Felis_catus Locus C1orf79
snOPY snoRNA Orthological Gene Database
Felis_catus C1orf79
Felis_catus
C1orf79
GeneScaffold_1538
SNORA44, SNORA61
1055..1185, 1416..1547
3435
TCGGCCCATTACAGCTACTTATTGGGCGACCTTGGGGAAGTGACTTTACCTGTTATCTG
GCTGCAGGACATGTTAAGGAATTCATGCAGGTGGATAAAAAGGGATTTTTGGAGTTCGAG
TCCTTAGAACCTATTTTAAATTCCAGTTGTGTGGCTTTTCTACACTGATTGGCGACTTTC
AGTAAATAGCTTAATTTAAACCTGTCCGTAAAACGGATGATAAAATGGTCCTGTAAAGAT
TAAATGAGACAAAACACTGGTACATAACAAAAATGAAGAGGAAGTTGGGACCTGGTAGTA
GGATATCTGTTCTCTTATTTGGTCTCCAGCATGTCTCAGTAGGTGAATTTCAGTTATGCA
ATAGTGCACAGGATTTAGGGGAGTCTGAGGGTTGGACAGCATTTGTGGCGGTCCTGAGAC
CTAAATTGCCCTGTGGCCCTTATCGAAGCTGCAGCTGCTTCCACATAGCTGCTGTGGTCA
AAAAGGAGCCCAGAGTGACAGTTTTCCTTGACGGTCGCCGTTCTGTTTGCTGTAACTGAT
CTGCAACATATCAGGAAAAGACAATTCCCATTGTACCTGCCATTTCTCCGGTATAGGCGG
AATCCTTTATTACAATAGACAGGTTTCCAGAGGCCAACAGAAATGCTCTGTTGATGGGTC
TTGCATAGAGTTGCTAGAATAAAACTTCTGAGAAGTAGATTGCTGAGATGAAGAACAAGT
ATGGAGGGGCAGGCAGTGGGAATGGGTTGGACATGTGTGCTGGGAAAATCCAGTGGCAAG
TGGCACAGATCTTAACAGTGCTTTGGGTCACTGCCCTGGAAAGCTTAAGGCATAAGTACC
AGGGTCAAAAGCCAGTCAAACATTTTGATTCTCAAGACCAGAAGGGAACAATGTCATTCA
GGACAACTGTGTTCTCGTCTTAGTTGTGCCAGATGAAGATTCCAGGAGGACTCTGAGGTT
GAGCTTTCTGGTGAGGATTCTGTGGTCATGACTGTGATGGAACACCACCATCTCAGGACC
CGGTAGGTTTCTGGGAACTGCCTGGCGGGTCAGTACAGCATGTTTCCAAGGGCTGTGGCC
GGTTGTGGCCATGGGATCTCCAACTGCATGCGAGAGCAACCTGGAGAGACTTTGACAGCA
CAGGTCAACATAATACCTGCAGCTGCCACTCGCCTTTCCTATAAACGGCTTGGGACCTGG
GCTGGAAGCCTTCTCAGTGAGTCCGGGTGTTTTCCATAAACTACCACGTAGATGGTAGGT
GGGTGTTTCGATCAACTTTTTCGTTTAGAGCTTTCACCCTTTTTTCTGCAGGTTGCCCCC
CAAGTGTCCTGGCAGTATCTGCTACTGAAGAATCTGAAGTTACCAGGTTGTTGCTGTGCT
TTAGATAAGGTAAAGTTAGATGTTGAAGACATCCTGACCCTCCGGTTCCCTTTCCCATCG
GATCTGAACACTGGTCTTGGTGGTCGTAAAAGGAGGAAAAAGAACACTGAACTAGCCTCC
CAGTGCTTATCGTCTGGTATATAGCTTGGAGGCTAGTTTCAAACAAGATTTGAATTCTCT
TTGATCTCCTCCCCTGTAAAATGGGATAATCTTAGGCTTAAAGGGAGGATGTAGGTGAAG
GTCTGGGCAGTTGTAGTGATGGCTGACTTAATACTTCTGAATTTGATCAACATGAATGTC
CTTCTTGCCTCTTGGTTGAGAGTGTCCTGTTTTTTGTTTTTTAAAGATCTCTTACCAGTA
AAGCTGTCCTTATCTGTGATTATGGATCTATAGTTGGGTAAGTTGGCTACCTAAACTTCA
CTGTAGCTTCCTTGCAGCGCCAAGCAGTGGAGTGTTGTAAACCCTAAGTAGTGTAGTGAA
TCATGAGGCAGCCTAGGCCTATATGAAAGAAAGTCTTAGCTTTTTAATACTACATCACTT
ACACCTATTAGCTGTTCATGGCCAGAAGAGAAAAATGTTTGGTGTGATTTGGTCTGTTAG
ATTTGCCTATCCTGTTGGAAGGCCAGGAAGAGCACAACATGCTGTGAGTAGAAAGTACCA
GATGCCAAAGCCCTGCACCTTTAGCAGCAAAGGCTGATTCCTTTGAATGTGCAGTCGTGG
TTTGAGCTCCTGCTCTGTCTGAGGTTTGGGGAAACCTCAAACCGTGGGATCGTACTGGCC
CCTTTCCTGGAAGTGTGGGAGATGGGTTGGGCAGAAACAAGTAGTTCATCTAGTTCAGGG
TATGTTTTGTTAGGCTGACTGGTCCAGGATGAAACCTAATCTGAGTGGACATCTATGGAT
GATAAATGCGGATATGGGACTGAGACCAGTTTGGGGAAAATGTCTGGGTGGCATTAATTA
ATGGGGGAATATTAACACACTGGCATACACTTCCTTTTCAGGAGACAGACCTTATGGGAA
GAGGCAAGCTAAAAGACAACAGGTTATTTTCAGCGGAAAACCATGACCTCTGTATTTCTG
CTTATGCTGGCATGTGGTATGTAAGTGACCAATAAAAGACTTAAAGTATGCTTGTGTCCA
TATTCTTGATGTCCCTCAAGCTGCTGGTTATTCCCCATTAAGCGTTAAACTCTCTATTTT
TATTTTGTATCCTTTTTTTAATTAAAGGATAATATGATGAGTTCTGTAACTTCCCATTTA
TATAAATGTCTCCTTCAGTAAGCCTGAAAATTCAGGCTGAGCCTAAGACTGGTGTTCCTT
AAAAAAATGTTTATTAGAGGGAGAGAATCTTAGGCTCCACGGAGCCCAGTGCAGGGCTCA
GGGCTCGATCCCGTGACTCAAAACCAAGAGTTAGACTTTCAAACCAAAACCAACTGAGCC
ACTAACAGAAAAGTAGGAATAAAATGGGAGATTTTTAGTATAAAACCAGACTTCCACATG
GGTGCTGGAGATCTGTGTAAGAGGACTCACATCTATTAAATGAAATTAAGGTCAAGAAAC
GGGCCAGGTGGATGTAAATTCTTAAAAATATATAGAAAGTTAAAAAAAAGAAACCGGCTA
GGCACACAGATGTCAGTAATTTCAACCATGGCTTACCTCAAAGTCAGACCTGCCCTTGGA
GCATGCCCTAACTCGTGAGCCTTTTGGTCTAGATGTAGCTGGCTCCATGACTTCCTACCA
CATAGCCACACAGCTTCTTTCCCAGGTGGAATGTCTCAGAACTTCAATCTGCCCTAGCCA
CGAAACTTAAGCGTGGAGGATGGGGACAAAGGGTACTTGAAATGGAAGATCAACGTTGCC
CATCATTTGGCATAACAGCAGGTAATTCATGCATTCTGACTTCACAGGGGGTAAGGATAT
AGTGTCACCGGAAAAAGGCTCCTGGGTTGAATAAATCATACGCTCCACTTCATTAATGAC
TCCAAATTCTTCCCTCCAAGAGTGTACATAACCCTACCTGGAACAATTGTTCAAAGACAA
ATTGGAAAACCTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1014..1021, 1311..1319, 1321..1382, 1387..1388, 1724..1768, 1773..1776, 2381..2382, 2385..2408, 2411..2419, 2421..2435
1001..1006, 1014..1021, 1311..1319, 1321..1382, 1387..1388, 1724..1768, 1773..1776, 2381..2382, 2385..2408, 2411..2419, 2421..2435
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved