Felis_catus Locus RPL23
snOPY snoRNA Orthological Gene Database
Felis_catus RPL23
Felis_catus
RPL23
GeneScaffold_4415
SNORA21
1133..1267
2557
GAGACTCCGGACGTCACTCGCTCCAGCTGCCCTCAGCGCCGACACCGCCCACTTCGCCG
CGAGAACTTAACCCGACGTCCAGCATTTATTACGTAATAAAACTGCGCCCTGAAGCCGTG
GAGGGAAGAGGTGGATTGAGCAGGCTCCGGGACACGTGACGGGATTGGGCGGGGCATCAA
GGTTCATATCCCAGAGTCCTTTGCACTGACTCCTCTTCCGACTCCGTGTTGAGCAAAGAT
GTCGAAGCGGGGTGAGTGTCTGAGAGATCCTTCGCCATCTGTCGCGAGGTGGCTGCTGGT
CGCGCCCGGAGCGGTGGCCACGGGCAGCTGTGGCGCTTTGCGCTCCTCCCGGGCGGAGAG
GGAGAGGGGGGCCGCGAGAGAGCGCTTGAAGGCTGCCGAAAGCAACTGGGGGGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTTCCTTTCTACCCGCAGGACGTG
GTGGGTCCTCCGGTGCGAAATTCCGGATTTCCCTGGGTCTTCCGGTCGGAGCCGTGATCA
ACTGCGCTGACAACACGGGTGAGACCTTCAGCTGCACCCTGCCAACCCCCCCCCCCCTTT
TAAAAGCACTCGTTGGGCCTTGACTAATGACCCACTGAGCCGTCAAGAAAGGGCAGAGGA
AAAACACTGCTTTTGGGTGAAGCAGCAGCATGCTGTGTTGTTTTGCTTCAATCGGTGGTG
TGACAAGGTATTGCACCTTGGTCAGGTGTGGGGGGGGCGACTAACTCTTTGGGAGTAAGA
GGGGAGGGAGAGGGTCTGGAAGTGACGGGGTGTGGGGGGGGAATGTTATACCGGGAGAAC
TGCTTAATAAGCTCTCCAAAAAAGTCGTGTTTGTTTACATTGTTTTATAGGAGCCAAAAA
TCTGTATATCATCTCTGTGAAGGGGATCAAAGGAAGACTGAATAGACTTCCTGCTGCTGG
CGTGGGTGACATGGTGATGGCCACAGTGAAGAAAGGCAAACCAGAGCTCAGAAAGAAGGG
TGAGTGGAGGTCCTGAATCCTCCTGTTGCTTGGTGGACAGGTGCCCTTTACTAGAAAATG
GAACAGTTACTCTACCATTTTCAAGGCTTCTTAAAAGCTTGATTTTCTTTGAGAGGAAGT
CTGAGCTATTGATCTGCAATTGAAGTTCTGCTCTTGGCTGTGTTAGAGACTATTCTCTTC
CCTATCTGGTTTTGTTGTATCTGTCGCTTTTTTTTTTTTTGTAATTGTTTTAAGTAATCT
CTGCCCAGCCTGGGGCTTGAACTCATTACCCTGAGATCAAGAGTGACATGCGCTAGTGAC
TGAGCCAGCCATGCACCCCATTGTTACATTTGCCCTTGTCCCCTTACGCCCTAAGTGTAT
TTGCCACACTGAAGTCAGGGCCCATCTTTTAAAAATGTAAGTCTGGGGTGCCTGGGTGGC
TCAGTCAGTTAAGTGGCAGACTTCAGCTCAGGTCATGATCTCACGGTCTCTGGGTTGAGC
CCAGCGTCGGGCTCTGTGCTGAGAGCCTGGAGCCTGCTTCAGATTTTGTGTCTCCCTCTC
TCTCTGCCGCTCCCCTGCTTTCTCTCTCTCTGCCAGGAACTGAATAAATATTTGAAAAAA
ACAAAAAAAGATTAAAGTGTAAGTCTTGGGGCACCTGGCTGGCTTAAATGTAAACCTTGG
CTTGTCATTTCCCTACTTAAGTTCTTTCTTGGTTCCCAATACAAGCTGCGAGGAAGTACA
TATTTACCCTGCCATCTCCCCGAGTTCAGTGGATAGTTCTAAACCACATCAGGTACCTAT
ACCTGTAGAAACAAAAGCCCTGTCCTTGTAGAACTTAGTCCTTCTTCATGGTGTCTTCTC
CAGCTCTATTGCTTTCAGGTCTTGATTTCTCCCTCCACCTTCCTTGGTGCTTCAGATCCT
TTGTACTTTGTGCCTCCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1430..1557
1001..1097, 1430..1557
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved