Felis_catus Locus ENSFCAG00000007518
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000007518
Felis_catus
ENSFCAG00000007518
GeneScaffold_4019
SNORA68
3444..3576
5100
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGAGAGAGAGAGAGAGAGAGAGAGAAAGAGAAGAAAGAAAGAGAAGAAAGAGAAGAAA
GAGAGAGAGAGAGAGAGAAAGAGAGAGAGAAAGAGAGAGAGAGAGAGAAAGAAAGAAAGG
AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAGAAAGAAATTCCACACAAGAGCATCACG
GTAAGTGGAACGCTCGGACTGCCACCCAGACAACCCTAGGCCGCCTACAACTCCCAGCGT
GCCTGGCACTCCCAGGCTCCCTTACCGGTCAAGGCGGAAGGGGAGGGGCTACTAGACCTA
CCTCCTGTGAGTTGTAGTCTAGCTGCGAACGAAGGCGGGGCTGTGTGAGGTTGGTGGATC
CGGAGGCAATGAAAAAGCAGATCTGGTTGAGCGCCGGGCCGACAAACCAATGGCCGTGCG
GCTTGCGGGAGGCGGGACTTCCGTCAACGAAATCCTGGTGAGCGGCTGCGCGAGGGCGGC
CACTTCCTTTCTTGGCTGGCGGCGAGAGCGGAGGGTGCGCCATGAAGGCCTCGGGCACGG
TAAGGCGAGCGTGGTGGGGCAGGGGGCCGGGGAGTGCGGTGCGGAACGAATCCGGGGCCC
CGGCAGGTGGCGTGGACCGGGTAGAGGGAGCGTGCGCCCGGCTTCGTCCCTCGCCACGCG
CGCCACTGCCTTCAGGTGCAGCCAACATGGCGGCCATAGCGGGCGCCGCGTGGGGAGGCT
AATGCCATGCTCCCGGCCCGCTTGGAAATCACGGGGCCCGAAGAGGCCGGGCCTCCTTTC
CGGGGGAAGGGACAAGTTGCGCGACTTGGACGCTCGACCGACGGGACCTTGTTGAGCCTC
CGAGCCTCAGTTTTCCCGTTGGCGAAGAGGACCCAGTGGGAGGGTGCAATAATATTACTC
CTCTCGGCGTGGCTGTGAGAAGTAGAAGGAAACTATAAACCCGAGCTGACACCGGGAGTG
CGAGCTTTATCTGTGACAAGTGCTAGGTGAAGTCAGGGCGCTGTGGTGCAGAGATGGAAG
AGCAAGTCCCCGGGACCAAGGGGGTCATGTACAGCTCTCCAGCCTCAGGCCAGCCGCATC
GGTCCCTTCCTGAACGGGTGGCCCGCGGGGCTGAGGAGTCAGATTGAGAGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCAGGGTCAATCTTTCACGGTTGCC
TCAGAGCTATGGGTCAGGCCTCATCTCACCCCTGTCTCTCTTTCAGATGCGGGAGTACAA
GGTGGTGGGGCGCTGTCTGCCCACCCCCAAGTGCCGCACTCCACCGTTGTATCGCATGCG
AATCTTCGCACCTAATCATGTTGTCGCCAAGTCCCGCTTCTGGTACTTTGTGTCTCAGCT
GAAGAAGATGAAGAAGTCTTCAGGGGAAATTGTCTACTGTGGGCAGGTACGGGGCGTCTG
AGACAGGGTGAGGTCTGGAGTGGGTTGTTTACACGTTCCTGTGGGGCCCTTCCCCACTGC
ACAGAGTTCCCAGACTTCATAACCCCTGGCCTGTTCGTATGTGCTGTTGAGGCCCTAGGT
CAGGATGGGACGGATCCCTCGGTGCCCTTTTCCTAATGAAAGAGCCCGAGGCCCAGAAGG
GTGTGGCTGGCATGCCGGGGCACCTTGGCTGAGGCCCGCACCTTTGCTGGACCTCATCTA
CGAAGGTGCCGTCACTTGGGCATGTTTGCTGTGTTGGGCACTGGACTCTGCGTCATACGG
CGGCACAGGGTGGCAGCTGGTTTTTGGTCTAGATAGACCTGGGTGAGTGGCGTTTGGGAG
GAGCCTGGAGCTGGTGGTCCACATGGGGGGAATATCCAGGCCTGGACTGCTGTGTGCCCC
CGGCTGTTAAGGTGGGAATTTGTCCTAGGACAGCGGGTTTTCCTCGTGTACTTTAAAATT
CAAAGACTAGGAAATAGGCGCAGGAGAGGCCTGGGGCTGGGCTGTCCTTGGAGCAGCAGG
GGCAGATGATCAGCCAGGGTAGTAGAAGTCGGGCTCGAGCCCGCTCACTACGCTTGCCTC
AGCCAGTGTCTTTGGCAGGTGTTCGAGAAATCCCCCTTGCGGGTGAAGAACTTCGGCATC
TGGCTGCGCTACGACTCCCGCAGCGGCACCCACAACATGTACCGGGAGTACCGGGACCTG
ACGACCGCGGGCGCCGTCACCCAGTGCTGTAAGCTTCCGGTGGCCACAACCCGGTTTCTC
CTTTAGACTCACCTCGCAGGCGTCTGCAGCTCATCTGCCTGTGGCCGCCCACTCCTTCAG
ACCGAGGCAGGACGGGGAGTGGGTGGTCCCAGGCCTGGTGGTTGGGGTGCAGAGGCGGTG
TTTGTGTTTGCTAAGGGGACAGGAGTGGAAAGGATGTTCCGGGTGCATCTTTTTCTGGAG
CCTGGCAGCAGGGGGACCTTTGGAGTTGATCACTCGTGTGGCGATAATTCCCACCCAGAA
TCTAGCCGGGGCCGTGTCCGTAACGGATGTGGTGCCAGTGGCCCCAAGTGCTCCCAGGGC
AGGTTGCCTGCCGGGGCCAAAACCGAAGCACCTCAACCCAAGAACTGCTGTTTCTTGTAA
TAGCGGTTTAAACAGAGGTGCTGACAGCAAGTTGATCTCGTCGCCTTTGGGGGGCTGTGG
CCGTGCTCCTCAAAGTGAATTGAGAGGTTCTACAGCCCTGGTAGCCCACGCCTGTTGGGG
TCCTTCCGGGTCAGTACTTGACGGGGGGTTTAAGGAGTGCGCGGACCCCCGGCACACGTT
CACCTTCACCCTCCTGCAGACCGAGACATGGGTGCCCGGCACCGTGCCCGGGCCCACTCG
ATCCAGATCATGAAGGTGGAGGAGATCGCAGCCAGCAAGTGCCGCCGCCCGGCAGTCAAG
CAGTTCCACGTGAGTGCCCTGGGGGCCCTGCTGGGTGGGCTGGGCTGGGGGGGGGTCTCC
CCTGGAACGTGGAGCTGGCCTAGTTGCTTCCCTGTCCCCCAGCCTTGGGAGCTGCAGGGA
GGCACTGGGTTTGACGCAGGAGCCCGGTGGGGGGTGGCCACACCTCAGTGGCCCCTGGAA
GAAAGGTTAAGAGGCTTCGTCCCCTTCACCCATCTCTCCTTACCACAGGACTCCAAGATC
AAGTTCCCGCTGCCCCACCGGGTCCTGCGTCGCCAGCACAAGCCACGCTTCACCACCAAG
AGGCCCAACACCTTCTTTTAGATGCAGAGCCTCCCTGGCCCCAGGTCCGCCCAAATAAAC
TCCTTGGGAAAACCCGGGTGCTCAGACACGCTTGTATTCTTTGTACACCCTGCAGAGCTC
AAAAGGGCGCAGCCAAGCTGTGAGTTCTCTGCTCTGGGAGGGGTCTCTCTCTCTTGAAAT
GGGACCCAGACACTTGATTTCTCCAGAAGGGGAGCTCTAGAAATGAGAAGGCCACACCCC
CTGGGACTTCATCCAGCAAGGGGCTGTCATGGGCCGGGTCCTAGAGCCAGAGGGCCCATT
TTTCAGCCCCATCGACTGGCCCTCTGCTGTGAGCTTTGTAGCATGTTGCAGGCCAAAAGG
TTTGGCCCCTAAACCTGTTCCACCTGCCTTGTGAGGCCTCAACTCTCCCCACGTCTGTGG
TAAGCTGTGGCACTTGGATGCCTGGAAGGAATCGGGATGTTCGGGTTGGTTCATTCCACC
TATGAGTTTTCCCTTCCAGGCTTAGAACGCTAGTCTCTGGTTCCGGGATCCTCAGAGCAG
ACGTGAGGGGGCACCTGAGAGGGCTGTGAGCTGTGGTAGTTTGTCCTTCACTGGCTTGGG
GGCCCCTCCAAGGACACCCTGATCCTGCCCAAGGAGGTGAAGGACTCACTGGGTATCTGT
CTCCAGGCAACCGCTTACAGCCTGGGGAATTCTAGGCATGAAGCTAATCCCACCCTGGCT
GAGCCCGTCAGGAGGCCGACACAGCCAGGAAGGAGCAAGGATCTGGGGAGGCATCTGTCC
TTGGTGTGTGACCTTGAGCAGCCCCGGCCCTTTGAGCCTTGATGTTCTCAGAAGATGAGG
GCACGGACCAGATTTAATTTACTCGGTTGACAGTACTGGGGAGAGTCGCAACTACGGGCA
CCGGGGGCAAAGGTCAGTCAGGATCCCCTTCTATTCCGGGGAGCCGGGGAGTGAGAAGAA
GGCAGGGCGAGTCCATGTGGAGTGGGGTGTGGGGAGCAGTCTGCGCTGGAGTGTCCCAGG
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2146..2325, 2958..3087, 3679..3788, 4008..4100
1001..1018, 2146..2325, 2958..3087, 3679..3788, 4008..4097
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved