Felis_catus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Felis_catus GNB2L1
Felis_catus
GNB2L1
GeneScaffold_2327
SNORD95
1404..1471
5892
ACATACCATGAGGTTAAATGGGAGGGCGGTAGCCAGCCAGGCAACCATGTTCCACTGCT
TCCCAGTCTGAGGACACCTCCTTGGGGGCACGCCTGGACCCCCCAGCCGGCCTTTCTGTG
AGGTGTTTAGGCCCAGAGCGGCTTTGGACCCGAGTCCCCAGAATTCAGAACCCGGAGGCC
TTTCCTCTCGCGGCCGTTCAGTTTCTATGACGGCTCTCTGCACTCCTGCCTAGACGAGAG
CTCGGTGACCGATAAGCGGCCCACGGACCGATTTTTCGTTCCTCCCCGCTTTTCCGCACC
GTAACCCATTTTCGTCTTAACTCCTGCCTGGACTAAGCCCTTCCGAACAGGGAGTGCCTC
AGCCAATTCCCTCAGAGCAAAAACCTCTTGATGAAAGAGCTGCCCTCTGAGACAGAAGTC
TGTTAGGGCTTAATAATTCACCTGAGCACAGTGTATTTAAAAAAATTTAATACCATATTT
TTCATATCGCTTACCATTACTTGCAGTTCTCACCCAGAAATTAAGCTCCCTCAGCGTTGC
CCTCCGAGCCACCCTGCGGAAAGGGCGGGGCTCGGGCTGTGCCACGTGGGAATACTAAAG
GTGCTGGGCGATCCTGACGGGAATGTGCCGTGCACTTCCCCTCTTCCGCTTCTTAGACAT
CACGCCCCAGTGAACGTTTGATGGGTTCTTTAAAACACTTGACCGAGTTGGTTTCAGAAT
GTTTTTGTATGGCACTGCGAAATTATAATGCGTGGCGGAAGGGGACCATGAAGTTTTATC
ATTTCACCTGTCCCTATGCCCCACCTGGCGCCGCCATCTTAAGCAGAAATGAATCATGGG
GGCCGCCATTTTGTTGGAGCGGACGGGTATTTCCGGTTCCGGTGGGGTTCCTTCTCTCTC
TTTTCCTCTGCAGAGCCGCGGTGCGAGCGGCTGTGGTGCTAGTCTCTGAGCTATCCAACT
TCATCCTTGTCGCCCCGGCGACATCCGCACTCCCCGCCGCCATGACTGAGCAGATGACAC
TTCGTGGCACCCTCAAGGGCCACAACGGCTGGGTGACTCAGATCGCCACCACCCCCCAGT
TCCCGGACATGATACTGTCCGCTTCTCGAGGTACGGGCTGAGGTGCGGGGCAAGGGGTTG
AAAGATAAGTGGGTTGCGCGTGTCTCCTGTTGTTTCCAGTGGATCGCGAGTTGGCGGCCC
GGGAAACTCCGTCCGCCTGCGAGGTGGGGCATGCGGACCCGGGCCTAAGTCTCAGCCTGG
ATAAGCCCATGAGGCATTTTCCACTTTGCAAAGGCCGAGACATAGATCAGCTCGTAGCTG
CTAGGATTGCAGGATTGGGGTTTTATTTCTTGCCCGCCTCCTCGCAGATGTGGCTAAGTG
TGCAAGAGCCTATACGGGTCGGGCGGGGCGGTGATGACCCCAACATGCCATCTGAGTGCC
CATGCTGAGACCCAGAGGCTGTTTCTGAGCTGCCGCCCGGCCCTGTGCCTAGTTTTTCCT
GGATGGACTCCCAAGGGGAGTCCTGATGCCAATCTCCTTGCAAGCCCGTGTCTTGTCTTT
TCTGCCTTTTTTTTCTTGTCATTCTCTTGTTTGAATGAACACGCTATTGTTTGCCCCCAC
GCTATTAAAAACAGTCTGAGGTTAGGATCATGTGTGACGCATAATCGGAAAGCGTGTGGA
GTCCAACACCTTTCAGTGAAAGCTTCCAGCCTTGTAGTGTGTAAATCAACTAAATCCAGT
ACTTCTGGCATCCTCAGTGGTAGTTGTAGGAAGCCCACATTCAGTCTTCCCACACCCAAG
CAGCAGTGTTTATGTATTAGACCTCAGAATAAGATTCAGACATTGGGCTGTTATGAATGT
CACAAAAAGGCATTCATAATCTGCTAAAGGCCTCCACACCTAAGTTTAATTCTAGTGGCG
TTGCTTAGTTCTACTTGACTTTTTTTTGGAATAATGAATCACTTAGCTTTGACTAATGAC
AGCACTCTCGGCTTGGGGGTCCCCTCCCCCCTTGAGTGTCCTTAATTTCTTTTAAATCCA
CCAATGACCTTGAGGGATCCTGGATTATCCAATAGGTCAGTGAGTGGGCTGTGGGATTCC
TCACTGGATTTTCTGTGTTACCTCCCCTTAGATAAGACTATCATCATGTGGAAGCTGACC
AGGGATGAGACCAATTATGGCATCCCACAGCGTGCTCTTCGGGGTCATTCCCACTTCGTT
AGTGACGTGGTCATCTCCTCAGATGGCCAGTTTGCCCTCTCAGGCTCCTGGGATGGAACC
CTTCGTCTTTGGGATCTCACAACGCAAGTAGCTGCTCATTTAACTCTGGGGCACTGGGGA
AAAGCTGGGCAGAAATGAGGTAGATGCTGTTGGGAGGTGGTTTCCAAAGGACAGTGAGGT
TCATTGTGGGAACTGTAAGGCAGGGCGTACAAAGAGAAGGTAGTTGGGTTGCTTGGCTTC
CATCCTTGCTGCTTTTAATTACTTTCGCAGAGTTGCTTCAGAGTGGGCTGGTTGAGCAGC
TTTGCCACATACTGTGGTTGAGAGTAGGCAAGGATTTGAACATGTTTTATCTTGGGAGCT
CAGTCGTTGGATGGTCAGGCATAATGGAGGATCCTAGTGATGACAGATGACATTGTCAGC
CAATCCCCATGTGGGAGTGAGGACATGTCCTGCAATTCTGAAGGGATTCTCTGGCATATG
CTCAACCATGTTGTGATCAGACCCATGTCCAGGGTCATGTGAGTAATGGCAGCTCCAGTA
AGGCCACGGAAGGCCAGGGAAACAGTCTGATGTGGAAGAATGTTTGCAGAGTCTAGAGAC
TGACCAAGTCCTCTTCCTTAGGGGTACCACCACACGCAGATTTGTAGGACATACGAAGGA
TGTGCTGAGTGTGGCTTTCTCCTCCGACAACCGCCAAATTGTCTCTGGCTCCCGAGATAA
AACCATCAAGCTGTGGAATACTCTGGGTGTATGCAAATATACTGTCCAGGTAACAGTGAA
GGCACATGCAGAAAGCACATGAAGATTCTCTCCCATCCTTCTTAACCTTGGCATTATGTG
GTGATTTCAAGCCTGGCTTGGGCTCCAAAGGGGTTCTGTTGATATTAAAGGTTTGGGTTC
CAGGGATGTGAGTGCAAAGCCATCAGTGTACCTCCCATGTAACTGAGGGAAGGGGTGAGG
GGTGTAGTTTCATGGGACAGGATAGTTTCTCCTTACTTCTTTTCTGTCCTCTAGGATGAG
AGCCATTCGGAGTGGGTGTCTTGTGTCCGCTTTTCACCCAATAGCAGCAATCCCATCATT
GTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTGAGCTTGAAGTCAGGATGTAGGGCTTTT
ACCAGCCAGAATGTTCCCATTGCCTCGTAGGTGGTCATAAGTTCTAACTTTGAAAGCTTT
ATTTCTCAGTTGACTTTTCCTATTGTTGTTTTCTAACTATTAGTTTTTGATACTTGGTAT
GGAGTAGCTAATTGAACCCAATATCCCTTGTAGAGCAACGAAGCATTCTTTATTTAATCT
TGATTGTCCTTAGGTGACCAAGACAAATTCTTTAACCTTTTTTGTTACTGGTAGAATGAA
AAATGGCCACCATATCCAGAAATGCTTTTAAAGAAGGTGCCATGCCTTTTTTGTCTTGAG
CCCTCCTGACGCCAGTGGATTCGGAGCCAGGTTTTTCACCTATTACCCCTAACCCTCCCA
TATCTAGGTATGGAACCTGGCAAACTGCAAGTTGAAGACCAATCACATCGGCCACACAGG
CTACCTGAACACTGTGACAGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGGAAGGT
ATGTTCAGGAGCTGGGAGTATTCTACTCAATGGGGGACAGTGGTGTTTTTTTTTTTAAAA
ATACTTAAGGTAGCAATCCAAGAGTAAATGTTTGTGAAAATTGTTTTCTAAAAATTATAC
ACACCATACTGTTTAAAAGATTGTTTTCAGTAAAGCTGGTTTCTTAAAGCTGTTATTAGA
ATTCTGTTTTCAGAACTGATTGTAGTGATTTTAGAAATTGTCAGGGCCTTGGTAGGGTTG
ATGGGGTGTCATGCATTAACGGAGGGGCATTCAGAGATATACTGGTATTTGAATCATTAG
CTTTGGGGAAGTTGTGGGAGGGAGAATAAGGATTAAGACAGAACCTTGACAGTAGAGATT
AACACCTGGAATAGGTTTCATATTACCCTGACTCCCCTTTCCTCTTCTCAGGATGGCCAG
GCTATGCTTTGGGACCTTAATGAAGGCAAGCACCTTTATACACTAGATGGTGGGGACATC
ATCAATGCCCTGTGCTTCAGTCCTAACCGATACTGGCTCTGTGCTGCCACAGGCCCCAGC
ATCAAGATCTGGGTGAGTGTGGGCTACAGTTGAGGGCCGAGCTCCTGGCTTTACTCTTGT
GAGCCATGGCAATGTTGTGATTTCCTGATATGTCACTGCTGGGATTCGAGCTTCCTGAAC
AACTGCTGATCATCAGGCTATCAGTGGAGACCCAGGAAGAGCAAGTTACAACTTGCTAGG
ATTGGGATTTGCAGTGGTGCACGATACTTACCTACTAAAGGGTGTCACAAATTACAGCAA
TTTATTCAGTCTCAGCATAATCAACCTTTTGGTCTAGATAATTTGGTGGGGGGAGGGGAG
ACAGTCCTATGCATTTTAGGCTGTTTCACAACATCCTTGGCCTCTATTCCTTGGATGCTT
GTAGTAGAATCCCTCCTTACCTTGATTTTGCCCCTTTCCCAGGACTTGGAAGGCAAGATC
ATTGTAGATGAACTGAAGCAGGAAGTTATCAGTACCAGCAGCAAGGCAGAGCCACCCCAG
TGTACTTCTCTGGCCTGGTCTGCTGATGGCCAGGTAAGTGGGTCTCTGCTTAAGTGACTC
AGCTTTTACCTTTTCTCTCCCCCTCTTTGCTCTTGGAATGTCTTTGACATAAAATGAAAT
GACAAAACTAGCCAGGTTGATTTGAGAGAACCAAATTAGCTCTACCAGTGAACAGAGTAC
ATGTTCCTGCACTGGAAGGAAAATTGATCTAACAAGCAATGATTACCTACCTTCAGTTAA
CACTTTGGATAACTTAATCATTTTACAAGAGTATGAGTCCTTACTACCAGCTGTTGCTTC
CTCTAGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 2131..2302, 2841..2988, 3234..3329, 3727..3837, 4251..4391, 4782..4892
1001..1109, 2131..2302, 2841..2988, 3234..3329, 3727..3837, 4251..4391, 4782..4892
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved