Felis_catus Locus RPS11
snOPY snoRNA Orthological Gene Database
Felis_catus RPS11
Felis_catus
RPS11
GeneScaffold_795
SNORD35
2129..2214
4001
GCCCCACGCTACAGGATAAGTACCCAAATTGACAAGGGAGGGTTTGGACTCCCTTGTCC
AAATAAGGGGGATTCTGGCTGGCTCAGTATAACATGGAACTCTTGATCTCAAGGTTGTAA
ATTTGAGCCCCACCTTGGGCGGGTTTAGAGATTACTTAAAAATAAACTCTCGAAAAAAAT
AATAAATAACAAGTATCCAATTATAGACCTGCACTGCCCAATGCCATAGGCTTAGCTCCA
AGTAGCTATTTAAATTTAAACCTAATAACAGTAAACAAAGTTAAAAATTCAGGTCCTCAG
TCTCGTACACATTTCAAGTGTCAGGGGCCAGGTGCTGAGTGGTGCAGACACAGAACATTT
TTATCATTGCAGAAAGTTCTCAACAGTGCTGTTACAGACAGTGCTGGTACATCAGCAGAA
GGGTTTTTATTCGCGAAACCATTGTCTGAGAATGAAACAACAACGTTCATTAAATTTGAA
CAAACAAAAAACCACTCTTGGTTAACGCCCGCCCCTCACAAAGACGGCGGTGCCGTTCCC
CAAGCTCCTAAGACCCTCCAGCCGCGTGCCCCGCAAAAAGATGGCCGCCACCGCATCGCG
TTTGAATTCTGCAGAAACGAAGCCACGCGGTCCTCAAATCCCACGTGATTTTAGCCCCGC
CGAACCCTGACCACCTCCCTGTAACTCTCGCGATAATGTAGGCAGGCTCAAGGCTGGCCT
TGCCTTCCCAACGTGAACTAGGGCGCCCAGCGCAATCGCGGCCTGACTTTCGCGAGACAG
TGTCCGCCGCTTCCCGACCCTCGGCCCTTCATCTTGTGGGCGTCCCTGCAGTCTCCGAAT
CGCGGGCTGTGTTTGGGCCTCCTGTCAATCACCGTCGCGTCCGAGGCACCGCCCCAAACC
GTGCTCCCGCCCCCTTTCGTCACTTCCTCTCTAGCCCCTGTGCGGTCGATAAGGAAACCC
GGACGCCGCCGCGGCTTTCCTTTTTCCAGGCGGCCGGGAAGATGGCGGACATTCAGGTGC
GGGCTCCGGGCCGCCGCGGAGGTGGCGGGGTCCAGTCCCGGCGTCAGGGGCGCGTCCTGG
AGAGAAGGACGCGCGCCCCTGTTTGGGGGTTAATGCAGGGCGGCCTCGATTTTCCAGACA
TTAATTCGGGCAGAGGGCGCGTGTCTGAATTAATCTAATTAGCACCGCGTAAATACTAGG
GTCTCCCCCACGTGGGGTTTAGGAGAGGCTCAAGCCTTATGAGAGGTATTTTTGGAGGCC
TTGGGCCATTGGGCTAATCCAGGAAGCCCATCGTTTTGGTATTTATTTCTGAAGTCGCGT
GTATCATAGGAGAGAATCCTGAGTGGGCGCCTTTGTGTCTGGGAGAATCTTTGCCAAAAG
GTGTACAGGTTGTTAGAGGAATTATTGTTTCTGTCTGAGTTTTAAGGAGTGAATTCGGGT
GATGGGAAGTGTCTTGGAGCATAAATACGGAGGTAACTCCGGTTCAGAGTTGGGTCTGAA
CTCAACTCTTGGTGTGACTGTTGTCGATGGTCATTATCCAGGTTTTGGAGGTTGACGTTT
AGGGAGTAAAGGCTGGAGAGGGTGGGATTTGGGGGTTTCTGGGGAGGTTTTCCAGGCCAG
GTTGCTGGCTTCGAGAGCTTACCAGCTTATTCCTCATCCACGTAGACTGAGCGTGCCTAC
CAAAAGCAGCCAACCATCTTTCAAAATAAGAAGAGGGTCCTGCTTGGAGAAACTGGCAAG
GAGAAACTCCCACGATACTACAAAAACATCGGTTTGGGCTTCAAGACGCCCAAGGAGGTA
GGGGGTTGGAGAGACTCAGAAGGAAGGAGACCCCGGTGTCCTCCCACGTGGGTACACAGG
GAGTGGCAGTTCCCGGGGTTGTTGGGAATTGTAGTTTGTGTACCTAAGGCCACACCCCCT
GTTTTGTTCAGGAACTACATGTGCCAGGCTCACTCCTTTCTCTCCCTTGTTCAGGCCATT
GAGGGTACCTATATTGACAAGAAATGCCCCTTTACTGGTAACGTCTCCATCCGAGGGCGG
ATTCTATCTGGTGAGTGAGGACTTCTGGGGGCTTGGGTGAGGACGTCTGCATCTGGGGGA
CGCCTGGACTCCTGGGTGAGGGGGGCGCTGGCAGATGATGTCATCTCACGATGGTCTTCA
GATGCCCACCACGGGCACTGCTGAGAAAGCCACTTGGCACAGCTGATGTCAGAAGCAGGG
TTTGGGATCCCAATTCTCAGCATGTTCTGGGCGGCCCAAGGCTCCCCTTCCCTCCCAGGG
GGGCTGACCTACCATCTGTCCCCTCCCCCCAGGTGTGGTGACCAAGATGAAGATGCAGAG
GACCATTGTCATCCGCCGGGACTACCTGCATTATATCCGAAAGTACAACCGCTTTGAGAA
ACGCCACAAGAACATGTCCGTGCACCTGTCCCCCTGCTTCAGGTGAACATGGCGGGCCCT
TGGGTTCCCAGGTGGAGAGGAGGGGGTGGTCTGCACCCAAGTCTGAGTGACCCTGGGACC
TGGCCCGGGCTCACAGGGCGCTCCGGCTGCTGTGTGGGCAGGAAACTATAGGAGACGGTA
TGAGGAGACCGCTGGAAGCCAGCAGATGTCCTCAGGAACCCCCTGCGTGTGTCAGGTGGA
GAGGGTTGATGGCGATCTTCTGCCCTGAGAGGCCCCTTGGAAGGGCTGGAGTGTTCTCTG
CACGGCTTTGAGTTCAGTGCCTTGCGCACTCTGTTCCGTAAACAGTGACTGGGGGCAGGT
GGGATTGGAAGTTGGAGCTGGGATAGGGTTTGGTGGAGCTCACGCGGACAGGCCTCGGCC
TCTGATGGCCTGAGTGGGGCAGCCCAGCGTGTGACACAGCCCCTGCCCACCTCCACAGGG
ATGTTCAGATCGGCGACATTGTCACAGTGGGTGAGTGCCGGCCCTTGAGCAAGACTGTGC
GCTTCAACGTGCTCAAAGTCACAAAGGCTGCTGGCACCAAAAAGCAATTCCAGAAGTTCT
GAGACTAGACGTCTGTCCACACCCCCGAAGAAAATAAAGTTATTTTCCCAGTCATGGGCC
TGGCTCCGGGTATCTGCGCCTTTACCAGAGGGATTGTCCCTGGGAATCGGGGTTGATGCG
AACACGGGGTTCTCGTTCATCCTCTGGACCCCCTTATGTATGGGTGGGACTGGGAGCCAA
ACCCTTCCTCTCTGTTCTCATCTCTCTGGGTGAAGATATGAACCTGTGTTAAGATGTTGT
TCCCTTTCTGGGCCTCCTTTTGGTCCATGTCACCTCTTGGTGTCAGAGTAAGTAAAGTCT
CCTACCTGGTCGGGGCGTGTCCCCCCTCACCCCTCAGTCTCTGGGGAGGAAGTGAGTGAG
GGCGTAGGCCCCTGGGTTCTCAACTCCGGTCTGGGCCCTTTCTGGCCTCCTTGGGAGGGG
GAGGAAGAAGCAGCCACCCTTGGGTCTGGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCCCCCCCCCCGCCACCACCCCACTGCCCCCTCCTGGGCCAGCACCA
GGCCCCTTTTGCAGATGAGCAAACTCATCTGAGGGGGGCAGGTTCTCCCCTCGGTGAGTA
GCCGAGCTCCAGGCCTAAGGTTCTAGAGACTTCGTTTGCCTGAAAATCCAAGGAAATTGG
CTTTGAAGGCATGTGGTATAGTGAGGCCAAGCTGGAGCCAGGCTGGAACCCACCTCTGCA
GCCCCTAACTGCAGGCCGCTCAGAGATGGCTTAGGGAGCCCCTGGAAGTGAGACCGTGTT
GGGGTGGCCTTGGGGAAGGAGAGAAATTGGAGTTGGGGAGAAATGGGGACAGGGTCAGGC
AAATGCAAGGAAAGACAAAAAAAAAAATTGCAGGAAGAGACATCTAGCCAGACAGTGGCC
TTGAGTATCGGGAAAACGGGGAAGGGAGAAAGGTTGAGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1665..1796, 1974..2049, 2312..2441, 2878..3001
1001..1015, 1665..1796, 1974..2049, 2312..2441, 2878..2998
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved