Felis_catus Locus RPS12
snOPY snoRNA Orthological Gene Database
Felis_catus RPS12
Felis_catus
RPS12
GeneScaffold_559
SNORD101, SNORA33
1540..1612, 3161..3290
4446
CTCTTCCAGGTCTGTATGGCGAAATTCATGCCGGATTTCTCAAAGACTACGTTCTCTCT
TTACTGTATCCCGAACCCAGTTCCTGTGTCTGGCGCGTCGTAGGCGTTTTAAATGCACCT
AATGAAATGCACCTACTGAATCCCGATCTGCGCGGGTTTACAAATTTCGGGAACAATCTG
GCGTTAAAAACAAAACAAAACAATTTTAGAACCAACTGCATTTAGAAACTGTAACCAACC
ACTTAACCAGAGGTTCCACTTTAGTCATACAACGCCGGTAAAGAATTTGCGGCGTACTTA
GCAGTGAAGACGGGCTGGCTTTCGTTTCACAACAAAACACGCACAAAACGACACACTCGC
AGACGTCTAGAGTAACTGAGAAGCGATGCGAAAGCGCGCCGTGCAGGAAGGCCCAGTTAA
TGGGTTCGACAGGAAATTACAAGGTACTGACTTAACGAGGAAGACAAGGAACCAGGGAGC
TAAGACCACGCAGACGCGCGCTTGGCCGTTCTCGCGCTCCGTAGAACCCACTCTCTGGGC
CTCCGTAGGCCACGCCCCTGGCGGGGAAGGACGATGTGGGGCTGCCCGCGTTAGTGCCTG
TTGCGCGTAACAGTGACCGGTCGCGGAGAGTCGGAAGACTAAGAGTAATCTTGACTCGGA
TTGGCCTCAATCCGGAAATAGAAATTCTCGAGGCCCGGCACCACCAGAGCCACCTCTTTC
GTGAAAGGGAGTGCACATGCGCCTAGGGGTGGGGGTCCTGGGAAGCCTTTAAATACCGTC
ATGCGGGCGCGCACGACCTCTTTCCCTGCCGCCGCGGAGTCGCGCGGAGGCGGAGGCTCG
GGGTGAGTTGAACGGTACTGGGGTGGTGGTTGTGGTGCTTTTGGCAAGGATTGGGCTTGC
GCGGAGTTGTTTGTTCAACTGCTGTCTTAGTTTCTTAACCTTTTTTTCTTTCTTTGCATT
ACAGTGCGGTCAAGATTCGGCTCCATCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
TCCAGGGTCGGAGCCGTGGGGGCGGGGAAGGGCATGGGCAGCGAGCCTGCTGTCGGGTCT
CAGGGTCAGCCGCGGTCTCCTAAGGGCGCCTCCTGTGCCTCGTTTGTGACTTTTGAGTCC
CAAGCGGTCCGGTGGTGCGTGGGGAGTTTAGTGATGGTTTTGACTTGCTCCGTTTTCAGC
ATTGCTGCTGGAGGTGTAATGGACGTTAATACTGCTTTACAAGAGGTGCTGAAGACCGCC
CTCATCCACGATGGCCTGGCACGTGGAATTCGCGAAGCTGCCAAAGCCTTAGACAAGTAC
GTGTATCAGTCTCAATACTGTGGGTTGTTGGAACCGGAACAAAACTGCAGCCAAGGAGAG
AAAGCGTGAAGTTCATGGTGTTAGCACAAAAGTTCTGAATGGCATCCGTTCTACAGGAAA
CCTAGGAAAAGGTATCAGAACTCAGATCTGTGTGGCCCATCTAAAGTATGTGGGTTCGTT
TGGAGTGGGGATGAGCGCTTTATTAAAGCAAGACTACAGTGTTTGAATGATGACTTAAGT
TGTCGGATACCCCTTCACTCTTTCTGTGAGTGAAACCTAACAGTCTGACAAACCTGTAGG
TTGTGGGGCTGATTTCACATTAGAGGGCAGATAGGTAACCTCGAGTGAAACTGGAGGATT
TCAAGCTAACGTTGCAGAAGCAACTGGACTTACAAACGAGTTCAGAAAGTGGTAGCCGTA
GAAACCCACGTAAGTACGAAATATTCGTAAAAACACCCGTTTAGGTTTTCAGTTATTTAA
GTGGGCAAGACAACTGTATGTGTTCGCTATTGGAGTGGAGCATCCGTGCCCTTTAGGAAT
TTCTTACAGCTGGGTTAAATTTTAAGATCTCTTAGTTCGCCTTGGTGTAGACTGGCTTCT
TGAACCCAGCGAAGTCGCACTTTGCCGGAAGCCCTTCAGGTCCTGGCGTGAAGCCCCTGC
GCTGTTTGTACAGTGGTAGTGCTGGGCAATATTAAGTTTTTAGGCCAGTAGCCGGTAACG
ACTCTGATATCGTAGTTCGTTTCTCATACCGCCTTTTAAACGTGTAAGTGGCTCTCAGGA
AAGGGTTTTTCTTTGGCCACAGATGGGTAAACCGGTTGTATGTGAAGTTGGTATTTTTAG
GGAATCACTGCAGGCCTGGTGGTTCTAAAGACGTGTGAATATATATGCTTTTTGACCGGC
TTCTCAAACTGAGGCAGTTGTGTTGTTCTCCAGTGGGGGTGCTGCTTGTGTTCCCCCAGT
GTAGCCATTGCCAAGATAATTCTCTTAAAGGGTCAGTAGTAGTAGGCTTAGATTCGAGTT
GCGGTTTCTGTTGGATTGTGCATTTCAGGCGCCAAGCCCATCTTTGTGTGCTTGCATCCA
ACTGCGATGAGCCTATGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTGAGCACCAGATCA
ACCTAATTAAGGTAAGTTGTCCATTTTTTTGAGTTGAGAGATGCTTTAGCTTCGTGAAAA
TAGAGCCAGTTAGGGTCATGTTTGGGTTAAAGCTATTACACCAGAGCAAGTTCTGTATAA
AAATGGGTCATTTCTGATGCTGTGAAAAACATGGCTTAAACTTGGTATTTTGGGCTAGTT
TATGGGAATGTTTCATTCGTGCAGAATGAATTGCTAATTTTGGTATTGGTACAGAAAAAA
GTGGCAGTGCTTCTGGGTGTTTTGGTGCTGTACATGATGACAACTGGCTCCCTCTACTGA
ACTGCTATGAGGAAACTGCCATGTCACCCTATCTGACTACAGCTACCGTCTCTGTTTGAC
TTACTGTCCTTAGTATTAATGTCTGCTAATATGGTGATGTTTTTTTTTTATCCCCTCTTA
ATTCCGTCCCAATAGGTTGATGACAACAAGAAACTAGGGGAATGGGTCGGTCTCTGTAAA
ATTGACAGGGAGGGAAAACCCCGTAAAGTGGTTGGTTGCAGTTGTGTGGTGGTTAAGGTA
AGTCCGTTTTTATCTCTGGGTTGAAGGTTGTGCTGGGAAACTGCATAATTCTGTACTCAG
TTTTCATTGTTAAAGTCCAGAACCTCAATGAAAAAGATGTGTGATTTTCAACATTCGGAG
TCCGTTTTCAGCTTTTCAGAAAAGGAAAATAGGCTGTAATGAAGCCGGCCAATGAATCTG
CTTAGCTGAATGTGTTTCTGCAGAAATTTAAAAAACGCTGGCAATAGGAACGCCATGTTA
CGAGCCTTAAAGACATTGAAGTCATTAAGGTCCCTGAAAATGGCTACAAGAAATTTTAGT
GATGGGAAACATTTTCATAAGACACGAACTAGTTTTGTAAAGCTTCACCATAACTAATGC
TAACAAGAGTTATTAATGTTAGTCAAAAAAATTGCTTTTTATTTTTTAGGACTATGGCAA
AGAGTCTCAGCCAAGGATGTCATCGAAGGAATACTTTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCATTGACTTTGCTCCGCGCTGTATCGCTGGGACCTTGCTTGC
TCTGGTAGGCCCTCCAATATCTTTTGTTGGATGAACAGATTTGACCTTTCAATCTACTTA
GCGAGGGAGGGAGGGAGGTAGGTAGTGGGGTTTCTTCTCAAGGCTTACACTCCCCAGCCC
CTTTTGACACATGAATTTCTCATGTTCCTTTTTTTCTAGCAACAGTAGTCAATCTCTCAA
GCGGGGCCTCTTTTAGACTAGAACGGTGCCAAGCTGTCTCAGCCTGCCTTCGCTCCAGCT
CCACTCTAGGGAGCAGGGCAGAGAAATGTATCCTATCACAATATGGGGTACAGAGCTCTA
AGAGTCTGAGAAATCACTTTAAAAGCCACTTTGAGACCTGGGAACAGTAAAAAGCCTGTG
AGTTCGGTGAAACTATTTTTACATTGCAATGATTTCTTTTTGAAGCCTATTTATTAAGAC
ACATGCCAACAGCACGGTATTGTACAGGCGATGTGAACGAAACCTTACACAAATGTAGTA
TTTGTCTTTTTATTTTCCCTTCTCTCAACTCAGCTGCCCCCGACTAAAATTTACAAATGG
ATATAAAAATCCTGTTTGTACCTGGTTGGCTTGTTAGAGAAACACTGAGTGAAAGGCCTG
TGACATTTCATAGCACTGCCACCAGATTAACAGGAGCAAAACGCACGTAAAGAAAGAAAT
AGCTATGGGATTCATAAGGGGGAAATAAAATATTAACATACAAGAGGCTACAAATTAAAA
GCCCTGTCTTCGCTTTCGGATCCGATGCTCGGATATACTCGGTGAGTTGCAGGGGTCAGC
AGATGTTTTGCTAAGTGGGCGCGGGTTGTGAGTCGCTGGGAGGTGCTTCCCCACACGTGG
ATTATAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1199..1315, 2368..2470, 2895..2996, 3409..3426, 3429..3446
1001..1014, 1199..1315, 2368..2470, 2895..2996, 3409..3426, 3429..3446
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved