Felis_catus Locus ENSFCAG00000004502
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000004502
Felis_catus
ENSFCAG00000004502
GeneScaffold_4236
SNORA38
1286..1414
19972
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTGGGAGTGAGGCCTCTGGGAAAGGAACCTGGGGCGCAGTTA
GGGAGTTGGTGGTCTAATAAGTGGGGGATCTGAAGTTCTGTTACTTGCAGAATGGAGCTT
TATGCCTTTTTCTGCTTTTGTCTAAGGCTGGGACTTGTCATGTTTTATTGTACATCTCTG
GAATGATTTCTGTGGGGGGAGAAGAGATTATGAAGAGAGATAATGAAGTAGCTGCTACCC
TTTATAGCCTGGCACAAAAGGAAGAGTGTGTTTACTACTAGGAGGATACTAAATTTTTTA
TCTGGATTTGCTTGGCAAGAGGTGTCTGGGGGAAAGAGGCACCATGGCATTTGGGCTCTG
TGGGAGTTTAAGGGACTGGGGACTTTGAATAGGCTGGAGGCAAAGACACCAGAGGGCCAC
ATATCTGGGTCCCTAATGAGAACAAAAAGGACCATCTAGGTTTCTTTTGGAGTTAGTAAA
GGGAGCAGAGACTGAAGCACTTGGTGTCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTGCGAAGATGTTCCTAA
TTCCTAGAGGCTGGGCATACATTTTAAAGCTCTTTGAAGGGAAATGGTTATAGTGCAAAT
ATCAAAAGACTAGAGAAACACTAGAGACTTCCGAGTTTTATTTTAGGTCCCATAGGGGAC
GTTGGTCTTTGGATGAACACCATTTACCCTCCTACAAAGGCGTGTCTGTAGTTCCCTGTC
TTTGGACACGTAAGAATCGGAGGAAGAGAAACGTGGATTTGGAGAAGTCTGGGCCAGCTT
GCTCCTGCAGGCTCAAGATCAACCATCCAACAGAGAAGCATCANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTGAGATTTAGCAATTAGCACTTAGTTTTTGGAGGGGGCAG
AGAGAAAGCAGGGGCCTATGACAGAGGGGAGGACAATAGGTTTAGGGAGCTGGTTGGCTC
TTTGTCCCTCTAAGCAGCTGCTGTTGGGACGTTTTGCAGATGTATCCCCCGTATCTCCCG
TTCCCTCCGCCCTATGGACCCCAGGGGCCTTACCGATATCCTACTCCTGATGGGCCCAGG
TGAGTAACCCAGCTCTGGGTTTGTGATTGGGGACGGGAAGCCTACTAGGAAGGGAGGTGA
TCTTCAAGGCCCAGAGTCTTCTATGTGTATTTTTTTGGTTTTGTTTTCTTTTGTTTTTGA
CATTTATTTGTTTTGAGAGAGGGAGCAAGCGGGCAAGGGGCTGAGAGAGAGGGAGACAGA
ATCCAAGCAGGCTCCACACTGTCAGCGCAGAGCCTAATGTGGGGCTCAAACTCACAAGAA
CTGACAAACCGTGAGGTCATGAGCTGAGTGAAATCAAGAGTTGGACACTTAACCGGCTGA
GCCACCCAGGCACCTCTTGTATGTGGTTCTGTAACATGCTTTTACACTCTCTCTCCCGTT
TGTCTTTTCATATGCAGCCGTTTCCCTCGTGTGGCGGGCCCTCGGGGCTCAGGGCCGCCG
ATGCGCCTTGTAGAACCTGTGGGTCGGCCTTCGATTCTTAAAGAGGATAATCTCAAAGAG
TTTGACCAGTTGGACCAGGAGAATGATGATGGTTGGGCAGGTTAGTGGATATGAAGGATG
AAGTGTTTTGGTCTCAAAAGGCAAAATCCCCTGAATAAATAGGGGGTTGTGTTGGGAGAA
AAGGAGACACCAAAGGGTAGGGCAGACACAGGGGGGAAAGCCAAGTCCTGGTAAAGAACT
GGGAGGTGTGGGAATGCCAAGACTCCCAGTGGCATTCACTTCACTCAGAGGGGGGTTGGC
GTTTCCAGTAGTGCATCCTGTTACGTAGTTCTAGACCCCTTTGAAAGTTACCTGAGATTG
GAGAGAACACTTGGGTTATTGCTTTTCACTTTTCCCTCAGGGGCCCATGAAGAGGTTGAC
TACACTGAAAAGCTCAAGTTCAGTGATGAGGAAGATGGGCGAGACTCTGATGAGGAGGGA
GCTGAGGGCCAGTGAGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGTGTTTGGGCTGAGGGTACAGGTGGTATGGGTGGAAGGGAAATGAAGT
TGGTTTATTGGACTGTGGCAGATGAGAAAAGCTCTTTGCTCGTGTGGATATTTGAATTCC
TGGATACGTAGTGACCTAAAACCACTTCGTATAAGCTCAGTCTGGAGCAAGGGGTAGAAG
GCGTCTGTCATTTTGGTGGTTTCATGGGAATTTAATGCCACCGTCATTGTTCTTAAAAGT
AAGTGCTTGAGAGAGGGAGGTGAGAGCTGAGGTGATGGGTATTCGTGGCATACCTGTTGG
TGTACTGGGCCACTGATGATTATCTTTTTTATCAACGCAGTGGAACCCCAGCTGTCCTCA
AAAGAGGGTTCTGAACAACCAGAAGAGGTTCCTTCTCCTGCCACAACCCCTGCCCCGAAG
GTGGAACCCAAGGGTGATGGGGTTGGTCCCAGCCGACAGCCCCCCAGCCAGGGCTTGGGC
TACCCCAAATATCAGAAGTCATTGCCACCTCGTTTCCAGCGGCAGCAGCAGGTGAGATCA
AGTTATTTCCCCCATTAAGAGCTGTTTCTGTCCCTGGCTTCGATGTTTATCCTGTTTGTA
AGTTGCCTTCCGGGTCCCTCTACTACCTCTTGTCTCTCTTGTGTCTCTTTGGTTTCCATG
TCGTCCAAGTGTTGATTGCATCTGTGTATTAACTTTGCCTTATTGTGTGTTTCTCTTTTT
CTGTTGAGGGTGGTGTGGGGGTTTTGAGGTCTCTCTCGTCCCCTCTTCTGTCCTTGCCCA
GGAGCAGCTTTTGAAGCAACAGCAACAGCAGCAGTGGCAGCAGCATCAACAGGGTTCTGC
CCCACCCGCTCCGGTACCACCATCACCGCCCCAGCCTGTGACCATGGGGGCTGTGCCAGC
TCCACAGGCTCCGCCCCCACCCCCCAAGGCCCTGTACCCAGGTGCTCTGGGCCGGCCCCC
ACCCATGCCCCCAATGAACTTTGATCCCCGGTGGATGATGATTCCTCCTTATGTGGACCC
CCGGCTCCTCCAGGGCCGGCCCCCTCTGGACTTCTACCCTCCTGGTGTGCATCCCACTGG
TAAGGGCCCTTGCATGGGAGTGGGTAGGGGACACTTCAGTCCCAGGAAGTGGGTATCGGC
ATCTTGCTGTGGGAATAAAGGGTCACCGGTGAAGGAGGTTGGGGCAGGTATGTGGTTGTA
TTGCTGAGGTGGCTCTTTGTTTCAGGACCATCTTTGGGAAAGAAACGGTGGTCTTTCATT
GGCCAGGATTTACTTGGGGGGATTCATTGATTTAGTCTGGGGAGACTGAGTGGATAGGGT
AACTCTTTCAGGAGTGTGCATCAGGCCCAGACTTGACAGGTATAAGAGAGGAGTTGACAT
TGATGTGACTGACAGAAGCAGATTGGGGAGATGCTTTTTGAGCTGCAGGGCCTGTCATGC
AAGAGAGGGTTAGCTTTCTCATCCCTCTTGTTTTCTTAGGCTTAGTTCCCCGGGAGCGCT
CAGACAGTGGGGGTTCAAGCTCAGAGCCGTTCGAGCGCCATGCACCTCCCCTGTTGCGGG
ATCGGGGCACCCCACCAGTGGATCCAAAGTTGGCCTGGGTAGGAGATGTCTTCACCACCA
CGCCCACTGACCCCCGCCCGCTCACCTCCCCGCTGCGCCAGGCGGCTGATGAGGATGACA
AGGGGATGAGGTGAGTCTGTAGTGAAGTGAGTGCATTGCCACTGAAAGGGTCTGGGCTAG
GAGAAAAGGTTCTTTGGATTATTGGTGCAGTGACAGGAGTAAGTGTGAGAGGAGCGTCTG
GGTGGTAATAAAGTGTACTCTTTCTCCACCTAGTTGCAGTTTTTTTCATTCTAATTTCCA
GTTTTTTTGTTGCCCTTTTAGGAGTGAGACCCCTCCAGTACCTCCCCCACCACCCTATTT
GGCCAGTTATCCAGGCTTTCCTGAGAATGGAGCCACTGGGCCCCCGATTCCTCGCTTCCC
TCTGGATGAACCAGCTCCTGCAGGGCCCCGTCCACTCCCTTGGCCCCCAGGCAATGATGA
AGCCACCAAAATACAAGCTCCCCCGCCGAAGAAGGAAACCCCCAAGGAGGAGACTCCACA
ACTGACGGGGCCAGAAGCCAACCGAAAGCCTACCCGAGGAGTTGGAGGCCAAGGCCCCCC
TCCACCTCGCAGAGAGAGCCGCACTGAGACCCGCTGGGGTCCTCGCCCAGGCAGTAGTCG
TCGTGGGATCCCTCCAGAGGAACCAGGGGCCCCTCCCCGCCGTGCTGGGCCTATAAAGAA
ACCCCTGCCACCTACGAAAGCTGAAGAGCTCCCTCCCAAACCCCTGGAACAGTGTGATGA
AAGCCCCAAGGTTCCAAAGCCAGACATCCTCAAGACGGCAAAGGGGAAGATAGGGGTCCC
CAAGGAGACCCCACCCAGTGGGAATCTTTCCCCTGCCCCAAGGCTTCGGAGGGATTACTC
CTATGAAAGAGTGGGTCCTACCTCTTGCCGGGGCCGGGGCTGAGGCGAGTATTTTGCCAG
AGGGAGGGGTTTTCGGGGCACCTATGGGGGCCGGGGGCGGGGAGCCCGAAGCCGAGAGTT
CCGCAGTTACCGAGAGTTCCGAGGAGATGACGGGCGTGGAGGTAGTGCAGGTGGACCCAG
CCATCCCCCTGCTCCCAGAGGCCGCACTGCCAGCGAGACGCGAAGTGAGGGTTCGGAGTA
TGAAGAAATCCCCAAACGGCGCCGGCAGCGGGGCTCAGAAACGGGTAGTGAGACCCATGA
GAGCGATCTGGCCCCCTCAGACAAGGAGGCTCCTCCACCCAAGGAAGGAGTGCTCACCCA
GGTTCCTCTTGCTCCTCCACCATCGGGAGCCCCTCCTTCACCAGCCCCAGCCCGATTTTC
CACCGCCCGTGGTGGGCGCGTCTTCACTCCCAGGGGAGTGCCGTCACGCCGGGGTCGAGG
AGGTGGGCGGCCCCCTCCGCCCATTTGTCCAGGCTGGAGCCCTCCGACCAAGTCCCTGGC
CCCCAAGAAGCCTCCGACAGCTCCTTTGCCACCGAGTAAGGAGCCTTTGAAAGAGAAGCT
GATCACAGGGCCTCTGTCCCCCATAGCCCGGGGAGGCAGCAGTGGAGGCAGCAACGTGGG
CATGGGTGTGGAAGATGGGGAGCGGCCCCGACGGAGGAGGCACGGGAGGGCTCAGCAGCA
GGACAAACCGCCTCGGTTCAGGAGGCTGAAACAAGAACGGGAGAATGCGGCCAGAGGGAC
TGAGGGCAAGCCCTCTTCCCTAGCCCTTCCAGCCCCTGCCTCTGGAGTGGAGGAGACACT
CACGACAGTTTCCATGCCCCCACCCCCGCGCCGGGCAGCTGCCAAGTCTCCCGATCTGTC
AAACCAGAACTCCGATCAAGCCAACGAGGAATGGGAGACTGCATCAGAGAGCAGTGACTT
TGCCAGTGAGCGCAGGGGGGACAAGGAGGCTCCCCCATCAGCATTGCTGGCCCCTAAAGC
TGTGGGAACTCCCGGGGGCAGTGGAGGCGGAACCGGACCAGGCATTTCAACCATGTCCCG
TGGAGATTTAAGCCAGAGAGCCAAGGATTTGAGCAAGAGGAGCTTCTCAAGTCAGCGGCC
TGGCATGGAAAGGCAGAACCGGCGCCCAGGCCCTGGCAGCAAGGCTGGCAGCGGTGGCAG
CAGCAGTGGAGGAGGTGGGGGACCTGGAGGGAGGACTGGCCCAGGGCGAGGAGACAAGAG
GAGCTGGCCCTCTCCCAAGAACCGAAGGTGGGTAGGGACAGGCTATTAAGTTTATTCTAA
GGTTAGACTGAGGGGGAAGGGAGAGAATCTGAAGGAAAGGGAAGTTGGGCACCATGGACT
TTGAGATCTAAGGGCACACGGGCTGCTGGGTGCTGGAACACCCACAGGTAGGGAAAATAG
TCGGAAAGCAGTTGATTGAGTCTGGAGTGTGTGTGTATTGTATGCATATTCTCTGTTCTT
TGCTCTCTATTCTGTAGACCCATGCCATACACCTAGAATTTGTTAGATGTGCTTAGAAAC
ACCTGGATTTTAATAGGGAGGTGGGAGAGGTTGAAAGACTTGACTGGTAGGGAAAGAGTT
AACAATTCCATGAATATTAGAGTTGATGCTCTGTTCTCTTCAGCAGACCTGAGGAGCGTC
CCCCAGGGCTTCCTCTGCCTCCCCCGCCTCCCAGCAGCTCGGCTGTCTTCCGCCTGGACC
AGGTTATCCACAGCAACCCTGCTGGCATCCAACAGGCTCTGGCCCAACTCAGCAGCCGCC
AAGGGAGTGCAGCTGCACCAGGGGGGCACCCAAGGCCCAAGCCTGGGCCTCCCCAAACCC
CCCAGGGCCCCTCCCCTCGGCCCCCAACTCGATATGACCCTCAGAGGGCCAACAACAGCG
TCGGTTCGGGTAAGCTGGAGGGGCTAAGGGTGGGAATGTCTCCATCCCCAGAAAAGGTCA
GGTGCTAAAGGGGGCAGAGTCTGCCCTGGGGACCTTGATGATGGGTGTCTGCACTGACCA
AAGGTGGAAGGCTTGGGAGGGGCTAACAGGAAAAACTAGGATCAGATGTAGACCAAGGCA
GATGCTGACGGATTTCCCCTTTTCCCCAGACCCCCACTTCGAGGAGCCAGGGCTGATGGT
GAGGGGGGTGGGCGGAACTCCCCGGGACTCTGCCGGGGTTAATCCCTTCCCCCCGAAACG
GCGGGAGCGGCCTCCCAGAAAACCGGAGCTGCTGCAGGAGGTGAGGGATGGAGCTTGAGA
TTGTGTTTCACTGCTCTTACTCCTGAAGGTTCTCACTTATGTTTTCTCCACTTTCTCCTG
TTCTGTCATTGCGTCCTTACCCCCAGATTCTCCGTTATTAGTCACTTCTTGTCTCCCTTT
TTGTCCCACACCTCATTCTGGCCCAGCCACTTCCACTCCCCAGTTCCCACCTCACTTATG
TTTTGTTTCTGGCCTTTCTCACCTTTAGGAATCTTTGCCGCAGTCTCATAGTTCTGGATT
TTTGGGCCCCAAGCCTGAGGGCCCAGGCCCTCAGGGAGAGTGCAGAGAGGCAGGGACAGA
GGCCCTGACTCCTCACATCTGGAACCGTTTACATACTGGTGAGTACAAGTGAGCAGTGGT
TGAAAAGGGCGATGTCAAAGAGCCAAGAGGGCAAGGTGGCCTCTGGACTGCCTCTCATCT
CTGCTGTCTGGTGTTCTACCCAGCCGCTAGCCGGAAGAGTTACCGGCCTGGCTCCATGGA
GCCCTGGATGGAACCCTTGAGCCCTTTTGAGGATGTTGCTGGAACAGAGGTAAGTGACGA
TGGGAAGGGAGTGTCTGAGCTGGGATTCTCTTGAGTACTGGTAGTGCTTCTCCACCTGGT
CTGGGTTGTCCAGGGCTATTTGCTCACATAATTTCTCCCTTTTCTTCGGTTTGTATTTTG
TAAACATTAGGTACTGACTGCTGACTTGACTTATTTTGATTTAACTTTTTTTCCACTCCT
CTCAGATGAGTCAGTCTGACAGTGGGGTGGACCTGAGTGGGGATTCTCAGGTGTCATCAG
GTCCCTGCAGCCAGCGAAGTTCCCCTGATGGAGGACTCAAGGGGGCAGCAGAGGGGCCTC
CCAAGCGGCCTGGAGACCCCTCACCCCTGAATGCTGTTCCTGGTGAGGGTTCACCTGGCT
CTGAATCCTCTGAACCTCCTAGGAGACGGCCACCTGCTCCCCTTGATGGGGACAGAAAGG
TAAAAGACCAAAAACAAGAGGAATGTTTCTGGGCCTCCGACTTTGGCCCTACATTTGTCG
TCTCCTCTGTGCTTCTGTGTTTTGGGGATTCTTTCATTTGGGAGATGTGACTTGACTTCC
TTTACTTCCCCAATGTAGGAGCTGCCCCGGGAGCAGCCTTTGCCCCCTGGCCCCATTGGC
ACAGAACGGTTGCAGCGTTCGGACCGAGGCCCAGAGCCCGGCTCCCTCCGGCCGTCCCAT
CGATCTGGGCCCCCGGTCCAGTTTGGCACCAGTGACCAGGTCTGCATGGGCAGGATCTGA
GTACCTTGGGTTGGGTGAAGAGGGGAAAATCTGGAGGTGGGATGTGGAGGATACAGGTCT
TGAGTCATGGGACAATCTCCCTTGCATCACTACCACAGGACTCGGACTTGCGCCTAGTGG
TAGGAGACAGTTTAAAAGCAGAGAAGGAGTTAGCATCAGTCACTGAGGTGAGTGGGAGAA
TGAGTTTGGTGGAAAGGCCTTCGGTTTTTGGAAAAAATGTCTGGGTGTGACCTGGAATCC
AGGAAGCCCAAACATTGCTTCTGACAAGGCTTTTTCCTCATAGGCCATCCCTGTATCCCG
AGATTGGGAGTTACTCCCCAGTGCTTCTGCCTCAGCTGAGCCACAATCCAAGAACCTGGG
TCCTGGGCACTGTGGCCCAGAGCCCAGTTCCTCAGGCCAGCGTTTGTACCCTGAGGTCTT
CTATGGCAGCCCTGGGCCTCCCAATTCTCAGGTAGGTCCTATTTCCTGTCCCATGACCCC
GTTCTGCCTGCTGCCCCTTAGTGTCTGTCTTTCTGATTTGTGTAGTTGTAAAATGCCATT
TTGTTATTTCATTTTTCTCCTTGGCTTTTACTGTAGTAGGTGGGGTGGGAGATCTTTTCT
TGACCAGAAAAATGAGCTATTCCAGCCTTGCTCTCCCTCAGGTCTCGGGGGGAGCCATAG
ACTCTCAGTTACATCCCAACAATGGAGGCTTCCGCCCTGGGACACCCTCACTTCACCCTT
ACAGGTGAGACTCAATGACTGTTGATCTCAGAAGGACACACAACTGTGTCTCAGTGGGAG
GGAAGGGGAAGACCTGTTTCTGGGGTATGAAACACTAGTAGACTTAACTTGGAACAAACG
ATTCTGGTTTCCTGACTCCTTCTCCCCACCTGACTTTTTCCCTCCCTCCAGATCACAGCC
CCTGTACCTCCCCCCGGGCCCAGCGCCCCCCTCGGCACTGCTTTCTGGGGTAGCTGTCAA
GGGCCAGTTTTTGGATTTCTCCGCACTGCAAGCAACAGAGCTGGGGAAGCTGCCAGCTGG
GGGAATCCTCTACCCTCCACCTTCCTTCCTCTACTCTCCAGCTTTCTGCCCCAGCCCTTT
GCCCGACCCACCCTTGCTTCAGGTGAGAGGTGGGCAGGTGCTGGGCTTCGGGAGTTAGGG
GTGGGGGAGAATGCTTTTGGGAGTTGACATTTCTCCCTGTTGTCTCCCAACAGGTGCGCC
AGGATCTGCCATCCCCCTCAGATTTTTATTCTACTCCTCTGCAACCTGGTGGCCAAAGTG
GGTTCCTCCCCTCAGGGGCCCCTGCCCAACAGGTACCTTTTGTTACTTGTCCCTCATTGT
TTCTCTACCCAATTTCTAGCTTTTTTGTCTGACTCTGTTTCTGGTTTTATGACCTTCCTT
CCTGCCCTTAATACCCTCCCCTCGACATTATTTCTTAACTACAGATGCTTCTACCCATGG
TGGACTCACAGCTGCCTGTGGTGAACTTTGGCTCCCTGCCACCAGCGCCACCTCCTGCCC
CACCGCCCCTTTCTCTGTTACCTGTGGGCCCTGCTCTGCAGCCCCCCAGCCTGGCTGTGC
GGCCCCCACCTGCTCCTGCTACTCGGGTGCTGCCTTCACCTGCCAGACCCTTCCCCCCTA
GCTTGGGGCGAGCCGAGGTAAGGTATAGGAACTGAAGTGCGAGGGAACTCCTAAGAGCTA
GGGGTAGGGATTCAGAATCTCCAGGTGAATTGGGTTGGGAGGCAGGAGGCTCATGAATTT
TTTTTCCTTCAGCTGCACCCAGTGGAACTAAAGCCCTTCCAGGATTATCGGAAACTGAGC
AGCAACCTTGGGGGACCTGGGTCGTCACGTACTCCCCCAGCTGGAAGGCAAGAGGAGGGA
GCGGGGATGCAGACTGCTCACCCTTAAGGGCTTTCTTACTAAGGGGCCAGGGAACAGGGG
TCAGCTTGCCTTAAAAACTTTTTCCTTTAGGTCATTCTCTGGCCTCAATTCCCGTCTCAA
GGCCCCACCATCTACCTATAGCGGAGTCTTCCGCACCCAGCGCATCGACCTCTACCAGCA
GGTGAAGGGGAGACCCCTGTGGCCCCAAGTCTGAATCCAAGAGTTACCATCTGAGTTCCT
GTCTTTTCCATCCCTGACTTCCCAGTATGACCTCTATGTACCTATATCCTAGGCCTCCCC
ACCGGATGCCCTGCGCTGGATGCCGAAGCCTTGGGAGCGGACAGGGCCACCTTCTCGAGA
GGGGCCTTCCCGACGGGCAGAGGAGCCTGGGTCTCGAGGGGACAAGGATCCTGGGTTGCC
CCCACCCCGCTGAGGGAGTTCCCCTTGCCCCCCACCCCCCGGGGCTTGTATATAGATTAT
AAATATATAAGGGGGAAAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATACTAGCTCTTCTCGTGCTTCCAGTTACAAAGCTATGGCTTGGATGAATAGGGTGTG
GAATCATAAGTCAGAATTCTCAGTTATATTCAACAGAGACTAATTTCGTAGAGACAGGTA
TAAACGATTTTTTCAATAAGGTATTAGCAGGGTTTCCTGGTTGGATCAGTCAGCAGAGCA
CTCAACTCTATTCCCTCCACCCCCCTCCCCTGGTCCCCTATCCCTGGGGCCGTTTGTTAA
AAAAGAGTAATAAAAGGATTAAAAAATTTTTCTGAAATGATTTTGGGGATGGGTTGGTTG
TTTGCAATCTTTTTGTACCATAGTACAGTCCCCAGTGAAGTGATTTTACAGAATTTACTT
ACCCCAGTGATCTGTTGTAACGAGCTATCTCAAAATTTGACCATTTTATTGTATATTGAA
GTCTTAGGGACTGGGAATTAGGGCTGGCTTCCACTGGGCAATCGGTTTCTTGTGCCAGTG
AGTGAGGTCTGTTGGTTACCAGTCTGCAGCTGACGGTTGGGCTGGTCACATAGGGCTACC
CTCAGGTGTCTGGGGCTTTGGTGGCACACCTGGAAGGTAGAATCCCACTGGACTGTCACT
AGGGACATCAGGCCAATTATGTCCTTGAGCTAGTGCTCAAAGAGGTCCTGGTGGCTGGTG
TAAAGTGTAGGACCTGGCCTTAGCAGGGCTCTTCTGCCACATCCAGTTGGTCCAGCACGG
AGCTAACAAACAGGGAGGGGACCACAACTGCATCTCAAAGGGAGTAGCAAAGGATTGGCA
TCCTTGTGTCATTTTGGTCCTGGCTATAAACTTGAGAGGACATGCCTTTAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1111, 8919..8998, 9377..9519, 9820..9908, 11022..11210, 11461..11740, 12159..12369, 12561..13179, 13183..14426, 14803..15068, 15269..15399, 15628..15757, 15863..15948, 16145..16378, 16518..16658, 16778..16846, 16963..17130, 17321..17403, 17571..17781, 17873..17971, 18104..18316, 18432..18526, 18630..18720, 18832..18972
1001..1111, 8919..8998, 9377..9519, 9820..9908, 11022..11210, 11461..11740, 12159..12369, 12561..13179, 13183..14426, 14803..15068, 15269..15399, 15628..15757, 15863..15948, 16145..16378, 16518..16658, 16778..16846, 16963..17130, 17321..17403, 17571..17781, 17873..17971, 18104..18316, 18432..18526, 18630..18720, 18832..18969
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved