Felis_catus Locus CPSF4
snOPY snoRNA Orthological Gene Database
Felis_catus CPSF4
Felis_catus
CPSF4
GeneScaffold_1605
SNORA70
2329..2461
10163
AGCTCCATTCTTCTGAGACTTGCCCCCCTGGGAGCCTATCCCTCACTTTTTCTCTGGAC
CCCAACTCTGTGTCATTCATCACAGCTGGGCAGCTGCCTGAGCTCCCTTCCTTCTCCACC
TTCAGATGGTAGCTCCTGGCTCCCCCACCCCACAACTTAGGTGGATGTCTCGCACTTTAT
TTTTATTTATTTATTTATTTTCTAAAGTAGGCTCCACGCCCAGCACGGAGCCTGATGCCG
GGCTTGAACTCACAATCTTGAGATCAAGACCTGAGCTGAGATCAAGACTTGGACACTTAA
CTGACCGAGCCACCCAAGTGGTGCTCCCATGTCTAGCACTTTTTTAAAAAAAACCAACAG
TTTTCTTGTTTCCTTTCTGGACACACTTGGAATCTGATGTTGTAACATTAAAGCCTAGAG
GTCATTACGTTCAATCCACAGATGGGGCAACTGAGGGCTGGGAGGGGGAAGGGACTTGTG
GAAGACCACTTGGTCTATGGCCATTCAGTACCTAGTAAAACCAGGTGAGCTCTCCAGTGT
TCTTGACTGGTTCGGTCTGCGGTTCCCTATGTTGTGTTTTATGACTGCCAGAGATCCATG
TTCTCCTACCAGTCCGTGGCCTGGAAGAGCCCCCTGTAGCCTCGTTCCCCTCAAGTGGCC
ACACTTCTCATGCACAGTCTTAGCCCTCTGGACCATCCCATGTCCGAACTGGGGGTAATT
AACTTCTGTGATCTTATGCCCTAACCTTTCCACAGCCACTTGAGAGCATCTTGCTTATAG
GAGGTTCTCAGAATAACTGGTCCCAGCATATGTGTCTCATGTTGCAGGGAATGGCTAAAG
TGAGAAGCTTTTTTCTGGCTTGGTCTGGCTTTGCATTTTTTTGCCAGAACGTTTCCTGTA
CCCTTTGTGGTTAAAGGCAAGAAGGGTCCCCTCCCTGTGTTTTCAGCTGTCCCTAGTCAC
ACCTCACTTTGTTTGATGTCTCTGTTTTCCTTTCCGCAGAGTCAGGGGCTGCTGTCTGCG
AATTCTTTTTGAAAGCTGCCTGTGGCAAAGGTAAGAAATCACTGGCTCCCCGACATTCCT
CCTGAGGTGCTTTCCACCACCCAGCCTTCAAGCAGACTTATAGGCTGTCAGGTCTGGTTT
GCTGCAGACTAACAGTGTCCCTGGAGGAAATCACTGTGCTTTGGATAGGCTAGGAACACT
ATGGGGTATTTTGCCTGAAATTTAAAACACAGGATGGACCCTCACTCTGAGTCTGCCTTC
TCACCTCACTTTCGCTGTGGCCACGAGCTGACCTGTGACATGGGCAGAAGGTGTGAGTAT
CGAGGTGTTCAGGCACTTTTTCAAGATTACAGAGTTAGTGAGTGGCTGAGCCAGTGTCTG
AACCCAAGCCTTTCTGATTCTACAGTCTGCACAAGCTCACTGTCCTCTGTATCCTCTCAT
GAAAAACCCCTACAATAGTCTGTCCTGTGGAGCTTTGTTCATACTAACCGGGCTCCAACA
GAGGCTGCTGGAACCAGACCATCCATTGATTCATAAGGAGACAGATTGCAGGTGAGACCT
TACATGCCATGTATAGGTCTGGGCATTTTTCTTCCTGTAGGCAAATTTATTTGGAAACTA
AATTTTTTTTTTTTTTTAACGTTTATTTATTTTTGAGACAGAGAGAGATAGAGCGTCCAA
CTTTGGCTCAGGGCGTGATCTCGCAGTCCATGGGTTCAAGCCCCACGTTGGGCTCTGTGC
TGACAGCTCAGAGCCTGGAGCCTGCTTCGGATTCTGTGTCTCCCTCTCTCTCTGATCCTC
CCCCATTCATGCTCTGTCTCTGTCTGTCTCAAAAGTAAATAAACATTAAAAAAAATTTTT
TTAAAGAAAAAAAAAGAAGAGTTTCCAAAAAATAATAGTAATAAAAGTAAATGAAATTAT
ATGAGTTTCCAAAAATAATAATAATAATAAAATGAAATGAAATAAAAATAAATACGAGTT
TCCAAGGGTGCAGCTCTGTCCCATCTGGGTGGCTGGTCGCTCAGTTCCTGCCACAGAAGG
CCAGTTTGTATACAGAGCATTTCTTCAATTCTGAAGTTGATTTTCTTTCCTAATTCTTGG
AGGCTAAGTGGGCTTTTATAACTAGAGGTGGAGCCCACTTGGGGTCCAGGCTTCTGCTGG
CATCCTCTTTACCTTCTGTTTCTTAGAGCCGTGTTTCCCAAACCCCAATCTTTTTTTTTT
TAACTACCCCTACAATTTTTGCTATGTCTGTGTATCACTAAAGCTATTCTTTAATTAACA
AATAAGCTTATTTCCCCACCACCCTAAGGCTTATTAAGTTTCCATCTTACTGCAGCCAAT
TAAGCCGACTGTGCTCTTTTCCCATGGGGCCCGGTGTGGTGTGCCTGCAAACAGCAGCCT
CCTTGGTGGTCTATACAGCCTGTTGATTGTATGGGTTGCCCTAAGGGACCTCGGAGACAG
CTTTTTCTGGTGGACATTGAAGTTTGGCCTCACGCTTTCTGCAGTCTAGGCTCCAGACAG
GCATGCGGGGTGCCTTTGGAAAGCCCCAGGGCACAGTGGCCAGGGTCCACATTGGCCAAG
TCATCATGTCCATCCGTACCAAGTTGCAGAACAAAGAGCATGCGATTGAGGCCCTTAGGA
AAGCCACGTTTCAAGTTCCGCGGCCCACCAGATGATACACATTTCCAAGAAGTGGGGCTA
TAATAAGTTTAATACCGACGACATTCAAAGACATGGTGGCAGAAAAGCAGCTCATCCCAG
ATGGATATGGGGTCAAATACATCCCTAATCGTGGCCCCTTGGACAAATGGTGGGCTCTGC
ACTCATGAGAATCTCAGCACTACCCCTCCTTATTTATGCCCACCAATAAATCCTGCTTCC
TATCTTAAAAAAAAAAAAAAGTTTCCATCTTACAGTAATATCTGTGAAAGCATGCTTTGA
TGTTTTAGTTAGGTTTTTCCAAAACACATAGAAAATATAGAAGTACTAAAACTTAACGTA
TGCCCATGTACTGCCTTCTGCCAGGGGCAACCACCACCGTCCAGGACATGTTGCTCCCAG
ATACTGCAGGGAAATGTGGGGTGAAGGCGCCGCCCTCCTCACAGTGCGCTCTTTCTTGGC
AGGAGGCATGTGCCCATTCCGCCATATCAGTGGCGAGAAGACGGTTGTGTGTAAACACTG
GCTGCGGGGGCTGTGCAAGAAGGGGGACCAGTGCGAGTTCCTGCACGAGTACGACATGAC
CAAGATGCCTGAGTGCTACTTCTACTCCAAGTTCGGTAAGCAGATGGCCCGGCCCCTCTC
TGTACTCGGACATCCAGGCTCAGGAGCTCTGGAGAGGCACCCAGAACGGAGACCCAGAGG
GGATAAACAGCTGCTCAGGTGCCCATGGTGTCTGCTAACTCCCATCTTTACAGCTTCACA
TGAGAACCTCATGCAGTGCCTGCCAACCTCAGCTGGCCCTCCAGTTTCAAGTTCTTTGGA
AGCTGAGGCAACTGAGGGTCCCATGGTGGGTGCAGCTGGCGGGAGGCCTTGTTTCTGCTC
ATGTTGACCTTTTCCCTCATATCGGCTGTTGCTTCCAGACTGGCGACTCCTTGCCCCCCA
GGTCTGAGCTGGTTCCTTCTGTCTGGGAGTGCGATCCCAGGTATTACTTTGACTGTCCTA
AACGGGGCTGTCTTGTGGTGGCCAAGACCTCCACTCCTCACCTTGAGGTTGCCTTGCTTG
CTGTGTAGAGAACATGTGCCCTTGGCTGTCCTGAGGACTGCATGGAGAAGTGGGGGCAGA
GGGGGCTGCTCAGCAGAGCTCTTATGCTCCCTGATGGAACTAGAATCCACCGCTCTCTGC
TGTGGGCAGAGGTTGCCCAGGAAGGAGCCCTGTTGGTCAGGATGAGGATGGGCTCTGGTC
CTGGGACCGTTGGCCTTGTGCAGGGGCTCAGCGGGGGGCTAGAAGCCTGCTATACTTTGC
GGTGGGCTGGGGGTGCTGGGGAGCACTGGACATGGAGCACGCTTTCAAAGCACTGTCATT
TAGGAGACATTAATTATTCCAGCAGCTCGACAGGCATGCCCTGCTGGTTTATTACGATAG
TTGTGGCTTTTTTGTAGAGGTAGCATAAGCTGTGAAGTCAGTGCACAGATAGTCAGAAGT
AGGACCCAGGCTTCCCAGCCGCACCCCTCCCCCCCCCCACCCCCCCACTGCCACCACCAA
ACCAGCACTGGAACCAGCACTGGAAGGGGGGTGTCCCCTTTTCATGGAAGCCATCTCCCA
TCTGGACCCAAAGGCAGGAGACAGCTCTCCTGGAAGACTCTTAAGAGCACCCCTGAAGGC
TGGCCTGGGTTCCTTCATTCCTGCCGGGCCTGGCAACCTCCCCACTGCCTCTGATGCTTC
CCTGCCTGCCCTTTCCCCAAAAAACTCGCCCCGGTGCACATGTACCATGCACCTTCTGTT
AACCTGTGACACAAATGAGGGTCCTCTTTCAGCACTGGAGTGTCGGTAGTAAACAGGAAA
AACCCACTTCTCGTCCCGCGTTGCTTTTGTTCTGGTGGCCCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCT
CAGGTCGTGATCTCACGGTCCATGAGTTCAAGCCCTGCGTCAGGCTGTGTGTTGATAGCT
CTGAGCCTGGAGCCTACTTCTGACTCTGTGTCTCCCTCTCTGCCCCTCCCCCACTCACAC
TCTGTCTCTCTCACTCTTAAGAATGAATAAACGTTAAAAAAAAAAAAAAAAGAAAGAAAA
TGACATGCAATAAGCACTCTGAAGGAAATAAACAGCAATGGGACCACATGAGGACCATAT
TTTCCTTTAGCTAAGTGGTCAAGGAAGGTCTTTCTCAGGAGGGGAGACCTGAGCTGGGAT
CTGAAGGCTAAGAAGGGGCCGGTCACGTGGGGCGGGGGGCAATGTGGCTGGGGGTGGAGG
AGCCTGGGGAGGAGTGGGCTAGACCACATAGAGGCTTGCGGGTCTGGAAAGGGATTTGCG
TGTTCTCTGGCCACCAGTGATCAGATTGTCCTTCCGTGTGTCACATGGATCGGGGAGGGC
AAGCGCGGAGGGGGTGGATCCCGTAGTTGGGTGAACGATGCCACTGGCCAGCTGGTCCAG
TTGCTCCTAAGAGGAGCTGTCATCATAAAGGCTTTATCACATTCTGCCACAGGACTTCAG
CCTTGAGTTCCCAAATCTTCCCTGTTTGTTCTGAAAGGTGGAATCCTCAGACCTTTTGCC
TGTCCCGGCTAGTAGATGTGAAGGGCTCATCAGGGTAGGCCAATTATTTCCTGCTCTCAG
TTGGTGCCTTTGCATACTTGGGCCCCTGCCCAGTGTCCAGGATACCCCCTTTGGGTAAGA
GAGCCATGAGGTGGGTCTGGGTCTGGCTCTCCCGGAGCTGCCCCAGGTGGACGCACGTCT
GGCTTTCCCTGCAGGGGAGTGCAGCAACAAGGAGTGCCCCTTCCTGCACATCGACCCTGA
GTCCAAGATCAAGGACTGCCCTTGGTACGACCGTGGCTTCTGCAAGCATGGTAGGTGTCA
GGGTGGCTGGGCCCCCAGCAAGACGCTGGTCCTCGCTTCCTGTCCCCACATGACCCTCTA
CCTGTCCCAGCAAAATCTGGTGTTAGGCATCTGGGGCTAGTGAGGCTTTTTTACACCCTC
AGCTCGCCCGAGCCTCCCAAAGCTCCTGTGTGGACTGCACTCTCACCTAGATTTTCGGTA
AGGAAACTATCGGTTTAGAGGTTGTGTGCCCTGCCTGCTGTCCCTTGTGAATGGATATGA
GACAGAGCCAGCATCTAAAGCCCTGCTCTTGCTCTCTACACCCCAGGCAGTGGTGTAGGC
AGGGTTCTGACTGGCACAGGGGCACGAGGCCATCCCCCGAAGAGGGGAGTCTGAGTGACC
CAGACGCTTGGCTCCACAGGTCCCCTGTGCAGGCACCGGCACACACGGAGAGTCATCTGT
GTGAATTACCTCGTGGGATTCTGCCCAGAGGGGCCCTCGTGTAAATTCATGCAGTGAGTA
GCCAGACCCTGTTCCCCTACTCCACTCCTGCCCCAGGCCCTGCTGCCCTCTAGATCTTTT
CTGGGTCCAGCTGGGCTTTGATCATTAGGTGGTGTCCCCACAGGACCTGCGGCAGGGGTC
ACTGCTGCTCCCTGAGCTCAGAGGTGGCTCTGCCTAGCCCAACACTTAACCTTTACTGGG
TCATAGATCTGATGAAAGCTGGGCTGCGTGCATGAGAAAAGTTCATGCCTTGTAAGGGAC
CTCTGGTTAAGAACCTGAGCCCTAAAGGAAGGAGACTGCAGTTTGGGGGCCTCTGTGGAG
TCAGAGCTTGGGATTCCACATATACTAGTTTGTATAACTAACTCTCAAGTGTGTGTGAGA
GAGGATGACCCCATTTCGCGCGTGGGAACACTGAGGCTCAGAGCTTAGTCACTGGCCTCG
GTCACATGGTGGTAGGGTTGGCACCTGGTCTGAGGCAGGTCCGTAGCCTCTAAAGCGGGG
TTCACCTTGCCCAGCAGGGCTCAGAGCTCCTCTCCTGGGCCTTAGTGCACATCTGTCACT
TTGGGTGGTTGTGGAGTCGGACTTCTCCCTGGGGTGGCGCTGGGACCTCAGAGTAGTGTC
GTTCCCCTCCACCCCCCACCCTGGGCTGCTTCTGTCCACACCATGGACACCTGCACAGAA
GCATGGTATCCTGGTCACTGCCACCCAGTGGGCAGGTGGCAGGTGCTGCAGACTTGGCGC
CGCTTTCTGGATGAGAGCCAGGAGCCTGCAGGGGGCCCAGGGATTCCTGCTTGCGGGGCG
GCCGGGGTGTCCCTCGGGATTGTGTCTTGTCGGAGGTGGTCTGGCACCTGAGTTAGAAGT
GGATGTGGGGGGCGGGGGGAGGTCCCATGAACAAAAAGCCCTCCAGAGGCAGCACTTTGT
GAAGGTCCTGAAGCTAGATGTGGGCAGAGCTGCCCAGGCAAGTCAGTTCTTTTCACCCCT
GTCCCCCGGAGGCTTCAGGGGCGGAGCTCAGAGCCGGCACCCTCCCCACGTCTGGGTGAG
TTACTCTGTGCTTGGGCAGAGGCTGCCTGTGATCTCCCGGGAATACCTCCTGGCATGGCC
CCTCTCTCATCCCCTCTTCTCCTCTTCTCCTTCTCATCCCCTCTGGCTGCGGGGTGACCA
GCCCTCGATTTGAACTGCCGATGGGAACCACCGAGCAGCCCCCACTGCCACAGCAGACGC
AGCCTCCGACAAAGGTACTGTGCCCCTGCCCCTCCCTGGCCCCGTAGTGCTGCCGGCCCC
CGCACTGCCTGCCCTGGTGCACGGTCCGCCACAGCCCCGGCTGGTGATGTGTGAGAAGGC
AGTGAGGAGGTGGGACAGGAGGGGAGTCACCCTGAGTTCCAGCAGGAAATTCAGGGAGCA
GAATGGTTTGCATCTCCCTGTAGAGGTGGAGGGCTCTCTGCTATGTCTGCCAGAGCCGAA
TGCCCACTTGGCTTCTCGCCCCTTCTTGCCTGGCGAGTGCCTCGGTGGCGCCTCACCCCC
CACCCCCACTCCCAGGGGCCAGAGCGGAGGGCAGCGCGAGCGCCGTGGGTCTGCTGCTCT
TGCTTCTGGTTCCAGCCCTTCCTGTTTCAAACAGGGAAACAAACTAGAGGGAGGGCCTCG
TCTGAGGTCCCGCAGCTGGGCAGGAGCAGCTGGGGAGCAGAACTGAGGCTGACTGGTTCT
CCTGCCAGTACCCTTAGCGCTCTGAGTGGAGGTTCCTAGCAGGACAGGCTGGGAACAGAG
CTGAAGGACCAGCTGGCTTCACTTTTCTAGACAAGGGGGTCCCACAACCCAGCAATGGGC
TGATCCCCTCAAGCATGAGGAGAGGGAGAGATGCCATAGACAAGTGGGAATCTGCAGCAG
CAACCCCCGAAACCAAGGGCACCCGGGAGTCAAGGGTTGGGGGCCCAGAAGAAGGGCTGG
CCAGGTGCACTAAGCAGGGTCTCCACAGGCTGAGTAAACCCGCCTACTGATCTTGAATCC
TTACCTGTTACCTGGCTGGACTCTGACCCCATTGCCAAAGCCCTGCTCATCCTTCATTGC
AACAGGCTGAGCAGGTGGTAGGGGGCATGCCCCCCCGCCCCTGGCCCCACTGCACTGACC
CCCACCCTCAGGAGGCTGTGGGACAACTCAGAATTCCTCTCAAAGCCAGAAACTGGGTGT
GGGTACAGCCATGACAACCTGGGGCTTTCTAGCTCAGTGCTCCTATATTTGCGGAGGCCG
GGCCGGGACCCCTCTTGGTTAGGAGGTGGCCTAGCTATCCGGCCCGAGCCCTGAGCCCCC
CGTCCCCCTTGCTCACATGACTCCCTAGTGGAGGGCCCTCTCAGCCCCTAGACCGCAGGT
CAGCACGTCAGCCTCCAACTGTTTTTCTGTGACTGTTGCTCGCCGTGTAGGCTGCTAAAC
ATCTGGCTGAACCAAGCGTTCATCCTGACCTGAAGCTAGAACCTCAGAAACAAAAGTAAG
GCCTGCTCATGCCCTCGCCCTGCTGCCCCAGAGACCTCCTCGTCTCTTTGGTGTTTTGTT
TTCTACTTTTATTTTTCGTTTTTGTGTGTCTGCATGGTGTTTTTCGGGCAGCGGCTCCTG
CCATCATCACCAGATGTTTCTTTTCTGGCTGCTCTCCTGAGCAGGGCCACCGCGGAAGCC
CTTCTTCCTGCTGGTCATGCGGGAGCAGTCCCGCCCTCTTTTTTCCTGTCCCCATTGGTA
GTCTGCGTGCACGTGTTTTCCGCAGTAAAACCGTGTTGTGTAACTCTTTCCAGCAAAGTA
ACAATCCGCCATTACAAAGGTCGTCCTCCTTGATCCAGTTAACGAGTCAGAACTCTTCTC
CCAATCAGCAGAGAGCCCCGCAGGTCATCGGGGTCATGCAGAGTCAAAACAGCAGCGCAG
GCAACCGGGGACCCCGGCCGCTGGAGCAGGTCACCTGTTACAAGGTGAGTCCTGGGGCTG
GGGGATGGGGCAGGGTCTTCACAGTCAGGGGCTGTTCCCTCATTCCCCAGACAGTTAATT
TTGAAAAATGAAAACATCTATGTTTTTGCTGACCATAAAAGTGACAACGGGCTGCTCTGG
TGGGCTAGAGACCATGCTGCTTCCTTCCACAACACACCAGGGCCAACAGAACGATCACAA
CATGCTGTTGAATGCAAGGACAGAGTTTGAAGGAAAGGGAGGGGAATCTTCCAGAGGCCA
GTAACAAAGTGGAAGCATGGGTTAAGGGAAGGGAGTAAGCCCTGAAGCTTCTGGATGTCC
TCACATCCACAAGGGCGCATACCCGAATGAGAGGGACAGCTTTACCACCCAGGAAAAAAA
CAGACTAGAATCCCCCTGAACAGAGTGGGACGCTCAGGGGAAGGGTAAACTTTTAAAAGT
CCTGCTAGAAAACTTGTGTTGTTCTTGGCTCTGGATGGAAAGGGGGGAGAAAAGTGCCTT
GAGACTTCATAGTCACCAATGGTCCCTTCATGAGTTTTGGGGCTGTATGCACACCCTTGG
TGAAGGCTATACAGACTTGAATTTTCTAATCGGAAACAGCCCCAAATGTGGGCCCCTGGA
ATCTGGCTCTATGAGGAATTTATTCTCAGCCCAACCACACAGAATTCCCACAGCTAAAGT
TCCGAAGAATGAGTTCATAATCAAAAATCACAAAACCTAGAAGGAAGCAAACCCCACTGA
GGGAAGTCAGCAGAAACAACTGATAGTAGAACTAGGCTTACAAAAACTTCAGATTTCAGT
ATTTTACAAAATACAGAATTAGTACACGCTTTCTGTAAAAACATTTAGAGGACAGATATG
TTTCAGGTACAGTGTTATCTCTATTCCCACCTTTCCTAAAACAGCCACTTGACTTAGTGT
GCTGTGTTGTCACGATTTTTGGTTTTGGTGTTCCTTCAGGCCCCATGGGCGACCCCACTT
AGAGAACGGCTGTGCCAAACTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 3122..3274, 5654..5749, 6139..6232, 7381..7453, 8993..9163
1001..1049, 3122..3274, 5654..5749, 6139..6232, 7381..7453, 8993..9163
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved