Felis_catus Locus ENSFCAG00000008793
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000008793
Felis_catus
ENSFCAG00000008793
GeneScaffold_945
SNORD49
1755..1825
3705
TTTTACTGTATTCTTCAGGTAGACTGATGGACCTGTGCATTTGACCCCCCCACCCCCCA
CTTGGCTCTTGCTGGAAGCCCCCCACCCCACCCAAATCCTTAAGACCAGCTCACAAGTTG
TCTCGCTATAGCTTTCCCAATTTTCTCCAGTCCAAATGAATTGCTCTTCCTTGGTGTCCT
AAGTGTTCATAAAACGCGTACGAAATGAGTATTTTTTAAGTGGGGAAGACCTAAGGGTGT
GCAAATGCTGAAAGGAAAGCATTTGCGGAGAGGGAGAGGTTTACATTGCTGGTGAGATCG
AAGAACAGGCACAGGAGAAAAGAGGATGGAAGCGGATCCAGAGAAGACGTCTGCTTGCTC
CTTAGGGGTCATTCTCAAGAGTGATGAGAGCTGTCAGCAAGAAGGGATTTTGAGAGACTC
CGTGGATGTTTTGAAATAGCTGCGGGAAGAGAGCAAACTGGCAGCGCTTCTTAGAATCAG
AAGCACTACTATTTGTGAATGCTTGCTGTTTCAGGTGTGATATCTCATGTGATCCTCAGA
GTAACCTCTGCGGTGCCGGTATCTTCATGACCAGAGGAGCAACAGAAGCTCAGGGTGGCT
GAGTGATTTGCACAAAACCACGCAGCTAACAAGCGGCCGGGATCCCAACGCCTCGTTGCT
ACCGCGTTTCAGCCCCCACGCATGCGCCCTGGAGCACTCCTGGCACCGCGAGTCACATTA
TCCGGGGCCATGGGAGAGACCATGGGCTCTAAAGGAGGGGGGGTGGCCTGGGGTGGTGGG
GCGGAGTCTGCATCGTTAAATGGCTGGAAGTTCCCGTGAGTCTTTGCCAGCATTACCCTC
CCTCTTATGAAGAATGGAATATTCCGACTCCTTAAAGGCGAGGCACGCAGCTAAAGCGAC
CTTTCCCTTAGAGTCGCTATGGAGGTAAGCGGGGTTTGTAATTTAACTTAGTAGCTGGCG
GCAAGGGCAAATGAGCTAGAAGCTTCCTAGTTTCTGCAAAGAAGGTTTCGGGAGGCTTAT
GTGGGGAGTGGAGGGCGGCTCGGGCTTCGTGGCGGGCGCGTCAGTGGGGGGAGAGTCGCG
CTCGCGCAGGGCCGCGGGGGACCGAGGCTCAAGGGCCGCGTGCCTGTTTATCCCGTAGGG
CTGCTGCAGTCCCAGGAACCCAAGGTCCCCGAAGGCCGAGCCCGCGCTCCCCGGACCCGC
CGTGGGGAGCGCGCCAACTCCGGAGAAGTGGGTAAGTGTGGGTCGGCCTGCACGTGAGCG
CGCTTCGCGGGTGAGGTTGGTAATGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTGACGGTTTTTATGCCTGTCTGACCGCAGTCGCTGAAACCTCGACAGGGT
GATTGAACATCACCGCCAGAACTTGGCCCTTAACACGCGTCGCCCTCCATGTGCCAGCCG
GGAGCAGGATCCCGCCCTAAGGTAGGACCTAGTCCGGGCGGGGTTGGAGCTATAATTTGG
AACGTTTTGGTTGCTCAAATGCAGTGGAATTGGCTGATAGTTTACAGTTGTAAGGTTTGT
GCATTGGACACCGCACCATCACAATGTGTTGCTGAGAACAGCCAACGGCCTGGTTGTTTG
TGGAGCAATTACGGCTTGTTTCCAGGTGGTGTCCAGGTTTCTGGAGTGGTACTGGGGAGT
GGGGAGGTGCTTGACTGCTCTGATGAAATCACTTATAGGAAGTGCCGTCAGAAGCGATAA
CTGACGATAACAGTTCCTGGCTGACTGCAGTCAACAAGTCCTCCCCAGCTGCCGGTGTCC
TGGCGGATCTTGGTTTGAGCAGTGACCTTTATTTTCTGTATTCACCCAGGTTGCCAGTGT
CCGATCGTAGCAGCTGAAGATTCGAGTGATGAGTGGCCTGCCTTGAGGTGAGTTTTGATC
TCTGGAGAAGTTTAGTGGTTGAGTGAGCCTCCCTGTTACATTAGGTGAAGTTCCCGTTAG
ATAGTGGGAATTTTATCGGTTAACCTAATCCCTTGTATCCGTGTAGCCCTTGACCTTTAT
TGGCAACATCTCTGAGATCCTGATGATGGTTCATAGTGGTCGTGGAGCTGAGTGCAGAGG
AAACCCAGGAATTTCCTTTTCATCTCACTGCTGTATAATCCTGAGCAAATCGCTTATTTG
CTGAGATTGTTTTCCTCGTCCTTTAAAATGGCAGCTTTAGGTCTGGGATCTTTAAAATGA
TGTGACTAGGGGCACCTGGGTGGCTCAGTCATTTAAACACCTGACTTGGCCTCAGGTCAT
GATCTCGCAGTTCATGAGTTCCAGCCCTGCGTTGGGCTCTGTGCTGACAGGTCAGAACCT
GGAGCCTGCTTCAGATTCTGTCTCCCTCTTTCTGCCCCTCCCCTGCCCGTGCTTGCTCTC
TATCTTTAAAACTAAGTATTTTTAAAAACTGATGTGACTTAAGTGGAGGTTACGATATCC
AAAGAAGCCACTTAAGACTTTTAGACTTCTGTGGTTTAATTTACAAAAAAGCATCTCCAG
AATGTTTCCAAGAACTATTACGATGAACTTGGGAGCTGTAGTTGAGGCTATCCTGATAAG
ACCTACCTGTTTTGTCTTTGGTGTCTGCTGCCTGTCTAGGGGTGCCTGAATTGCCCCAGG
TTTTGAGTGCTGGGTTGTCGAAAATCAGCGATCAGCAGTGTGGAGTTGAAGCCAGTGGTG
CCACAGCTCAGCCCAAGTAGGGGTAAGCTTTTGTCTGGACAAGGGCCCCCTCCCCCTCCG
TGGTAGAATGAATAAGCTAATTTTGTGTAAACTGATATGCAGAAAAAGGATATCAAATGA
TGAAATCGCCTAAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGTTGAACCTGTGGTT
TTCTGAAGATATCTGTATGCTATGAATAACCGTTGGTCGGAGTAGAGAGTCCGTTGGTCG
GAGTAGAGAGTGAGACTGATACTTAGTGTCTTTGCAGGCTATCTTCCCAGAGAATGGTCA
GCCATGCGAGGACCAGTGACCACCATCAGCTTGGACTGAAAACCTAGACTTCAGTAGTTG
GTGTGGAAACAGTACTTACCTGAGGCTGAGATTCAGAGCCCGTTCCATTACCAGCAGTTG
AACCAACAAATGTGTTTTTGTCACTGTTGGTTTTCTAGTGTTACAAATATATTTCTAGTT
CTCCCTTGCCCAAAGAGCTTTCTGCACTTTTTAATTTTGTATAAATTCTGTTGGGTGAGG
GTCTGAGTTCTTAAGCTTAAAGCTTATTTCTTCCTGAAATTAGCATTTCCATGCAATTAC
AATAAACCAGTACTACGATAAAGGATGGTTTTTAGTATTGATTCTTAAAAATGTATTTGG
AGAAAAGTTTGATTACTGCTGTTACATATGAGCAGTCCGGGTATTGGCATTTGTCAACAT
CTGTATGGTCCGGCCTAAGCTGTTCTCCTGTAACAACTTCAGACTTTAAGGGTGAAAGTT
CCAAAGCATTTAAGGCATCCACACCTCTGATTCCAGTCTGTTGCCCTTGGGCCACGTCCT
TTTGCATAGCCTCCACCTCCTGAAACTATGCTTAGTCCAACCTTTGAGCAGTGGCAGGCA
AGGTGCCATAGTCTGGTTCTTGACCTCGCCCCCATCTTGCTGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1042..1068, 1071..1079, 1082..1193, 1195..1206, 1208..1230, 1492..1520, 1909..1925, 1927..1966, 2699..2705
1001..1039, 1042..1068, 1071..1079, 1082..1193, 1195..1206, 1208..1230, 1492..1520, 1909..1925, 1927..1966, 2699..2702
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved