Felis_catus Locus ENSFCAG00000009194
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000009194
Felis_catus
ENSFCAG00000009194
GeneScaffold_795
SNORD35
3922..4008
5499
CTGGCCAGGACTGTCTGTAGGTGGGGCATGGTGTGGACGGGGCAGTTTGCTTGTGAGTC
TCGGTTTTTCGGTTAACGCAATGCTTCATTCAGTAGCCGTTTTCTGACGCCTCCTGGGGC
CCAGAGCCAGTGCATGGCACTGCGGGGACCCAGATGCGAGTCAGAACCCACCCAGCCCCC
TCAGGGCTCCTGATCTATGGGGGAGAAGACACGGGACCCCTCTGGGGTCAGTACAGCGTG
ACACGTTCTGATGGCAGGAGAACAGGCACTGTGGGAGCCCAGAGGAGGTACCCGGGCCAG
CCCCAGACACCGGGGAAGCTCTCTGGAGGAAAGGACCCCAGCCAAAAAGCACTGGGATTG
TGGCATGCCAGATATTAGAAGGTGGGGCTGGAGAGCAGGACATCGCAGGTAAGGGACGCA
ACAGAAGCCATCTGGAGTCATTCCCTCACACACTCTCGGATCGCATAGGGAAAACGACTT
CCACCTGTTTTACAGATGAGGACGTTGAGGTGTAGACAGGCCAGGGGTTTGGCCAGGTCA
TAAGGAGGCACACCAGGCACCGGACCCAGATCTACCCAGTCTAGACTGGGCCCTGAACAG
AAAGCCTCGTTGCCCTCTGCGGGCCACCACGTGCCCTGCAGCCTGCGCTCGCTTTAGCGG
GCGAGCCCCCGCCCTAGAGGCGGATTAGCAGCCCCTCAAAAATATGGCGGCCGAGGCTGG
CCAGCCCCGCCCCAGCTGAGCCGTCCTACCCCCACGTGATCTCTCGCCCCTCACAGCAAT
GGCTATCTAAGAGCCGGCGAGAAGAATTGGACCCGGATTGGACAGTCGGGAGACGACCCG
CCTTCTAGCGGGGCCTCTCTGCGCACGCGCTAGACGCTTCAACCAATGCAAAGACGGAAA
GCTGCCCGCACAGCCCATGCGGCGTCACTTCCTCCGCCCCTGTTTCAAGGGATAAGAAAC
CCTGCGCAGAGCCTTCCTCCTTTCCTAGGCGGCTGCCGAAGATGGCGGAGGCTCAGGTGC
GGGCTCCGCGCGGGCCGGGGAGGCGTGGGACCGGGTGGGATCCAGGCCGGGGCCGAGTTA
TACCCTCTTTCCCCTCGTAGGTGTATTGAGAGATCTAATCTAGGCTAATTGAGCGAAACG
GGGCAGCTTTTGGTCTAAGAAGAGTCTGCAACGGGGGAAATAGGAGATACACGGGGGTTT
TTTTTGGCCTTTTTGGTCGGTGACTGGCTAAAATGCGGCATCGTTCCTCCCTTAGGGGTG
ATTATGGGGGCTCCCAGCACGGGAAGAGTTAGTTTAAAATTAGGTCTCGTTTGCCTTTGT
CCTTTGGCCGAATGAGACCCGTGTGTCCCCAGCGGCGGGGAAGCACGCAGAAAGCGCCTG
GGCGGCCTCGCGGCGGTGAGACGCCGAGGACTGACCCCAACATGCCCCAGTCGCGCGTTG
CTTCAACCTCGTGGGACTGCTAATCCGTGTTCTGCAGCTTTGAGCGTTTTCGTAGGAAAC
TTAGGCAGTGGGTCCAGAGCGTTCTCGCCTACAGGGCGTGCAGGAACGAATTCCTCTTTT
TCTTTTGCTCGTTGGGGTTGATTTTAAAGATCTGAAAGGAGGGACCTGTAATAAAAAGGC
TCCACAACCCCGGGACCTACACTGTTCTTAAACGGGAGGTGGGGGGGGGGGAGGTTGGGG
ACCTCGAGGGACACAGCAGAAGCTTAGGTCTGAGTGCCCGCACTCCTGTCATTTCTTTTC
TGTAAAGGAGGGGATGGCTCGGGGAAATGGTCCCCGTGTGAATTTCATGTAAGGAGTCTG
AGTGGTTGAGGAAGGAAAAAGCAAGCGTGTGCCCTGGGGAAAGTGGTAGAGAAGTTCTCT
GAACATGTGTTCCTGGCACGGCTTGTGTTGTATTTTGTGTAATCCCCTGACCTTCCCATA
ACGTTCCTGAGGCAGATACTGTTATCCTCATCTTCCAGGTGAGGAGGCTGGAGATTTTTA
GCCAAAGTCACATTGTCAGGAAGTCTGGCTTTAGATTCTGTACCCTTCTGCCTTCCAACA
ATCACAAGTATATAACAAGCACTCGGTAAGAGTGGGGACTTTGCTCGTGGTGAAGCAGCT
GAGGATTCGGTGTTGAGCAGTTCACCCAGGGACACAGTTAGTCCATGTAAAACCCAGCAC
AGGCTTTTGTCTACACCGCAGAGCCTCACCCACACCGGGCCCGTTTCCTTTACCATTCAG
TTTGTGCCGGAAACGATTTTGCCCTTGAGATCAGGAGAGAGTGAGTCCGTCCGCATTCCC
GCAGCTGGTGTCACCGATGATAAATTCTAACTGGGTCCGTGGACAGAGTGTTGCCAGTCT
TTGTTCAAATCCCAGCACGTTCTCTCAGCCTTGAATGTAATCTGGGCTTAATTCCTGCCC
TTCAGGCAGCTGTGAGATGTGAGGCAAGGTCTTTGTTTTATTCCATTTACTGAAGCCTCG
AGTCCCCCATTTGCTTGCTTGGCCACATCTGTAAAAAGGGGCCTTGGGTCCTAGTTTCCA
GGCGTGCTAATGGATAGGAATTGCTCTGGGGGAGAAGGTGAAAGAATCAAGTAGAAAGCA
ATGGTTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACCGCTC
TGAGACCTGCCAGCCCCTCCCTGTCCCGGGGTCGGGGGCTCCAAATTGGAACGTTCTTTT
CCTGTTTGGCTGTTAATTTAAGCACAAGTCTAGCTCTGTGACTTGGGATCCCCTGCCAGG
GTCTTGGGTTTCTTGTGCCTTACGGTCAGTTCTATACAGGGGAGGATCCCTGTTTCCGGG
TCCTCGGCGTAACCGGGCAGGTGTGTGGTGGCCAGTTTGTAGGTAAAGCCCTCGGCTGGC
TACCTAGCTTTTGTTCTCCTCCGTCACCTCGTTTTCCTTTTTCTCTAGGCCGGAAGGTCG
TCGTCGTGCGCTGCGAGGGCATCAACATTTCTGGCAATTTCTACAGAAACAAGTGTAAGT
TCGGACGCGGGAGGAGGGCTAGAGAGGATTGACCTGGGAGAGCCTCAGGCTTCCTTGGCT
CCAAAAGCGAGCCCGCAGGTGGTGGGAGGTGCCCGTGTGAGTTCCTAAAAGGCCCCTGGG
GGTGTGGATGTGCGGGTGTCTGGGGCTGAGCCTTGGTGCTGCTCTCTCCCCGCAGTGAAG
TACTTGGCCTTCCTCCGCAAGCGGATGAACACCAACCCATCCCGAGGCCCCTACCACTTC
CGCGCGCCCAGCCGCATCTTCTGGCGGACGGTGCGAGGTGAGCTGGGCCCGAGGACCGCA
GGCAGGGACGGCCGGGTGGCCAGTGATGAGGACTTCTCCCACTCGTGTTCGAGTTCCCCA
ACCATGAGATGACTCCACATGCACTACCATCTGAGGCCGCCTGTGCGCCGGCGGGGCGGG
GGTCCTCGTGAGCCCCGGTGAGCGAGCTGCCGCCCCTCTGCCCACAGGCATGCTGCCCCA
CAAGACCAAGCGAGGCCAGGCCGCCCTAGACCGCCTCAAGGTGTTTGATGGGATCCCGCC
CCCCTACGACAAGGTGAGCAGGACGTTCCCGTGCCGCAGTCGTGTGCGCGGCGTCCGTGA
TGTTGCACAGTCGTACCTACATTGTTTGATCCTCGTGAGAACAGCACTGACTGAGACGCT
CTTCCAGCCAGCCTTGTCCCCTGTCTGTCCCTCGCTCCAGGTTTCTTAAGCCCCTCTCCT
TCTCTAACAGAAAAAAGCGGGATGGGTGGGTTCCCGCCGCCCTCAAAGTTGTGCGGCTGA
AGCCGACACGGAAGGTGAGCTGTCCGTTACGTGGAGTGGTCTCGCGGCGGAGGGGGGGGG
TGGACTTGAGGTCCCGGAGGCTGGCAGATGATGTCTCTTTCTCACGATGGTCTGCGGATG
CCGCTGCTGGCAGTGCCGACAACGCCAATGGCTCAGCTGATGCCAGGAGGAGGGGGCGGG
GAGCCCTTACGGGGTCTGCTGTGACAGCTTGTCACCTGTCCCCTAGCCACCCTGGCTCCA
CTTCACTTCTCCCCCTTCCCCCACAGTTTGCTTACCTGGGGCGCCTGGCTCACGAGGTTG
GCTGGAAGTACCAGGCAGTAACGGCCACCCTGGAGGAGAAGCGGAAGGAGAAGGCCAAGA
TCCATTACCGGAAGAAGAAGCAGCTTGTGGTGAGGATGGGCTGGAAGCTAAGGGCACCAG
GCTCGTGCAGGGCCTTTGGGGGCGGGGGTGTGTCTGGATGCGGTGGTTCAGCCCCGGAGG
CGGGAGGGGAGTGGGATCGGGTGGGGTCCTGGGAGGAGGAGTGTCCCAGGTGGCAGCAGC
CACCGACCGGCATCTGTCCTCCTCACCCCACAGAGGCTACGGAAACAGGCCGAAAAGAAC
GTGGAGGGGAAAATCAACAAATACACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGA
GCCCAATAAAATTGACTGTTTATTCCTCATGCTTGGCCTGGCCTGCGCTTCCTCCATCGC
CGCCCTAGGATGTGGGGGACTCCGGGGGCCCCTGTTTAGGTGCCACAGGCAGCCTGGGCC
TTAGAATACTGGGACCACAGGGCTTTAGTCACTGCTGCTCAGGAAGGCCTCCTAAAATGT
TCAAACGGCTCTAAGAGCTTTGAGGCATAGATTGCCCGTGACGTCCTCATTCATGAAGTT
TTAAGAAGTTGACAGTTGCAACAACTAGGGCAGTTTCACCATTCACAAAAAAAAAGATAC
CTGGAAAGTGATCGGAGGGGGACCCTGCGTTGTGCACGGGGTGTGTCCAAACTTCCCACG
CGGTCAGGTGCTAACGCTGCAGCTGTGAGGGTGAGGGTGCTGAGGGCCAAGCTTGGTGTC
CACAAAGGTATTTCCAGGTGCACACACAGGGAAGGACAGCCGGGGGTCACAGGCACTGCC
CTCTGGCTTTCCCTGTACTTTGTGATCCCAAACCAATAAATTATTTTTAAAAAAATGTGG
TGTCTTGGCAGTGTGTGTCTGCTGCGGAGGCAGGCCCAGGGGAGAGAGGCCCCCTGAGCA
AGAAAAGTCGCTTGTCACAACGGTTGCCCTGTAACCTACCCTTCAAGGAATTTCCTCCAG
GGTCCCGCGTAGTTCTCAAAACGGCCACGGCCTGAGGTTGCCTAGTGGGTGAAGCTGTCG
AGTCAGCTGTAAAGTATGGAGTTGCCACCATCTCAGACCCAGTCCCATCCTCGCGGTCCT
ATGGGCCCTTCTGGTCTGGGCCACACCAGGAAGTCTGGGCTTTTTTGGAAAGAAAGGGAC
AGGGAATGTTCTGCAAGTAGTAATGCACTGGAAACGGGAATGTTAAATTTCGTGATGCCT
TTTTTTTGTTGTTAATGTTTATTTTTGGGAGTGAGCATGAGCAGGGGAGGCGCAGAGAGA
GGGAGACCGCATCTGAAGCAGGCTCCGAGCTGTCCGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2990..3053, 3235..3336, 3527..3612, 3790..3795, 3798..3804, 3807..3853, 4106..4228, 4413..4499
1001..1015, 2990..3053, 3235..3336, 3527..3612, 3790..3795, 3798..3804, 3807..3853, 4106..4228, 4413..4496
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved