Felis_catus Locus ENSFCAG00000009388
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000009388
Felis_catus
ENSFCAG00000009388
GeneScaffold_4214
SNORD105
1904..1990
5558
ATAAGTCACAGAGAGGGACTGACAGATGAGAGAGAGAGAGAGTACAAGAGACAGAGAAG
GGGAGAGACATGGGAGGAGGTGGACAGAAACGGGGGGGGGGAGTCAGGAAGAGGGATGAG
AAGAGAGAGATGGGGATAGAGACATGATAGATATGGAGACTTGAAGGCATTGAAAGAGAC
AATTGATGGCAGAGACAAAGTGGGGCAGAGGGAGACAGAGATAGGAAGAAGACAAGGATA
GGGAAGGGGAGACGGAGGAGGGGAAGAGGAGAAAGAATTGGGAAGGAGAGACAGGAGAGA
GGAAGCAAATGGGGGAGGGGAAGCAGATGGTGGAAGGAAACCTATGGGACAGGAAAGAGA
CGTTGGGGGCGTCCCTTTTCCCCACCCCAAGGTTCTGGGGAAGAAGCCAGAGGCCTGAGG
CCAAGACTGGGGCTTTGAGCGGAAACCGGGAGGGGGTGAGTTATTCACAAAGCGCCCGCC
TTGCCCTGAGTTTCCAGAAGGTGATGTGGAGTTTCCATCTCTCCGCCGCAGACAGGGCCC
CCGGGGAAGACCGCTGGCCCTCAGGAGCTGGGGGCCTATATACGTAATTGCTATGCTCTA
CCCATTTCTCTGGTTGTTCCCCAAGTGCCTGGTGCCTTTGTGCCAAGCATTGTGCATCAT
CTTTCTTAGTAAGTGGATCAGAGGGGAAATGAGTACCATCCTCTCTTTAGAATACTTGTA
TGAGCCTCAGAGTGGATAAAATGGCTGTCAAAATCGCCCAGCTGGTATAAATGAGCCGAA
GTAGGATTCGAACCCACAACTTATTTCTCCGAAGCCGGCGCCGCTTCGCTGAGACACTGG
CCCCGCCCGGTTTCCATAGAAACAAGCACCAGTGTGTCTCCGTAGCAACCCCTCTGTGGC
TTTCTGCTCGCCTGGTGACGTCACCGCGCAGTTCCGCCTCACGTCGTCACCTCACCAGCT
CTGGAAGTGAGCGGCGCGGCGCTGGAAGCACTGGCAGAAGCGTCCAGCTGAGGACTCGCC
GCCTGGCGCATCCAGCTGCTGAGCGCGTATGCCTTGGGCCGGAGCACGGGCACGGCCCGT
GGGGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAGGCAAGCT
CAGCCTGGACCTTCATCGGGTCATGGAGCCCCCTCACCGCCACCCGCTTGCAAGTCTGCA
CCTCCCACCCCGCCTTCCATCAGCCTTTGGCCCCGTCTTCGCCGCTACGGAGATGGCTCC
AACCGCAGAACCGCGCGAGCCTTCAGGCTCCCTGGCAGGAGAAGGGGACCTTTATGGGGA
CCATCGTCCCTGCCTCTTCGGATTTTGTGGGGCAGCTGCGAGGGGGCGCAGATGAACCCG
TTTTGGCTGGATGTCTAAGACTGGTGGTTAAAAAGGGACTAGAGTTAGCAAAGCTAGAGT
GGAAACTTCGGTTCTCTCAAAGGCCTGGAGAAAGTTAATTAACGTCGCAGGGCCCAGGTG
GCTCATCTGCAAAATGGGCCAGGCACAGTAAACGAGCAAATTTAAGTCGGGTTAGTTCTA
GAGGTCAAGAACATTCCACTCCTTTCTTTCTGCGACAGGTTAAATTCAAGAAGGGGCATA
AGAGCTTCAGCTTACAGCCCTTGCTCGGGGGGAGGATACTTAACGATCTTTCCATTTTGT
GTTTGTAACTCTCAGATACGAAAGAAAAACACTCTGAAGGATTGTGTGGCAGTGGCGGGG
CCCCTTGGGGTCACACACTTTCTGATCTTGAGTAAAACGGAGACAAACATCTATTTTGTG
AGTTAACACATCCACACCCCTCATCTTCCCCCTGCCCTCCTCCTCCCCCAACTCTCACGA
TGAACCCATATGCCTCTGAGTTGCCATGATTCTGGCTTCAAAGTAAACGCTCTGAAGAGA
TGGGGCGGAGGTTCCCACTCCCTGCTGCCTAGCTGGACACCTTGACTCTGACCAGTCCTT
TTGTTTTGTTTTTCCCGTAGAAGCTGATGCGCCTCCCAGGAGGCCCCACCTTGACCTTCC
GGATCAATAAGGTAAGGGTCAGAGGTAATGAGGGCCATGTTGGGTAGAGGACGAATTCAG
GGAGGGCGCCAGCCATGTGTGGCTGTCAGGCCTCACTCCTCCCCCCCGTCCTGCAGTACA
CACTAATGCGCGACGTGGTCTCCTCCTTGCGCCGACACCGCATGCACGAGCAGCAGTTTG
CCCATCCGCCCCTCCTGGTGCTCAACAGCTTCGGCCCCCACGGCATGCATGTGAAGCTCA
TGGCCACCATGTTCCAGAACCTGTTCCCCTCCATCAATGTGCACAAGGTGGGCTGGGCCT
GGGGCGGTGGCAGGTGAGGGTGGAAGGGCGGACAGTAGGTACCACACGCAGGCCCTTGGC
TTGTTTGCTCGGTCCTTGCCTCTCAGCGCGGAGGCAGAGCGCTCCGGCTCCTGAGGTCAC
ATCTCCCTCACGTGTTCGTGACCCTGGGGTAAGAGACTCCCTCGTAAGCTTTCTTCCTCT
CTGAAAGGTGGAGAATGATCCTGATTGTCCTTTATTTCTTGAGTGGGGATTGAGTATTAG
CCTGAGCAGCGTGCCAGGTACTTGGGACACCAGTTGACGGATGGGGAGACAGACTGACAG
AGGGGAAGTCATTAGTCAGAGGTTAGACGCAGAGGGCAGGACTGGGTTTTTTAAGCTGTC
TGGCTCCAGAGCCCTAGTTCCTAATCCCTGGCACCAGCTGGTCTCAGGTTAGGCCTGTTA
GATGCTGATCATCAGGGAGCAGTCCACCCACAGTGTGGACGGCTTCGGTGGGCCTCAGAA
CCAAGAACTCTAGCCAGTGCGCCTGCCACTCCATTAGTCCCCCAGTGCCACATCTCCCTG
CTGAGAGATTTCTGGAACAGGGCCAGGGCCTGCTGTGGCTCTAGCACACAGGGAAGTCTG
TGGGCAGTTGACATGTTGCTGTGCCCTCGCCTCTCCCTTCCAGGTGAACCTAAACACCAT
CAAGCGCTGCCTTCTCATCAACTACAATCCTGACTCCCAGGAGCTAGATTTTCGTCATTA
GTGAGTACTCTTGTTGAGGGGCGGGGGGGAGGGGAGGAGGCAGGGCTTCCACGTGTGGCT
GATGACAACGCTCCTGCTGAGGCTCTGTGATTGTCCAGTTTCAAAGTAAACGCCCTGACG
CACTGTGGAAAGGGGAGGGGGGCAGAGCTGACCTCCAGTCTCAGGATCCCTAACCCCCCT
TCTCACACTCTGGGTCTTGCAGTAGCATCAAAGTCGTTCCTGTGGGCGCAAGTCGTGGGA
TGAAGAAGCTTCTACAGGAGAAGTTCCCCAACATGAGCCGTCTACAGGACATCAGCGAGC
TATTGGCCACGTGAGGAGGGCACCGGGTGGGGAGATCACTACCGCGCCGGAGACCCCGGA
GCTTTTCCAGGAGCCTAGAATCTCCTACTGACCAGTGTGTCCTCTGCACAGGGGCGCCGG
GCTGTCCGAGAGTGAGGCAGAGCCCGATGGGGAGCACAACATCACGGAGCTGCCCCAGGC
CGTCGCGGGACGCGGCAACATGCGGGCCCAGCAGAGTGCCGTGCGGCTCACTGAGGTGAG
GCCCAGCCCAAGGCAGGCCCAGGGTCAGAAGTGACTTCCTCTGTCAGTACCCCCCCCTTC
CCCCCGGCCCTGAAGAAGGACTGACTCGTTCCCTATGTCCCTCCAGATTGGGCCCCGGAT
GACCCTGCAGCTCATCAAAATCCAGGAGGGTGTTGGGGAGGGGAACGTGCTGTTCCACAG
TTTCGGTGAGAACGGGGCTGGGGAAGCAAGGGGCTGGGAGTCCAAGGCCCTCACGGGTGG
GTCGCGAGGTGCACTGACACATCTGGGTCTCCGTGACCCATCTTTTCCCGCTCAGTGCAC
AAGACTGAAGAGGAGCTTCAGGCCATCCTGGCGGCCAAGGAGGAGAAGCTACGGCTCAAG
GCCCAGAGGCAGGCCCAGCAGGCCCAGAATGTTCTGCGCAAGCGGGAGCAGCGGGAGGCA
CACAGGTGTGTGGCCGTGGGCCGTGCAGGTGAGGCAGGGTCTCAGGTGCAGGCCGCCACC
CTAAATGATCTCTCCCTCCAGGAAGAAGAGCCTGGCAGGCATGAAGCGGGCGCGGGCGGA
GGCCAGTGGGGATAGCGATGCCGAGGACCCCGGCGCCCCCCCAGAGGGGACCGGCCAGCG
AGAGGAAGAGGAGGATGAAGCCGAGTATTTCCGCCAGGCAGTGGGAGAGGAGCCTGATGA
GGGTGTGTGGCAGGGGTTGGTGCAGCTGGGCACCTTGAGCCCGTCCCTGTGGCCTGGTGG
CCTTGACGTGGTCTCTCCCCACAGACATGTTTCCGAAGGCAGCCAAACGAAGACGGCCTG
CCGGGCCCCCAGGCAAGAAGCAGCGAGGAAGGGGGCAGAGGCCAGATCGAGGCGCTGACC
GGAGGCCTCCAAAGGCCAAGGGCAGGCCTCAGCGGGCCCAGGCCAAGCTGGAACGCAGAG
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGAGTCTTGCGTCTG
CATTGGGAATGGGGAGAGCTGGAGTCCCGTGGTAGAAAGCCCAGAGGCTTGGGGCCAGGA
GCTTCTGGGAACCGGGCTAGGTTCGCGCCCACATCAGAGCAGTGGACACGCAGGAACTGT
TTTGCAGGTGAGGGCGATGGGCAGATGCAGTCTGGTGCCTCGGGGTGTCCTGGGCCCGTC
CCCAGCCTAACCCCCCAGGTCCCCGTTACCTGCAAGCCAGTGACTGGGCTGCTCTGGAGG
GCAAAGTGTGAGGAGGAAGGAAGCCGGGGGTGGAAGCGAAGCTGGCTGGTGTTGGCAGTG
GGCGGAGCTGAGCTGCCAGCGCTGAGAGAAAGAGGGTGGGGCTGCTGGGAAGGAAGGGGC
CCGCCACGCCGCTGGTTAGCTCGGCACCGGCTCGGCTCGGCTCGGCACCAGTGGTGGTGG
CGCGGCTTCGGCGCTGGACCCGGAGGCAGGGCACGTGGGCCATGGCTGCTGCCACATCAG
GTGAGGGTCCTGGCCCCTGTGGCGCTGCCCAGGACCGAGGCTGGGGGTAGCCGGCTCCTG
GGAGGCAGACGGGAGGGACTTAATCGCGTCTGGACAGGGACTTCCTCCCAGGGCGGAGAT
GGGACGAGGAGGCAGAAGCGTGGTTGGGGAAGCAGTCGCGTGGGGGAGGGAGGGCCGCTG
GCACCTTGCACGGAACTCGTGGCCAGCCTGCTGGACAGACTGGGAGCAGGCTGTGCACCC
AAAGCTGAGGCTAAGTTGGGTACATGAGAGGGAATCCATTCCAGATCTCTGTTCTGGTCC
GTGCTGCTGGTCCCAGGCCTTGTTCTGGGCTCTGGGAAGCCAGTTGTGGGGCACTCCCTG
CCCTCAGGAGAGGTCTTCTGGGTTGGGTTTGTTTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1002, 1022..1079, 1188..1195, 1197..1231, 1233..1252, 1755..1856, 2060..2110, 2216..2386, 3043..3119, 3322..3429, 3531..3654, 3766..3844, 3955..4084, 4161..4321, 4404..4558
1001..1002, 1022..1079, 1188..1195, 1197..1231, 1233..1252, 1755..1856, 2060..2110, 2216..2386, 3043..3119, 3322..3429, 3531..3654, 3766..3844, 3955..4084, 4161..4321, 4404..4558
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved