Felis_catus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Felis_catus PABPC4
Felis_catus
PABPC4
GeneScaffold_1558
SNORA55
5653..5787
25686
CTGGGAACTTGTCGCCAATAAGAGAAGCGTTCCTGCTGACAGGTGATGGTACGTTTTAG
CTTCTGGTCCTTTTTGGTACACACATGGGTTTGTTGGGAAGCCAAGGAAGCATCCCAAAG
CAGTGGATGGAAAACTTGGCTGAGCACCAGGGCACTTGAAGTCTGGAATTCCACAGAACT
CAGATTAAGACTTCACAAGGCCCTGAAACCACTAGGTGCAGAGTCTACTGCACTGTGTGC
TTAGGCAGAAAGATGCGGTTTCATCTTTATCATCCTGATAATAAAAATATTTCCATGTGT
GACCATTAGTATTTATCATTTTGAGGCCTTTCGAATCTGTTTCTGTTCTCAGAAATTGAA
AATACAAGAAAGTGGGCTGAAGATACAAGAAACGGATAGCGCTATCTCCCCAGTCAGTTG
TTCCCAGGTTTTGTTCTGTCACTTGTTTCCTAGACAGACAGATTGTAGACTAAATGACAG
CTCGTTCGTAATTTGATGCAATATCTAACTGAAAAATAATCAGAAAATCTAGTATTAGTT
TCTTACTCACTAGTTAGCTGCACGGTTTAGCCATCCTGGACATAAGTTTGCTCATTTTAT
GAAATAGATAATATCACAACTGTTCCACCTGTGTCACCATGGGTGGTCAGCAGCAGATCT
TTATAACTGATAGAGCTTGGTCAAATGTATGGAATTGTGACTTGATATTGGTGCCAGAAG
GCCATTTAGATGCTCTCGCCTACCCCTTTTACACAACAAGGGTGCAGGTCCAGAGGGCTG
GAGACTTGTGCCAGGAAGTGGGAGCAACTGGCCAGAACGTCTACCCTCACTGGCAACGCA
GGCTGGAGGGATCTGATGCCTTTTAATTTTAATAGAGTTGCCTTTTATCACAGTGATTAC
CTTGAAAAGTCTTGGAGTCCTCTGTTCCTGGGATGGTGGCAGTTGTCTGCACGGAGTGAT
GCTTTATATCCTTGACCGAAATATGTTTCTCTCTTGCAGCTGAGCGGGCCTTGGATACCA
TGAACTTTGATGTGATTAAGGGAAAGCCAATCCGTATCATGTGGTCTCAGAGGGATCCCT
CTTTGAGAAAATCTGGTGTGGGAAATGTCTTCATCAAGAATCTGGACAAATCTATAGATA
ACAAGGCACTTTATGATACTTTTTCTGCTTTTGGAAACATTCTGTCTTGCAAGGTAAGCA
TTGATTAAATGATTTCAGTAGAATAATCATTGATTCATGAAAACAAGATAAATACCAAAT
GGGGAGCAGCCTTGGAATTGGGCGATGGGATATTGGGCGATGGTGATTGGCTGGAAATGG
CTCCAAAGGCTAAAAGTTCCCTGTAGATAATCTTGTGTCACAATCCAGTATAACCAGCAG
GTGCTTTTGTTTCTCTGTTTATTCTTCTCTCTGCCTGAAATATCCTTTCTGTTTTCTACC
TTTGGAGGGCATTGAAGAGTTTATCTTTTCTGGGGGGAGAAGTAGAGCAGTGCCTCTGGT
CTCCAGGCAGCTATACTTAGTCATCTCAGAAGTATAAATTCATCCTCTTCCTTCCTTCCC
TTTGCACCTGTTTTTGTGGAGAATTTAGTACAACTGGTGTGGTGGTGGTATCTGACTCCC
TACTAGACTGAAATTGTATTGTGGGCTTGGCCATGGATCACTTTTTCTGCGGCACGGTGG
TTTTGCACCCAGTTCTCAATGTTTTTTTAATGAAATAAAACATTTGGACTGGAAGCAGCC
TAATAGTGGCTGCCATTTGTAAATGGAACATCACTAGGTCCCTTGTAGTGTGCTCACTAT
TAGGAAAAACCTTATCTGCTGGAGTCTCCTATCTTGACTATGGATGGGCTAGCGGCCTCT
CGGACACAGGAGACTCTGAGGAGAAGGTCATGTGGTTGTCAAATACCTGGAGATGCCAGT
GGTGCTAAAGTGGCCCCCCCTTGTCTTTGACAGGTGGTGTGTGATGAGAACGGCTCTAAG
GGTTATGCCTTTGTCCACTTCGAGACCCAAGAGGCTGCTGACAAGGCCATCGAGAAGATG
AACGGCATGCTCCTCAATGACCGCAAAGTGTGAGTGTCCCAGTCCGGAGCAACAGCCATC
GCATGAGCCAGCCGTGGCCCCACCTCGGTATTAACTGGCACACACAAGGCGGCTACTGGT
TCTCTCGGCCCAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCT
GCCCGAGCTGTGGCAGCCCTTTTGACTCGCCAAGGTGGGCTTCCTGCCCAAGCCATGGCC
TGCCTGCCGCCTCTCCCTCAAAAGCATCATTCGTCCGTGGGTTTTATGAGCATCGGCAAC
TGGGGCTTGCTAGAAGGCAGCTCTGAGCCCTTTCTGAGCAGGGGTCTTGGCCAGCGGCAG
AGTGGAGAGGGCCCTGGACTGACCAGGAGCTGTGTACTAGCCATGTGACCTTGGCCTTCC
TGTGATTCAGGTCTGTCCGTGGGGTCATTTGCTAGGAGTTGATGCCAAATTGTCCCCAGA
TCTCCACTTGGCTAACTTATGACTCAGTGGCCTTCTCATACAAGGCTGGCTCCACAGTAA
TGCTTAATTTGGTTATAATGAAAAAATCTCTGATTGCAGAAGACGCTGTTAATAGTAGAC
CTTCTCGCTTTGGTATGGTTATTGCAGAATGGGGACAAGAGAGTCTTAAGCCATTCAGGG
AGAGAGAAGGGACAATAAGTCTTGGCTATAACAAGCAAAAATCATTTCTGTCCTTTGTGT
TGAACAGACTAGGGGATGGATTGCATTGATACTGTGTATGTGGCCAATGGTCAAGTCTTC
CAAAGGTATCACTGGAAAGAGATCTAAAGATTTTCAGTGTGTGGATACATTTTCCCATTA
AGTGCAAACACCAGAATGTGCTAAGTGCAAAAGCAAAGGCTACCTCATAGTTCACTCTAG
CAATCTCACCCCTAGGATTAACCACTGTTAACAGTTTGGTTTGTATCCTTCCAGACCTTT
TCTATGCATTTACATAGATGCACAGAAATGAACGTTTTAATAATGGTCACCAGGTTTCTT
CATGAAGGCAGTGTGATGTGGTAGGAGTAGCCCTGGTCTGAGCCAGGAGTCCTGGGACTG
ATCCTTGCAGGACAGTCCTGCCTCTCTCTTTCTGCTGGGGAGTTGGGGCATCTCTGAGCT
TGCTCTCTTGGTGGTTGGATGGGGACTTGTGTGTTTTAACCTCTCCTGTCAGTCTTTAAC
CTGTATTCCTTTGGGCCCCTGGAAACCTGATTTGTTCTTCTGGGTAGTCACTGTTTCCTA
TGATTTCTTTTTAGGTTTGTGGGCAGATTCAAGTCTCGAAAAGAGCGAGAAGCCGAGCTT
GGAGCCAAAGCCAAGGAGTTCACCAATGTTTATATCAAAAACTTTGGGGAAGAGGTGGAT
GATGAGAGCCTGAAAGAGCTGTTTAGTCAGTTTGGTAAGTTGGGCTTCTTTGCCCCATGT
GCCCCCTTCCACAGTTCACCAGACCTAAAACGTGTGGATCTTAGTTGTTTAAGAGACAAG
GGCACCTAGGCCCAGAAGTAAACTACCTTGTGTGACAGGGTCACAGAGTAGATAGGAATA
GACTCTTGGCTTTATCCTACCTTGTCCCAGCCCCAGGGCCTTTCCAGTAGCTTGGTCAGA
ACTAGAAGACCAGGCACCGTGCCTCTTTCTGGACCCCATCTGGGTTCAGCAAGAATTGGT
TGGCTTCATTTGGACACTTAGAGAAGCCTTCTCTCCTTGAGCTGCAGTAGAGATGGTGTT
ACTAATAGTTCTGTCCTTTGGTAATAGGTAAGACCCTAAGTGTCAAGGTGATGAGAGATC
CCAGTGGGAAATCCAAAGGCTTTGGCTTTGTGAGTTACGAAAAACACGAGGATGCCAATA
AGGTGAGAGTACCACAAGGGTCGGGGAGAAATTTTCAGGAAGTGGCCCCTGAGTGTGGTC
AGGCCTGACTGGTAAATAGAGTAGAACTGGAATTGCCCGGGTACCGTAGTGATGCAGTTA
CTGGCCTGAGGGACTTCACATGGTAATACATCATTTACCTGTTCCCAAAGCACCGGGCGT
GTAGCCTGTCACCTCAGCTGTTTGGCCCTGTAGGTTGAAAGAGTAGGATGGATGTTTGCT
TCCATTCTTAGTGAGGGGACTCCGTCTTCCCTCAGGAGTTGCTGACTTGATAACAGGGCA
GCAGCTATTTTTGTAGATAAAGCATGGTGCTGGCCCTTGACATACATCACTCACTGCCCA
CAAGAGAACCTGAGAGACTTAGCTACAGCCAGATTATCAGCCTTGGCTCATGTCTGCCAT
GCTTGTATTTATAAAACTACCATTTTTTTTCCTGTATCATATGGACCAATAATCCATTTA
AGTAGTAACCCCCTTTTACTCATGAGGAAGTTTGGATTTGCTTAGCTGGCTTCAGAAATG
GAATTAAACTAGTTTTTAACCCTGTAGGAAAGATTTCCTTCTCTCCGAATGTTTGGTGGG
ACTTTAAGGCCTCCAGGGCAAGGGCCCAGCCTTTACATCTTGGTTTTAAGACCTGTGTTT
CCTCTTTAGGCCGTGGAAGAGATGAATGGAAAAGAAATCAGTGGGAAAGTCATTTTTGTA
GGCCGCGCACAGAAGAAAGTGGAACGGCAGGCCGAGTTAAAGCGGAAATTTGAACAGCTG
AAGCAAGAGAGAATTAGTCGGTATCAGGTGAGAGGTGGTCTCAGCACAGCCTCCCCACTG
AGGGTTTACTGTGCAGTCCTGACAAGAGCGCCTTTCTGTTTATCAGCCTTTCTCTTTGGG
AACTGGGAAACTGCCTCTTCCTCTCCTTTCTCCCAAGATCCCCAGGTTTGGAAGGATATA
CTTACCAGATACAGCAGTGATTCTAGAACAAGGGCAAAAGAGATTGATGTATTATTTAGG
GACTCACTCCCGGAAGCCTCAGTCTATTGTTCTTAGTCATGTGGGTTCTTTTTACTTAAA
TGATTGCCTTTTGTTGGAATGATGGCAAGAGCCTTGCTGGGGACAATGGTCAGAGCATTC
CAAACCCTTATGGAGGGTCCCTTCAGAAACTGCGGCAGGAGTCTCAACCCTGAACCTGCA
TCAGAGTCCCCTTTAGGGCTTGTGAAAGCATGGCTTTCTGAGCCCCAGAATTTCTGGGGT
CCTGGTCTGAGAATTTGCTTTTCTAAGAAGCGTCCAAGGAGGTGGTTGCTGCTGGTCTGG
GGACCACATTTTGAGAACCAGTGTCTCAGGGCATCTATAGGGTACAGATGTGCATTAACT
GTGGCTCCTCTGCTTCAGGGAGTGAATCTCTACATTAAGAACTTGGATGACACCATTGAT
GATGAGAAGTTAAGAAAAGAGTTTTCTCCTTTTGGATCAATCACCAGCGCTAAGGTATTT
TATACTGTGGTTTGGAGATCGAAAGTAGAAATTGTAATTTTTTTATTTCATTGAAGGAGT
GGAATCTAAATTGTGTTTGTTGCTGAAAATAGCTATCACATTCATCTAGCATAATTCCTC
CTGGCCTCCAATATTACGCATCTGAGTATGTGCTCTGGAGAATGGAATTTCATTAGGTTA
AATGGCACCATCTCTCCCAGGCACTGAGGTATGGAGGTGAATCTGAGCAGTCCCTCCTGC
CAACGCCCCTCAAGCACCTGAATCTTTCCCATTCTTTGCTGCTTTGTGCTGGTGTGGGGA
CAGATGGTGCAACAGTATGAGCAGAGGAAATCCAGACGGGTTGTTTTCCATTTGTCTTGG
GGCCTGTCTCTACAACTCTGCCACACACTTTGTCCTTGAATGAAGGTGTTTGAGGACTTG
GGAGCTGGGGTTAGGAACTTCTGTCCTGGCCTTATAAAAGCTAAAGGCACACAAAGAGGA
GTGGAAAGATGACTCTTCCACATTTTGCCATGTGTGTCGTCTGCTTGGTGTTCTTTGATA
GTCCTATCAACTGATACAGCAGGGTGAGTGAGTATGAACCCCCTTGTGGAGATAAGGAAT
TGGAGTCCTTGAGCATGAGTACACTCGTTAGAGGATGGTGTGCCGCACGTCCTTGGTCCG
TGGGGGGGGTGTGATGGGAGTGGATGGCGTGTGAAAGTTTTGGGTTGTAGCCTTGAGGCA
CACGCTGTTCCTGCTCAGCAGAGGTGCAGCAGGTGTCAGAGTCTTTTCAGGGATGAGAAA
GAGGCCAAGTGGTCTGGTAAAAAGACTTTGGTGTGACCCTGTCTTGGCCCTTAGTTTAAG
TCGTGCACAACCTGGGAGCGTTGTCGAAGGAACATTATCAGTTGTAGCAGAGTTGACCAG
AGGCCACCCTGTCGGGTTCCTTGTTTCCTTGGCCCTTCCCTCTTATCACTTCCTTCACTG
GCCTTCCATCAGTGTGAAGAATGATGGTCTCTCCTTGCTTATCAGCACAGTGCTTAAGTT
GGCAGGAAAAGAACAAAAGAACCAGGTCTTTCAAGTTTCACAGCCCCTGTTTTCAAGATC
AGGGTGTCATGTTTTCATACACCGTGTTGGCCCATCTCATTGGTAGAAAGATGTTGGGTT
GATATACATCCTTACTCTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCTATGTCTGTGACTTAACATTTTTTTGC
TCATTGATGACTCTTGTGAAAAAGGTTAATTATAAATGCTTGTTAGCTGGATGACTACAG
AGGCAGCCTATTCTTTTGGGTGGGGTTGGGAGATTGAATGAAACTGTTGTTTACAGAATG
TGTCCTGTATTCCAAGAGGCGGGAAGAGTTGTATGTGAATCATTAGGCTGTTCGGCCAAA
ATATCAATAATGGCTCCACATGGGACGTGTTGTTTGAACATGCTTTGGAATTGCTCCTTC
CGTGGGACGTGGCCAGTTGGACCTCTGCTGCCGACACTGATGTGCATTTGCTGGTCTGTT
GTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAG
CAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGATGCACACAGAATGGGGAA
AGATGGGATTTGACGGGTCTTTGCCCAGACTGATTGGCTTTAATTTTACTTATTCTTTTC
CTAAGGTGTTCCCACAGCTGTGCAGACCTTAGCACCTCGTGCTGCTGTTGCTGCTGCTGC
TCCTCGGGCTGTCGCACCTTATAAATACGCTTCCAGTGTCCGCAGCCCTCACCCTGCCAT
CCAGCCTCTGCAGGTGAGGTCTACCAAACGGAATGCTGAAAGGATCTGCCCTGTTTGCAT
TTGGTTGAAAAGATGTCTTTGCTTTGATTCCTTCAACAGCCATTAATGCCTGCTCTGTGT
CAGGGTGTTGTGTTTTCTATGATGACGCTGCCTTTTAGGGGCTTTCTTTACTGTGAGGGA
AAGGGGCTGGAAAGCCTCCCCCCCCCCCCATAATAATTTACTTAGAAATGCCCCAGCCTC
AGAAACAGCTGGTGCTTCTGCCTTCCTTTTTACAACATGTGTGCTCGCTTAGCTCTTTGA
GCGTCTCATTTCCACTGGCTGAGTTGATGCTTAGCCTCTCTGTAAGATTGGTACATTAAG
GCAGTAAAGAACTTCATTTTACAGATGAGACATTCAGTTTCAGAGATGTTAAGTTGGGGT
TGGGGGATTAGACCCAGAACTCAGTAGTAATTTGCTTAGAGGAGCCACACTTAACACTTA
GCCTTGTGACCCCTGAGCTACCTGCTCCTACTTCATGCTCTCTAAATTGGAGATGCCTCA
GAACTTTGCTTATGTAGCTTTTGCCTACAGGGCCCTACTTTTAGAGTTGTGACTGGCGTT
GACAGTGTATGTTGGTAGTCCTTAAGCATTTGATAGAATAAAAACATTTGATATGGGGTG
CCTGGGTGGCTCAGTCGGTTAAGTGTCCGACTTCGGCTCACGTCACAATCTCACGGTTCG
TGGGTTTAAGCTCCACATCAGGCTCTCTGCTGTCAGCACAGATCCTCCTTTGGATCCCCT
CTCTCTGCCCCTTTCCTGATCACTCACATGTGCCCTCCCTTCCTTCCCCCCTCTCCAAAG
AAATAAGTAAACATTAAAAACATTTGGTATAATAAAGTGATGTGGGATATAATTATAAAT
GGAATCACTTGATAATTGTTGAGCCTTATAGGTTTATTTTCTTACTCATTTCTTTTCTAA
TAGCATGCTGTTTCCTTTTGTTTTGTTTTGTTTTGTTTACTTTTGGGAGAGAGAGCACAA
GCAGGGGAGGGACAGAGAGAGGGGGAGACACAGAATCCAAAACAAGCTCCAGGCTCTGAA
CTGTCAGCAAAGAGCCTGACACGGGGCTCAAACCCATGAACTGTGAGATTGTGACCTGAG
CTTAAGCCAGACACTTAACCGTCAGGTGCCCTGCATGCTGTTTTCATTGTAGTTGGTTTT
TGTTTATGCTGTGTACCCCTCTGTTGCTTATGTAACCCCTTCCTCCCCAAGACCGCGATT
AGTTCCTTGGCAGCAAGGACATCCACCTCTCTCTCTTTCATATAGTAGGCTTTGAGAGCG
AATGGTCAGGCTCATGACCATCAAATGTCCTTTCCTTGATGCTAACCTTCTGCCTCTCCT
GATTCCCAGGCACCCCAGCCTGCGGTCCATGTGCAGGGGCAGGAGCCCTTGACCGCCTCC
ATGTTGGCTGCAGCACCCCCCCAGGAACAGAAGCAGATGTTGGGTGAGTGACCCATGTGT
TGGCAGATACCCGTGTCCATTCTTTACTGGGATTCAACCTGGTTTTTAATTAAATATTCT
TCCCCCAGGAGAACGTTTGTTCCCACTCATCCAAACCATGCATTCAAACCTGGCTGGAAA
ATCACAGGAATGCTGCTGGAGATTGACACTCTGAGCTGCTGCACATGCTGGAGTCCCTTG
AGTCTCTCCGCTCCAAGGTGAGCTGGTTTCTAGACCCTTCGGCTTTCACTTGCTCCTCCT
GGGAGGACGAGGGGTGGCCTTGGCATCCTGGTTCAGCAGAGAGACGGAAGGCTGCTTGTG
GGGTGGGTATTGGGAAGAGCAGGCAGCACCAGGAGACCCTACTACTGGATCTGGGCACCA
GGGAGGGGTGGAGGGCCTCTCCTCAGATGTCACTGACCACCTGGAGATTCTTCACAGGTG
GATGAAGCTGTGGCGGTTCTACAGGCTCATCATGCCAAGAAAGAAGCTGCCCAGAAGGTG
GGCGCTGTTGCTGCTGCTACCTCTTAGACAAGGAAAAACCGTATGTTTGGCTGTTTCTGT
TTTTTGCAATGGTTTTGACTTGTGAAGATCTTCCTAAAAGATTAGGGGCAGCATATAGAG
CCATGTTTCTGCTATTTAACCTGATAACTTGGGCAGGCTGTCGCCCGAGTATTTTCTATA
ATCTGAAGGAGTTAATTTGGAGAAAAGAGAGAACAGGTTGTAAATTATAAGGAGCAAACA
GGGCAGTTTTCTCCATAAGGAGCACCTGGTTAGATCTTTTTCAAGAATGACTTTTTTTGT
TTAGATGGATATACAAGGTGTTGTCATAATCTGATCCCACAGCCTCATTTCTATGAACAT
CTCCCTGGTTTGGCTTAAGGTTGGTGAGGTGAGCTTGCGTGTGAAGCCACTGTTTAGCTC
TGAGAACACAACGGACACAGGCCCTGTGTAAGGTGGGAGAGGCAGACACACCCGACTACA
GTTACAGGGTGTGGTTTTAGTCAATTCCTGGACCTGGAGGCCATGGCCCCCATCTGCAGA
GTGAGTGAAGCTTAACTAGGACCTCTGACAGGGACTGGTGGGTGCCTCTCCTGGTGGAGG
AAGGAGAGAACCAAATAGGCAGAGGCAAGGGAAAAGGGCATATGGTAAAGGCCTGAACAC
TTTTCATTGGGGATTTAAGCAAGTGAACCATCACTTCGGGTACAGGATGGCCAGGAAGGG
TGCGGGGTGGGGCTGTGTATAGTAAGTACATAGCCTCAAAGTGGGTGACTCTGAGTCAGG
GGTGCCTCTTTGAGAGGACATTTGCCAACGGAGACCTATTTTGGTTGTCATACCTGGAGA
TGTGTTACTCACATCTAGTGGGTAGAGGCTAGGGATGCTGCTAAAACATCCTGCAATGCA
CAGGACAGTCCCAACACAATCGTCCATCCCACATGTCAGTAAGCACCGCTTTCTACAATA
CCTTCTATAAAGCCAGAGATTTCAGTGAATCTCTGCGCTTTTTCTGATTATGTATTTATT
TGTGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1192, 1953..2068, 3314..3453, 3807..3901, 4569..4706, 5298..5393, 22386..22470, 22565..22692, 24069..24162, 24248..24294, 24297..24326, 24329..24376, 24597..24686
1001..1192, 1953..2068, 3314..3453, 3807..3901, 4569..4706, 5298..5393, 22386..22470, 22565..22692, 24069..24162, 24248..24294, 24297..24326, 24329..24376, 24597..24683
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved