Felis_catus Locus KIAA0907
snOPY snoRNA Orthological Gene Database
Felis_catus KIAA0907
Felis_catus
KIAA0907
GeneScaffold_1715
SNORA42
11333..11465
16840
TAGCAGCCTTCGATTGGTTCCCACCTTTAGGTCAAACCACAACTGGGGGTATGGGTATC
TCAATGATTGGTCAGGAATACACGGGCGCGCCAAGCAATTGTACAGAAGTGGAACAAGCT
GGTTAAGTTTCAGTTTGCTTAGGCCTCTCACTACCAGGATATAAATTTATTTGAAACACA
GCACTCCATGCTAGTCGTTCAACCTATCCTAGCAGCTTGAAGACCCACCAAACGCCGTCG
GTCCGCGGCGTCCCGGCCCCAGCCCCGGCGGGGCGCCCCGGCCCGCCCCCCTTCACCTCC
GCCGTCCACGACCCACTTCCAGCCCAACCCCGGCGGTGCGCCCCGGCCGGCGACCCTCAC
CTCCGGGGTCCACAACCCACTCCCAGCGCCCCCAGGCCCCGGCGGAGCGCCCCGGCCCGC
CCCCGCCCCTCCGCTCCCGCGCCCAGCCGCCGGCGCCCCCTCGCGGCGCGCCCCCGAGGC
CCGGCTCTGAAAGCAGTGGTTGGCGTGCAGACGTGAAACAACTAGAGAAATTTCTCACAT
GACCTTTGGGACGCATCATTTGCCGTTTCCTAAGCAGGTAACTGAGTGAAGCGGGCCAAA
GTGGCGGGAAGGCTCTCTCCCTGGCCAGAGGCTGGGCCTCCACACAAACGTGGCTGGACC
GGGGAACAAACTGTTTAATTCCCCGACTCTTGCGTATTGTCTTGTGGGCTACCTACTTGC
CCACAACAAACATGGATTCTCCTCGCCCCAATTGCGCCTTGATATGCTCTTCGGCAGCCA
TCTTTCTCCAGGGCAAGCCGAAAGCAGGAAGGTCACACCCTACCTGTCTCGGATAATGCC
AGACGCCTTGAAATCAACAAGAGTCCAATTGGAACCGACGCTTTCACCGGAACGGCTTTT
CCTCACGACCGGAAGGGGCTGTGCGTGAGGGCGTTGGGGGCGGAAGTGACGGGAAGGTGG
TAGTGGGGTAGTTGGCGGGTGGTTGAGCAGAGCCGGTCGCCATGTCCGCGGGGAGCGCGA
CACATCCCGGGGCCGGCGGGTAAAGCTTCCTGGGCGAGGGCATCGCGGCTCGCACGGGGC
AGAGGAGAGACGGAGGGACCGTTGGGAGCTGCGTATGGGTGTGGGGGGGCGTTGAAGTGG
GAAGTGTACGTATTGGAGGGTTGGGCTTTTGGGGAGAAAGACGGTGAGCAGGCCTTGGGG
CCCCCGAAAAAGGCCGGCAGGGAGCAGAGGGAGACGGAAAGCAGGGACTTTTCGGAAGGA
CCGGCCAAGAGGAGGGGCAAAACGGGGGCATGTGGGACAGAGTGGAGTTTTCTCAGAGGG
GTGATGGAGTAGAAAAGAAGTAGATTCTGGAGTAGGGTCGAAATTAGTGAGGAAATACTG
CAGTAATTGTATAAAGAGAGGTGGTCATTTTAATATTGATAAGAGACTTGAGGGTGTAAA
GAGGACACGATAGACGGCAAATGGGGTGCTAAAGCGTAGTAAGGGGAAGAATAACATGAA
TAAAGCTTTGGGGCCCAATATTTTCCTCTTTTTCCCGGTAGGCGCCGCAGCAAATGGGAC
CAACCAGCGCCAGCCCCCCTTCTCTTCCTCCCGCCGACGGCCCCAGGTGGGGAGGTTACC
AGCAGTGGGGGAAGCCCTGGGGGCTCCACAGCTGCTCCCTCTGGAGCCTTGGATGCTGCT
GCTGCTGTGGCTGCCAAGATCAATGCCATGCTCATGGCCAAAGGGAAGCTGAAACCAACG
CAGAATGCCGCCGAGAAGGTATTTGAAGTTGAAGGGACTCTGCTAATTGCGATGTTAATA
TGGGTTGTTTTGTAATTGTGCGATCCAAGAATCCTGTGTGTAGAGGAGAAAACCGGGACC
CAGTAATTTAAGGATCACTTAGTTTTGGAACATATCAGATGATATTTTGTCATTTGTTTT
TACGAGGCAGCTTTGGTTGGTTTGACTACATTTACGGATCAAATAGCTCATTTTTGTCTT
TGTTCTTAGTTCGGCCTGCTATCTACATAATCATTTAAAGCAACGATGTAGTATATTTTT
CACCACATGTGCATTTTCCCTGAAGTCACATGAGAAAGTCCAGGTAAATCAGTGAGCTTT
AAAATGTCTCTAGTCAACTCTGCTCAAAAATACGTTTATAAAATGTCCTTTATAATTAGA
ATCTAATGAACGTCTACAGTGTAATTAAACATGAAATAAAATGAACCGTTTATATGATGG
TTGGTTTGCTGTTTTCATACAAATTGGTCATTTTATAGAATTTGGTCATTTTATAGAATT
TGGTTGTTTTATAGAATTTGTGGTATAACTAAAATCTCACCACTAGACTGGATCTGAACT
TTGAAGTCTTTAACTTATCCTGTAATAGGAAACCAGAATCTTCTACAGGACGATGCATAT
AGTGGCTGTTTGTAGTGCTAGAATGCATGCTTTGCACTTAAAAGAAACCCTTATAATTTT
AAGGGATGGATTACTGTCTCCAGTTTACAGAGGATGGAAATTGGGCGTGCGTGTGAATGT
CAAGTTGTGTAATTGTGTAAGATCTGTCATGGTTGGCACACGTGTGACTTCAGAGTCGCC
TCGGACAACTGGGTGTTTAGCTTTTGCTTGAAAGCCTCTGGAGTTGGAGAATTCAGTGTG
TCCCAAGGCTGCTTGCTCCATTATAATTCTCATTTGAAAAAAAAAGTTCTGCCGGGGGCG
CCTGGGTGGCTCAGTCAATTGAGGTCATGATCCAACTTCGGCTGAGGTCATGATCTCATG
GTTCGTGGGTTCAAGCCCCACGTCGGGCTCTTTGCTGACAGCTCAGAGCCTGGAGCCTAC
TTCCGATTCTGTGACTTCCTCTTGCTCTGCTCCTCCTCTGCTCATGCTCTGTCTCTCTTT
CTCAAAAGTAAATAAACATTTAAACAATTAATAAAAAAATAAAGCTGACTTCCATAGTAC
CTGTGAAGAAATGAGTTCTGTGTTTGCAAATGCAATTTAGGTGAGCAGCGACTGTGTTAA
TTATAATTAACACGTTGTGATTATTTCACAATGTAACCGTATATCAAAATATCCGGTTGT
TCACCTTCGGTATATGTACACAATTTTTGTTTGTCAGGTATACCTCAATAAAGCTGGGGG
AGAAAGGAAAATACAATTTTTTGTTAGCTGTCCTGTGTATGAGTATGATATCAACAGGCC
ATAATCTGTCTGGATGTTTAAATATTCAAGTTCGGCAGAATTGGTGGGAACTTCTAGTGA
ATTGGAAGTTCGTTATTTTGTAGTTTGATGGTTTGCAAAGATTGAGTCCGTTGTCCGTTT
GTAAGTTTTACAAGGAGCTATAACACGCTGGTGATCATGGAGTGCTTCTTGAGTAAAAAA
ATTCTTAATACTGATGTGAATCACTTATTTTTTTTTTCTCTAAAAAGCTTTTGAGCTCAG
CAGGCGGCAGCACAGTGCACAAATAGTGGATTTAGAATCAGAATATCTAGATGTGAAACC
CAGGGTCCTCGGTTCTTGGCCTTAGATATGTCGTGGAGCCCCAGTTTTCCTCATCTGATG
GGGTTGGTGACATGTACCTGGGTGGTCCCCGACAGTGGCTGCTGCCTCCTGTAGCTATTT
AAATTAAAATTTGAGTGAAAAGTAAAATTTAAAATGGAGTTCCTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTCCAAGGCAAGAAAAGTTTGGGGAAGGCCATCTT
GGGATGAAATTTTTCTTGAGTAACTCCAATCCAGCTATCTGGAGTTGCCTACAGTTGAAG
TTGAAAGAAGCCAGATCAGATTTTAGGATTTTGCTTGACTTTTCATCCATTCTCTTAGTT
CTTTAGTAGAAAGTAACGGGTTGTCAGGTAGAACTGACGGGTGTTCCAGGTCACTGCAAG
GATGGGATTAGGTGAACGTAAGGTGCCATGGCCGCAGCGGTGGCACAAAGGCAGCGTCCG
GTTACACAGGTGAGGTGCATGGGTTGCTGGACTCTGCCCTGTATTTTTTTTTTTTAACTT
AGTTTTTACATTTATTTATTTTTGAGAGACAGAGCACAAGTGGGGGAGGAGCAGAGAGAG
GGGGACACAGAATCCGAAGCAGGCTCCAGGCTCCCGGCTGCCAGCACAGAGCCCAACGTG
GGGCTCGAACCCACAAACCGGGAGATCACGACCTGAGTCGAAGTCAGACGCCCACCCGAC
TGAGCCACCCAGGCGCCCCTGCCCTGCATTTGACTGCACGTACGGCTAGCTGGTTGAGGT
GCAAAGCACCATAACTTGGTCTTGTGATTTTCCCTGTGCAGATGGCAGCGTAGGGTTTCT
GGGATCATGTGATCGCAGAAACCCACACGTGGCTGAGGTTACAGAGAGACCTGAGGGTTG
CCTTCAAGTCAGTTGACAATACTCGATGTCAGTTCAGTGAGGTTTTGTTTGCTCGTTATG
TCGTTTTTGCAGAACGACCCAGGCGTGTTTCCAAAGTGTGTTTGCAGGCAGGTTTGGGGA
ACGGTAAGGTGGTGGTGGGACTTGGGAAGGGCCGGTTGTAAATTGGACAGCAGAAAGATA
CTATTTCATCTTACAGTCTTTTTGATCTAATTACTCTTTCTTGGTAGCTTCAGGCTGCTG
GCAAAGGCCTAACTAGCAATAAAAGCAAGGACGACCTGGTGGTGGCTGAAGTCGAGATCA
ATGACGTGCCTCTCACGTGCAGGAACCTGTTGACTCGAGGGCAGACTCAGGATGAGGTGG
GGAGATGTGGGGCCTCTCTGGGGACGGCGGTGGCTGGGCGTGGTCTTGTGAACGCGGAGA
GCGGAGTCAGATATTGATTAGCGGGTTTGGGTCATAATCTCCAAAGTCAGGGTTGGGTTG
AATTAACTGCAGAGGAACTTTCTAGTGAAGGTGAAGGAGCCGATATGGGTGGACTCCCTG
GGTCAGCTTGAGCTGGAAGCGATTTCCGATACGGGAGGGATTCCCGTACAGACGTCATTC
CTGTCTGTTGGTGGAATGAACGCATGGGGAGAATCCATCCCACTGCCTGTCATCGAAGTC
GGTCAACTGCCACATCATCCTTTTAATAGAATGTTTCCTTTTCAGATCAGCCGACTTAGT
GGGGCCGCGGTGTCAACTCGAGGGAGATTCATGACAAGCGAGGAGAAGGCCAAAGTGGGG
CCAGGGTGTGTATGCACGTCCTCTGCTTTGGGAAAAGATTGGACACGGGCTCACGTTAGT
GTGTGTTTCATTCTGAGGAAATAGGTGTAAATATTTGGTCAGCAGCTTGCTAGACGTACA
CGCATGCTTCGTAGTAGAACTTGGGAACGTCTCAGACGTGCGTAAGGAGGGTCGGCAGCT
CTCGTCCTTCCTGTTGCTCTTTGATTTTTCATTTCATGGGTAACGTTTTCTTAGAGGAAA
CACGTTACGGGAAAGTGTAAGATGAGACAGTTGCTAACATTTAATGACACGCTTCTAAAT
TTTTGTGTGGGAATGTTTCCCCCAACAAAAGGGTGTGTGTTTTGTTGTGATCTCCGTCTA
AAAAACATCCTTTTGTCCGACTCCTTGCTGTGTCCAGGGTGGCTGGATTATCTATGTAAA
CATCTCGTCCCCTTTAGTTCGTCTCTCCCATTACTCGGTGTTTGGGGCGGGTACTCAGGC
AGTGCAACATTTTTCACGTTGGCCCAGACCAAATATAATTAGGAAGCAAAACTTGCTCCC
CACCTGAGACAGTATATTGCAACTGTGTGCACGTCGGTTGCTGTTTTGAACTTTTTTGTC
TTTAGACACAGCTCTTTTTTGCTGACAGCTTGTTATGAACTGTATGGTTATCGAAGATCT
TCTCTGTGATTACAGTCAAAATCTGAATCTAAGCCACTTTACATTCAGAGTCGAGAGTTG
CTTTGGTTGCGGGCCTCACAGCCATGGGTCTGTGCGCTCCTGTCACTGTCACCCCGGTCA
TTTGGATAGACGAGCGTGTCTGCACGTAACCTGTTAGGCAACAAAAAGGAATTTTCTCAA
ACACCCGGTTATCTCGGTTGACTAGATCCCCGTATTCAGGAGCCCATACGAACAGATTTG
GTCCTGTGTGGGCTGGCTAACGTGAAGCAACCAAAAAAGTTTATTCAGCCTCAGCTTTAA
ACCACGTTCTTAAAAATTAGCAACAGTCATTTCTGTGAATATAGTGCCTTTGCCTTACTT
GGAAAGTATAAACGTTACAAATTCGGTGGCCCATTTGGTTCCTTTGGTTATGACCAGTTT
GGGATCATCATTTTGTATTTCTCTTTATAGGGATCGTCCGTTATACCTTCATGTTCAGGG
CCAGACACGGGAATTAGTGGACAGTAAGTAACGGTTGGGCTCACATCTGCTTTTTGTGAA
GGGCAAAGTATAGGGCCCTAAGTAACAAGTTGGCAGAATGTTCCCGGGCTGTGCTAACTC
GTGTGTATGAACCGCTTACGAATGGGCTGGGGGTTTAGAGAGGCTGAGAACCACATACTT
GGGGATCCTCTAAAACGGATTAGTACATGGGCACCTGAGCGTTGACCTTTGTCACGAGCT
GGTAGTCCGTGCGTTCATCCCATTGGTATAACATCTCACCCTGTTTTTCCACAGGAGCTG
TAAACCGAATCAAAGAGATCATCACCAATGGGGTGGTCAAAGCCGCCACGGGGACGAGTC
CAACTTTTAATGGTGCAACAGTCACTGTCTATCACCAGCCGGCGCCCATTGCACAGCTGT
CCCCAGCTGTTAGCCAGAAGCCTCCCTTCCAGTCAGGGGTATGTTTGGTGGAGAGATCCC
CTAACAGCTTTGCTATTTCTGTAAAATTGACATAGGCCACAGAAAACGGGAGACGAGAAG
AACATAGAAAATTTTGAAATTCTGACCTGAGAGTTCCCTGCTAGCGCTGGCCTGGTGACG
CGCCCTTTGGAAAGGGCGTTGACGCAGTCGAGGGCACACCGTTCGCTGTGAAGTTAGTGG
TTTGGTTCTGTGTCTGTAAATGTGACGGCAGCTGGAGGACTAAGAAGGCTGAGTCTGGTG
AAGCAAGACTCTGCTGATACAATCCTCCTAGAGAACAGGGTGGGCGAGAGCAGCCCTCAC
TGGAGGACACCACGGGGCTGACTGCACGACCCGACACGCCGCTATCGCGTCCCGGGAGAC
CGCACCGGGCTCTCCCTGCCTTGCGGTGGCCTGGGCCGTGGGCGTGCTTCCTGAGCCGCG
AGTCTTTGCTTTATGCCTGTTTTGCTGAACTGAGGAAGGTGTTAATGTTCTAGGTAGGTG
CGTGGGATAGGCAGATCTCATTTAAATTAAGTTACTATAGGGGCGCCTGGGGGCTCAGTC
GGTTAAGCATCCGACGCTTGACCTTGGCTCAGGTCATGATCTCAGGGTTTGTGGGATCGA
GCCCCACGTCGGACTCCATACTGACAGCGCAGAGCCTGCTTGGGATTCTCTCTCCCTTTA
TCTCTACCCTCTCCCCTGCTTACGCACTCATGAACACACGCACTCTCTCCCTCCTTTTCA
AAATAAACGTTAAAAAGAAAAAGAATTTAAGCTGCTTTGTAAAGTTTATTTTTATAGGCT
TATGGTAGAAATCATTTGGAGTCCTTGTTCTAACAGTGACTAAAGGTATCTGGAGGATTA
AAGTCTCGCACATAATCATTTTCAAGATTTGGATTTAATTATGTGTCATGTTTAATCTGA
GGTGTTCTGTTCTTCCACAGATGCATTATGTTCAAGATAAATTATTTGTGGGTCTAGAGC
ATGCTGTGCCCACTTTCAATGTCAAGGAGAAAGTGGAAGGTCCAGGCTGCTCCTATTTGC
AGCACATTCAGATTGAAACAGGTGCCAAAGTCTTCCTAAGAGGCAAAGGTTCGGGTTGCA
TCGAGCCAGCATCTGGCCGAGAAGCTTTTGAGCCTATGTATATTTACATTAGGTACGTGT
GGATGGGTGGGGCTGAGGACATTTGAATGCTTGTCACCAGATCAGTACAGGCAGGGATAA
TTCAGAAGGTGTAAGAAAATAGGTTTAATAAACCTTAACGTGAGGGACTTAGGTCAGTAC
TAGGAATAATCAATTTGTAGTTACTTAATAAGAATGATTGAAATAGGAGGTGGAATTGCC
TTTTTTAGTATTCAGGTTCTTGGGTTTTATACAATCTCTGACCCTAAAGTAGCTGTGATG
AGCCTAAAGTAACCTTTTTTTAAACCTACGACAGTATTCGTGTACTTTATAGTGATTTTA
GTGGCTTTTAAAAGTCTTGTGTCAAGAAGTACCATAACTCAGAGAGACCGAAAAGTGTAT
GTCTCGATGATACTGGTTATATCTTACAGGGCTTCTATTACGTTATTTTGTGATTTTCAG
AAAGTTAGATTTGTGCTGCATTAAATGTATTAAACTTATAAACAGTATACGAAGTGAAAC
ACGATTCTGTATCTTTTACTTTTCTCCTCTTTGAATTTTCTGGGTCTTCTTTCTTTGCAG
CCATCCCAAACCAGAAGGCCTGGCTGCTGCCAAGAAGCTCTGTGAGAATCTCTTGCAAAC
AGTGAGTTCTGTTCGATTGTCTGATACGCAGAGAACTGCTGGGTGGGGCTGTGTCTGAGC
CCTCTTCCCACCTGCACTGGTTTCCGAGGGCTTCAGTAACAAGTTGCCACTGACTAGGTG
ACAGAAACGTATTCTCTGACTGCTCAGGAGGCCAGATACGCAGAATCCAAGCGTGGGCAG
GGTTGGCTCTTTCTGAACAACACCCTGCGGGAGAATGTTCCACGCCTCCCCCGGCCTGCA
GCCCTTTGCATTTTCGCCTGGTGTCAGCAGAGCTCCGTTCTCTGTCCCGGTGACACCTGG
CCTACTCCTGCCTCTCCTTGTCCATCTGTCTGTCAGAAGGGTGGCAGTCCTCGGATTTAG
GGCCCACTGGAATCCAGTGTGACTTCATCTTAATAGCATGTATCTGCAAGACCTTGTTTC
CAAATAAGGTCACATTCTGGGGTTTTTGGCAGACGTGACTTTTGAAAGGACACCATTTAA
ACCACACTGTTCTGGCCACTAACATTCTCTCTAAGGAAGTCAAACTACCCTAGCATGTCC
TCGCTGGTGTGCGTTTTCTTCTTTAGGAGGCATTTCAGTATGGAGTTTTGGAAATGTGCA
GGCCTTCAGTGTGAAATCTCAATGTCCTCAGTTACTTAAGTAGACGATACTTTTAATCTC
AGTCAGGTTGTTTGCTGTGGGCCTTCCAAGTTCTTTTCAACAGTAAGTTTGGCTAAATAA
GGGAGGAAGGTGGAACTACGATGGTTTAAAACCAATCGGCAGTGCTTTGGCCTAATTGCT
TATTTGAGTATTCTTTTTATTCTGTAGTCTAGTAACCAAAAGTTAAACCGGGAGGCCTCT
TTGCGTAGCACCTGATGGAAACCAGGTTTGGGGTTGACTGTTCAGCGTTGTGTTATTTGA
TACGTAAGGGTTCCAAACTTTTGGGAAGCTGTTTGCTTTGCTTCTGCAAAGTAACCTGAT
TTACCATCCTTTGTATCAGACAACTGCCCTGACCACCCCCTGGCTTTGTCTCGTTGCTGC
GTGCGGCGACTCAGTGGGATGCCCAGAACGAAGAATTGGAATTGGTGGGGGGAGGAGGGG
GGACATACTAGCTCTGTGCTGAGCCTTGAGCTCCTTGAGGACAAGTCCGGCAAATAAAAG
AATGAATGATTTCTCATTAGTTACATTGACAATTTAGGAACTTCCTACCTTCTGTATCTG
TGTGGCTCTGGATGATTTTTACCTCAGAGTTGGGTCTCATTTGGGGGATTTTAAATAATC
TCTACACCCAACATGGGGCTCAGATTCACAACCTTGAGATCGAGCGTCACACACTCCACC
CATTGAGTTAGCCAGGCGCCCCGTGCCTTATTAAAATTTAGAGTAAACAGGTCTCAAATA
GGTTGAGATGCCAGTGGAAATATTTTAATCCCCGGCTGCTTTAGTCCCAGAACCAGACCC
TTGTAAATAATCCACAGATTGGGACTGTCCCATATGAATTTGTCTTCCCTTCTCTTGCAG
GTTCATGCTGAATACTCTAGATTTGTGAATCAGATTAATACTGCTGTACCCTTACCAGGT
GTGTATGTCTCAAAGTGTTTAACGAAGATAAATGCGTTGTTAGCGGTATCTGTGTGTAAA
ATAGATACTTAAGGCTAGACTAAGCGTGCCAGGGCACTCAACCTAGGGTGATTTGAAAAG
CCATTCGTACCTCAGTAGTTTTCTTCCCTAGAGATTAAGTTAATATTCAGCTAAAATGTC
TCATTCTGCTGCAGCTGATTAAACACTTTTTTTCTTCCCCCTCAGGCTATACACAACCCT
CTGCTATAAGTAGTGTCCCTCCTCAGCCACCATATTATCCATCCAATGGCTATCAGTCTG
GTTACCCTGTTGTTCCCCCTCCTCAGCAGCCAGTTCAGCCTCCCTACGGAGTGCCAAGCA
TAGTGCCACCGGCTGTTTCACTGGCACCCGGAGTCTTGCCAGCATTACCTACTGGAGTGC
CCCCTGTGCCAACACAATACCCGATAACCCAAGTGCAGCCTCCAGCTAGCACTGGACAGG
TAGGACGCCGGGGCGGGAGCCGGACGCCGCTGTGCTGGGGGAAGCCGGGCGGGGGAGGGG
CGCGGACGCGGCGGCGTCGTGGTGCAGAGAGAGCAGGTGTGTAATTTTGGTGCAGCGGGA
GGGGTTTTCTCCCGTTCCTCCTGCGTTCCCGCCACCGAGCTACCCGAAGGCTTCGGGGGA
CAGCGTGCACACACCAGTGTGTTCGTCCTCAAGTGTGTGGCACCGGCAGACCGGTGTGTA
GAAGAGGGGTCGGCCAGCTTCCTCTGGAATGCTGGCCGCCAGCTAGGTTGGGTGTTGCGG
GCCCTGCGGGCTCCGTCACGCCTGCCGTGCCCGGTCGGCGGGCGCACGCGCGGCCCGAGA
CGATAACGAGTGAGTGAGCGTGGCCGGGCTCCGGGAACACTCGAGTCGCAAGTGTACAAG
GGCCACAATCGTAGTTTGCCTGCACCTGCCTCCGGGAGAGGGGAGCCAGCCCACGCCACG
CCTCCACGCGTTTGGAACGGAGTCCCTAAGCTTCGAAGGAAATCCACCATAGGCAGGGGT
TCCTAGGCCAAGGGCTACATGAGCTTTGCCAACTTAAGGATCGTAAATGCTCTCACGGAA
TTCTCAAACTGTAAGAAACTAGAATTTTCGGAAAGGGTAGGCAGCTAGCTCATCTGGACG
GATGGTGTCCGACCCTACATCCATCAGAGAGCAGAGGGAAGCTAGTGAGTGAGCGCACGG
TGATTGATGGCGGGCCCTTGACCGTGGGCCTCTCAGAGTGGACCCGTGCCAGAGGAAGTG
CAGCCCCGAACCATTGCCCAGCCTCCTGATCGGTGGGCTGTGAGCACTGAAGGGGGCTGG
ACAGGGAGAAACAGCAGAAGACTTCGCTGAATTCTGGCAGGGACCCTGAGGCCTAATCAC
GTGCCTTCTGTGTTTGGCAGAGCCCTAGTTCTCCAGCCGCGCTGGAGAACTTGAGCCGTT
CTTGAGCCGCGCTGGTTTGTGACCGGAAATGTACATGGTGGAGCGGGCTCTTTAGGATTG
GGCTTGAGAGAGCGGGCGGCCCGGGCCCCTCATGCATTCCCGGGTTTGAGCTGTGCCTTC
CTGGAATATAATTCAGCCTATCCAGGCTTTGGTTTCCTTATGGAGAATGGGCGTGGGACG
CCTGGGTGGCTCAGTTGGTTGAGTGTCTCTCGATCTTGGCCCAGGTCAGGAGTTCAGGCC
TCCGAGTTGGGCACCGCCCTGGGTGTGAAGCCTACCTTAAAAAAAAAAAAAAGAAAAGAA
AAAGAAAATGGGTGCAATGATAATATCTCAGAGGCCGCAAAGGTTAATTGAGGTGACCCA
CGTGTTCAACAAGTAATGGCTATTTGATAAGACTTGTCTTATCTCTCTGATGCGTGCTGG
GTCAGTCCTTATTCCTTTTTGGAACAATCTCTTAAAACATTAGACTCCCCGGGGCGCCTG
GGTGGCTCAGTCGGTTAACCGTCCGACTTCAGCCCGGGTCACGATCTCGCGGTCCGTGAG
TTCGAGCCCCGCATTGGGCTCTGCGCTGACGGCTCAGAGCCTGCAGCCTGCTTCCGATTC
TGCGTCTCCCTCTCTCTCTGCCCCTCCCCTGTTCGTGATCTGTCTCTCTCTGTCTCAAAA
ATAAATAAACGTTAAAAAAAAAAAATTAAAAAACATTAGACTCCCCGTTGCTATGACAAC
TTACCCACGGAAGTGGCAGATGGACTTGCCTTTGCCACGAGCGTTGGCAGTCTTTATGAT
CCAGAAAGAGCTAATCGCGTTGATTAGAGGAGCTTAAATTGGAGAATGTTTGGCTTGTAA
CTTCTGAACTAAGTAAGTGGCTAGAATTTGTATTATTTGTTGGTCACGTTTGCTCCTAAT
CGCCCAAGTGCACAGCAGATTTTTCCGAAGAGTTGAGAGCACCTTAGAGATCGTCAGTTT
TGCATTTCCCTACCGTCAGGGTGGGAAGGCTGTACTGTCACCAGATGATACAGGAAGGAA
ACTCGCGACCAGAGATACAGGATTTCTAGGATACATGTGCATCATTAAAATGTATTGTAA
CTATTGTGTCCTTAAACTGGCTGGGCATTCTCACACCATTTTTCCCCTTGGTTTGTTTTG
GTCCCAGAGTCCGATGAGCGGGCCTTTTATTCCTGCTGCTCCTGTCAAAACTGCCTTGCC
TGCGGGCCCCCAGCCCCAGCCCCCGCCCCCGCCCCAGCCCCCACTCCCAACTCAACCCCA
GGCACAGAAGAGGCGATTCACAGAGGAGCTACCAGATGAACGAGAGTCTGGACTTCTTGG
ATACCAGGTTAAATAAAATACTTTTACTTTCCTCCCCATACCCTACTGTATCTTTCCTTT
AAAGAAAGAAATTCACATCTATGCCAGTTGCTTTCCCAATAACGAGGATTTCTGTTTTCT
GGAATCCATATAGATTAGGGTTTTTTCCTTGGGGGATTAACTGAAAGCAAGAATGAGTCC
CTTTGGGTGGGTTTGTCTTTGGGGTCAATATGATAAAATCCAGAACTCCACATAGAGAGA
AGTATAGGTCTCTTATGACTGGCACCTGGAACGAGTCGTGTAGATTTCTGCACTTCCTCT
TACACAGCACTCTTGAAAGCCTCAGATAGTTCTCGCTTCCCTACACATCTCACCAAAAGG
TATCATTCTACCTCCCAATAGTGGTTTGTATTTAAACCTTAGCTCCCAATTTACTGTTCT
GTCTCTCCATAAGAAAGAGTGATTTTTTTCCTCCAGTCCCCCACCGCCTGCAGAAAAAGG
TGGCCAAAATGTGATTCTGTGCATATAGTCATTCGAGTATAGGGTTTTTAAAAATATTAT
TAAAATGTTTAGTTTTGGTGCAGTTTTGTTTCATCAGGAGAAGCACCTGCGCTTTTTGCC
AGAGTCCTTGAAGCCTTCTTTGAAACACGCTTTGAAGCATTTTTATAGTTCTAGATGGAG
AGTTGAAAACAGATGCAGGTAGCATAATCAATCATGATGTCCCCGAGCAAGTCCTCCGTA
GAGAAGAGTGATCTCTGTTTGGGCCGTGGTTACGCCCCAAATCCCAGAGAGCTATGTAGT
GCAGATTACTGCAATTGACCAGAAAGACAAGGCACTTGACAGTTACGTTAAGGAGCTAAA
GTCTGTACAGCAGTTGTAGATTTGCTAATGCCACTGTATTTTTCTGCTCATAGCATGGAC
CCATTCATATGACTAATTTAGGTACAGGCTTCTCCAGTCAGAATGACATTGAAGGTGCAG
GATCGAAGCCGGCAAGTTCCTCAGGCAAAGAGCGAGAGAGGGACAGGTAAGTTCATTGGA
GCGGAATTACATGAATGTATTAAGACGTCCTCTGTTTGCATCGTTAGTGAGAATGGTCAT
TGCTGTGGGCTTTCCGTGTTCTAAAACTGTAACGAGATCCTTTGGCTCAAATAAGCTCCT
GTTCTTTGTAACGGATACGCTAATGGAGAATAGGACGCGCCTCCCAGTCTCCGGGCCGCT
GTACTCGACTTTGAATAATTCAGTGCTTGTTCATTCAGGCATCTTCCTTTACCTTCACTG
CCTGCATCTTGGCCGTTTTCCTAAGCGTAGGCAGGGACAGGAGTCTGACACAAGCCAAGT
TTGCTACTCAGAATCCTAGAACCTGGTGGGTTGAGGTACTTGAACGGAGGCCCGGCCTGC
CACCCGGGGCTCGCACTCTCCTGTGCCATCCTTTGAGCCTTCACTAGATGAGCCTAACTT
CTCCCAGCAGCGCATTCTTGTTTTGGCCCGGCCCAGCCTGGCTGTGTAGACAGGCCTTAC
AGTCTGACAACTTGATGGTAGCTTGAAGGGTGGGGTCAGGCGGAAGGGGTAGAAGTGGAT
GGTTACCTGCTTCGTGTCTGCTGGACAGGTTCTGGATGGATTGAATCTGTCTGAAAGGGC
TGTCACATTTTTTTCTCCTAACAGGCAGTTGATGCCTCCACCAGCCTTTCCAGTGACTGG
AATGAAAGCAGAGTCTGATGACAGGAGTGGGTCTGGGGCCGGAGCAGGGGGCCATGGTGA
GTGAGGTGTAGCTGGGGACACTCGGGTGGCTAAGACTGTTCCTAAGCTGTTAGTTTTCTG
ACCTGATGTTCACTCAGATGGCACTCATTCAGGTGTTTAATCCAGCTTCTAAAATCTACA
GGCTAATGAGAATACTTGTTTTTATTTAAAAGGACGACATATAGTTACACGGGCTTTAAT
TTTCAACCGACGTGTGTCTAGGAAAGAGTTAGTTAACTTACGTTTTATGCATAGCATTAA
AGCCCTAGGAAATACTAATGATTGGTAGGTCAGTTCAAAATTTTGTTGCCTTTGTTATCT
GAATACCTGGAGGTAATCTGATGCAGACTTGAGGACTGGTATTTCGGGGCACGTGCCTGG
CTCAGCCAGTGGCACATGTGACTCTTGATCCTGGGGTCCTGAGTTCGAGCCCCATGCGTA
GAGCCTACTTTTAAAAAAGATGGATTTTTCTTTGTATTGGGAGCTGAGCTCCTTCTCTCT
GCATAGCTCTATCGATTGAATGGTCAGCCTGTGGCTGTTGAAAAAGCATTGCCTCTTAGT
ATCCCAGAACTCTAGATGTGTAGAGGAATATGGGGCCACTCGTGTTCTTTGCCTGTAGTG
ATAAAAGTGAGCAAAAGAAAATACATTTTTTTTCTTTTCTTCTTTTTTTTGAACTCTTTA
AAAGGTGAAATATTAGCCTCCGGAGACTCACTTGCTAACTTTACTTTTTTTTTTCTTTTT
TCTTTTTTTTTCTTTTTTTTTTTGTGTTTCTTTTTTCTTTCTCTGTTTTCTTACATGGTT
CTGGTGGACTCACATTTGCTGATGCTGGTGCTGTTTTTCGTGTGATCTTCAACGTTTTTG
GGTGACCATTGACCCTGTGACCTCAAAATGGTGTCCAACTAACCAATTACAATTAACATC
TTTTTTTTATTAACGAATTTATGGTATTATCTTTTTTTTTTTTTTTTTTTTTTTTTTTGT
CTTGGTGGGGAACGGGGTTGGGGTTGTTTTCTCTATTCTAGAATATCCAGTCAAGAAGAT
GAAAACTACGGAGAAGGGATTTGGGTTGGTGGCTTATGCTGCAGATTCATCTGATGAAGA
GGAGGAACACGGGGGTCATAAAAATGCAAGTAGCTTTCCACAGGGCTGGAGTTTGGGCTA
TCAGTACCCTTCGTCACAACCACGAGCTAAACAGCAGATGCCATTCTGGATGGCCCCGTA
GGAAACAGCGGAGCAGAGCTTTGACCCTCGGTGACTCTCTTTAGCAATAATGCATGCGTT
TGATTTAATAAGACTCTGGGGCCTGTACCGGAAACCATCTTGGACCTTTGCAGAAGTTAG
AGATGCAGCGTCTCCTTTCTCAAAGTGTCTCGTTCTTTTTACAACATCCCTGTTTCTGCA
GTGGCATAGCATCTGTTAACATTTACTTAGAATCACAAGTTTGTCTCAGAAGCTTTTTAA
CAGTTGGTGAAATGTGCTTGTTCAACAGAGCATCCCAACAGGGTCATTCCCATATACATT
TGACCTGGTCCAGCCTTTTCCACATGAATGGCCCCTATTGTGACGAAGAGAAGGTTTTAT
TTGTATTTTACTACTGTTTGGTCAATTTTGATAACAACTGGTTACAAACGACGCCTTACT
ATTTATTAGTGGGGAAATGATCTTAAGACCATCCTTTCCTTTCAGCACCTTTAAATCTAA
GGACAATGCATCCCTGTTTCATTTTTGCATTCTTTTCTGTTTTTGGAAACTTCAGTTTTA
CCAATTTAAAACTGTTGGATATAGCTGGATCCTGAGTAGGAAGATTAAAGTTTTTTGTTT
TTTTCTTCTTCCCTGTGTCTTTTTACTGGGATGAGCCAAAGCTGGCACCTTCGGGCACTC
TTGTCTCAGAAAGCCATTGCTGTTTTTATTGCCCTTCTAAGCTCCATGTCGTCAGCTGGG
TCAGAGAAAACTGCTTGATCAAAGCTGGTCAGAACTCCTCACAGAAATGAAACACAGTGG
TCTGCCTCTCAGAACTGGTTGCAGCTCAAATAGAGAGATTTGACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1541..1757, 4667..4795, 5145..5224, 6330..6382, 6654..6817, 7760..7971, 8520..8580, 10080..10137, 10365..10618, 12727..12906, 13793..13905, 14544..14635, 15641..15840
1001..1038, 1541..1757, 4667..4795, 5145..5224, 6330..6382, 6654..6817, 7760..7971, 8520..8580, 10080..10137, 10365..10618, 12727..12906, 13793..13905, 14544..14635, 15641..15837
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved