCTCATATCAGACAGAACATGACTG
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3186..3270, 4152..4230, 6952..7052, 10595..10630, 10632..10664, 13064..13182, 18688..18772, 20932..21072, 23785..23898, 28250..28459, 29301..29420
1001..1023, 3186..3270, 4152..4230, 6952..7052, 10595..10630, 10632..10664, 13064..13182, 18688..18772, 20932..21072, 23785..23898, 28250..28459, 29301..29420
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved