Felis_catus Locus RPS8
snOPY snoRNA Orthological Gene Database
Felis_catus RPS8
Felis_catus
RPS8
GeneScaffold_2167
SNORD39, SNORD38
1236..1315, 3063..3135
5685
GATTGACCGGTAAAACTCTGTAGACCCACTCAGAATCTGAGATCCATCTCTTCTGGCCA
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTAAAGTATTTATTTAGTACATTTTACAAGAGAAGTGT
GCTTTATGCTCTCTCCCTAGATGCCATTCATTCTGGAAACTTTAATTACATTTGCATAGT
AATGATTCCCAAAGTAACATCTTCTGTCCAAATTTCTTCCATAAGGATGACCAAGACATG
AACATCCAGCTGCCGTCATTCCCCCTTAGAGGTCACCAAGATCTCAAAATGAACATGACC
AGAACCGCTCCCTTAGTTTACCCCATCTCAGTAAAAGGCACCGATTTTCATCCAACTCAT
CAAGTGAGGAATTAGTAATCCTCGACACACACCCCTTTCCCTAACCCCCTCCCCCCAAGT
CCAATGTATCACCAAACCCTTCAGAATCAAACCTAAGTCCACCACTCGTTTCCCTCCCTG
CTGCCTTCCACCTTTTCCCATCGCAGCTACGCCCAGCTTCTAAAACGAGTCTTTTCAAAG
CGTAAAGCCAGGTGACTCCACCTCGGATGTACCCTAAAGTCCTCAACCTCTAGCGAGCGG
CAGCAAACGCGGGTCCAGCGCTGTCCACGAGTTAGGAGCGCAGAGGCCCCTCTCGCAGCA
GGAGGTCCGCGGTACTGTCGCAGAAACGTCAGTGACGTCGCACTCAGACTCCGGGATCCT
CACAGCGGCGCGCAGAAATCACGTTAAAGGGGCGGGACTGCGTTTTACAAACCGGACCGT
GAGGCTTTGCGTTTTCCCTTTCTCAGCCAGCGCCGAGAGTGATGGGTGAGTGTCGCTCTG
CTTCGGGGCCCGGGAAGGGGGACGAGCTCGATCCGGCGCCATCCTGCCTCGCGGTCAAGT
CAGGAGTGCGGGCGCCCCGACCCCTAGCACGGAGCAGCCACGAGGAGGGTGGTGCTCGGG
TTCTGGCCGCCGAGGCCCCCTCCAGGGGCTGTAGGAGCTTGGGGTTGCAGGCATACCAAC
ATGGCTGCCATGGGACGGAGCCCGGGCTGGGCCGCATGTGGATGATGACACCTTGATAAT
GCTGTAAACTCCCGAGTGCGCAGTGGGGGAACCAACCTTGGAGAGCTGAGCGTGCGGCCC
GTCCGGCGCGGGGGTTTGGGGCTTGCGAGGTGCCGGCCCGAGGCCCAATGGCTAACGCTT
CCGTCCCCGCTCCGGCATGTAGGCATCTCTCGGGACAACTGGCACAAGCGCCGCAAGACC
GGGGGCAAGAGAAAGCCCTACCACAAGAAGCGGAAGTATGAGCTGGGACGCCCCGCTGCC
AACACTAAAGTGCGTGGCGGGGCGTTCGCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCATCTCTGGAAAGGTGGCTTTGTGGAAGAT
GAGCTGACACCCTGTGGCTGGGTAGCGGCTTAGAGTTCCCTTTTCCTTAGGCACTATGGG
GTAGGATGTGCAGGGAACAACAAAGCCAGTTGTTTACAGGACTTGATTCTGAATTTCTCC
TGTGAGCAGGTTGTACGCGCAAAACAAGGATTATTGATGTTGTCTACAATGCATCCAACA
ACGAACTGGTCCGCACCAAGACCTTGGTGAAGAACTGTATCGTGCTCATTGACAGCACAC
CGTACCGGCAGTGGTACGAGTCCCACTATGCACTGCCCCTGGGCCGCAAGAAGGGGGCCA
AGCTGGTGCGTTTTTGGGGTGCCAACTTCCCTGTTGGGCGGGGGAGGCCAGCCTCATTGC
AGCCTTCTTATGATGAAAACTGCGTCCAGTTCTGCTGCTGAAGGGAAAGAGATGAAAGCT
TTTAGTGCTGAGGAAGGCAGCAGGGATTGGGATGTACTGGGCCCAAAGCTGTGAGGACAT
TCCTTCCCTGAGCCAGTGCTTGGGGAGCTCCAGCTAAGTCATCTGTCTCCTTTATTTAGA
CTCCCGAGGAGGAAGAGATTTTAAACAAAAAACGATCAAAGAAAATTCAGAAGAAATATG
ATGAGAGGAAAAAGAATGCCAAAATAAGCAGTCTTCTGGAGGAGCAGTTCCAGCAGGGCA
AACTTCTTGGTGAGATGGCTGTTGCCTCGGGGGAGGGGGTGTCCGGATAACTGTATATCC
TCTGTATTTTATTCTTGCCTCTTTTGTTCTTTTTACTGGCCAGCCTTGTGGTAGAGGCTT
CACCAGGAGAGTTAAATGATAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTTACCTACTTCTTCCCTATTTCTA
GATCACACTGCCCAGTTCCCATACACAAACCTTCACTAACCTTCTTCCCAGTCCGGTCCT
GTCGTCGTGCGCCCTTCACCACCACCACCACCACCACCCCCCCAGGATACCTAAACCAAC
ATGGACTTCTAAGGCATACCTAGGTTTGGATAGGGCCACATTGTCATTTTGCTAATGAAT
GCATACTCTCTTGCAGCATGCATCGCTTCAAGACCAGGCCAGTGTGGCCGAGCAGATGGC
TATGTACTGGAGGGCAAGGAGCTAGAGTTCTATCTGAGGAAAATCAAAGCCCGGAAAGGC
AAATAAATCTTCCTCCTTCCTATCTTCGGTCATGTAATAAAAGGTGTTTATTCTGCCCTG
TATTCGTGTGTCAATATCTGATTGCTTGGGAAACCGTAGAGTGCCCCAGCTCACTCTGCC
TGAAGGCCAACCTTAGGTGTGGGCTATGTCGGTAACGGGGAGCATTTCTCACCCCCCAAA
GGCTAGCGTTTAGTGGGAACAGGGATGTGGCATGCAGGCCAAGCAGAAACAGTATAAGGG
AGGTATCTCAGCACTGGGCCCCCAATATTACTGTGTTGACCATGACTGGTACCTGAAACC
ATGCTGCCTCTGTAAATTTGGCTCTTTTAGAGGTCCTGTACCCTTTCCCTATGTGCACCT
TGGTCTTAAGGTTTTAGCTTGGAAGTTTTCAGCCTGGGTTTGTGAATAGCCTATAAACCT
GGAAATTGTATTCCAAATTTCTTTTGTACATTGTTGAGGAAGTTGAGCACACTTATGTAT
CCGTATCTTTCAGTTTTTTAATGTCTTTCTGAAGTTAATTTTCTTTTGAAACCTAATCCC
CCTTCCCCTTACTAAAGTGTGCAAGATAACCAGTGGTTTCTGCATTGCTAAATCTGCAAA
GTTCAGTTCTTTGTCTCCAGCTTGGCTGTACATTGTCTGTTGTAGGTATTGAATGTGGTT
TATGATGCATTTTTTTTTTTAATGTTTATTTTGAGAGCAGAGGAGGGGCAGAGAGAATCC
CAGGCAGGCTCCATGCTCAGTGCGGACCTGACTCAGGGCTCCATCTCATGACCACCAAGA
TCACCTGAGCCTATATCAAGAGTTGGGCACTCAACTGGCTCAAGCCACCCAGGTGCCCCA
TATGATGCATTTTTCTAACTTTAACCCAAACCTACTTAACACCTGCATTTGTATATCATA
ATTGGACTCTCAAAGGTGAACATGTTAAAAATGGATAACATTCTTCAGCTTTTCCTTTTC
AAATAGTTTCTCAGCTATTTGATTATAGCAAACAGTTGTCTTTATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1004, 1402..1508, 2831..3004, 3239..3368, 4576..4685
1001..1004, 1402..1508, 2831..3004, 3239..3368, 4576..4682
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved