Felis_catus Locus BAT1
snOPY snoRNA Orthological Gene Database
Felis_catus BAT1
Felis_catus
BAT1
GeneScaffold_4236
SNORD83
5344..5420
26453
AGGAGGAGCCGCCTTACGGGCCTGGTTGGACTTTTCTTACCTCGATTTACCAGCCTTTA
CTTGGAACATTTTCCAAATGTTTATGCGTGATGTCATTGTGTGTTTATAGGAAAGGAGTC
TCACCTGAAGAGTAACGAAGGGTGATGAGATCCCTTACTAGAGTTTGTAGTAGAGCTGGA
GTGAGAGTTTATCTCGAGTACCTTTTTTCCTATTAATTGTAGCAGAGGGAAGATAGTATT
CATCTCTGACCTAGTCATTTCTCTTACTCTACTCTTCTATCCCCCCCCCCCCCACATTAA
TTACACAGGGATTTCTTAAGCACCAGAAGGAGGTTACTGAGGAGTGGGACGCGGATGGCA
GCCAAATGATGTTTATATTTTGGGAAGTGAGCACTTTGCGCAATGATGACCTTAATCTAT
CACCCTTGACTGATGGCTGCCTTGTTAGGGGTCAACACTTTGAGATGTAGGGAAAGCAAA
AAGTCTTCCTTTGACGGTTTTTCAGGACTTGTCTTTATCTTGTCTCCATTCTCCACTCTC
TTGATTCATTTTGCTTTTCATTATCTATTTTCTTCACTGTTGTTACTTAACAGACCAGGA
GTTCATATGCTGGTTCTCCCCATCCTGCTTTCTGGTTTATGCTACTCTGATTCTAATCTC
TTTGGGAACTTGTGTCTTAACCGCCTCACCTGGGACCACTATATTATGTTTGCTTTTATG
TTTTGTGTTCTTGTTATTTTTCTTTCCAGATAAAGGTGTCAGTACAGGGAAAGTGGGAAA
AGTGTGGGGATGGAAAAGAGGTGGTGAAGGCTCTGCTCACGACTAATAAGTCTTTTGTTT
TTCTTGTTTGTTTTTTTCCTAGCTCTTCTATCAGAAACTACGTTTTTTGTTTGTTTGTGT
TTTTAAACTGTTGCTCAAGCCCCCACTCTGCTCCCTTGTTTCACTTACTCTGCGTGAACC
CTTCCGGAGACTCCTCCCCTTCTCCCCCTGCCGGCCCAGGAATGGCAGAGAACGATGTGG
ACAATGAGCTCTTGGACTATGAAGAAGATGAGGTGGAGACAGCAGCAGGGGGAGACGGGG
CTGAGGCCCCTGCCAAGAAGGATGTCAAGGGCTCCTATGTCTCCATTCACAGCTCTGGCT
TTCGTGACTTCCTACTGAAGCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGCTTTGAGC
ATCCGTCAGAAGGTAAATTTTCTATTGGGCCTAGAGTATTCATTAGGTTCTTTAAGGGAA
CAAGAAACAGGTGTGTAAAACAGTTCCTCAGATAATACATATTTATTTAGGGTATATCAG
GAAATAAAGTATCAAGAACTATTTTAGCAGTAGGAAAGATTTGTATAGATTGGTTTTTCA
TTCATGGTAACATGAAAAAGCTAGTGACCTAAAAACAGCTGCTGCTGTTAGTTGTTGTGA
CTGGCTTTTCTCTTTGCCTACTTTTTTCTTTTAAGTTTATTTATTTTGAGAGACTGAGCG
GGGGAGGGACAAAGAGCGAGGGGGAGAGAATTTCTCCAAGTTGTCAGTGCAGAGCCCAAT
GTGGGGCTTGATCCCATGAGATCTCATGAACCGTGAGATCACAACCTGAGCCAAAACCAA
GTCGGATGCTTAACGACTGAGCCACACAGGTGTCCGTTTGTCTACTTGTTTTTAATTTTG
TTACCTAGGCTTCTAATTTTGAATTTCCAGAGAGGAGCTGGTTGGACCTTTAGTCTCTAT
TGGGCCAGGCCAACTATGGTCTCTGGAAACCTTTGTGGCTGATCTAAAATGAGTTGCTTT
TGGGTCAGCTACCACACCCTTCATTTGTGACCAGGGTTACATGGCCTAAAGATGGTAAGC
TAAGTAGGAGAAACGGCCTGGGGCAGGCACTCAGATGTCATGGATTGTTACAGATTAAGG
GAAATAGGGACAGAGCCAGGAGCACCAAAGGTGAAGTCTTGGTGGGTGGAAGAGGCCAGG
CACTGGAGTTGGAGGAGGCCAAAGCCAGGAGGAACTAGGAAGGTCTGCTTTTGGGATGAA
TTTGATGGAGGGAGCAGAGAGGTAGAAAGGGCCTGGAAGTTGATGAGAACCATTTAAGAA
TTGAGTGGTGAGAAATGGGTTTGGAATGGTGAAAAAGGTTGTGGAGTTACTGAAGACTGA
AGTGTAATTTATCTCTCCCCCCATCCCTCCTTCTAGTCCAGCATGAGTGCATCCCTCAGG
CCATTTTGGGAATGGATGTTCTATGCCAGGCCAAGTCAGGCATGGGAAAGACAGCAGTGT
TTGTGCTGGCCACACTGCAACAGCTGGAGCCGGTTACTGGACAGGTATGTTTGGGGAAAG
TGCTGTGGAAGACATTTTGGTTAGGAATTTTTGAGAAGGGTGTTTTGCCTCAGCCACAAG
CTGCAATCAGAGCCACGGGTGTTTGTTGCAAAGATGACCTCGGTTACCTTTTTCTGATGG
CCATGTGGGATATTGCATAGAAATTATGTGGTTAATGACTTAGATCTCAGAATTGAGGTC
ATTTATAATCTGTTAAATGTATTTTTGTGACCATCACTTCCCTGAGGAGATAGTAAAGGG
ATATACTGTTTGTCTCTGTCTGCTCTCCCCACCCCAAGGTGTCTGTGCTGGTGATGTGTC
ATACTCGGGAGTTGGCTTTTCAGATCAGCAAGGAGTATGAGCGCTTTTCTAAATACATGC
CCAATGTCAAGGTAAGCCAGGGTAAAGACACCTGGGAGGATGAGGGTGGGGGGAGTTGTA
GGCATTGAAGACTTGTAGGTCAGCCGTCTTCATGTCCATAGATGTTAAATTATCTTTATA
TGAATGTCATTTGCACGTTCTAGGTGGTAAGTTTCTGCAAACTTTGGTATGCAAGGGATT
TACAGTTACGGTTCATTTGAGTGCACATTATAATTTCTGAGATGTTTGCTTTCCTCTAAT
TTTGGAGAATCTTTAGTTTGCTTTAGTTTTTAACAGATTGGATATAGCTGTGCAGCAGGA
GACTGCATGGTTAGGCTATGAAGGGTGCTCACCATGAGATCTCACTTTTGTTTATTATTT
CTTTACACTGACTTTGAATGATTTCACTGTGCTTTGGTTGAGTTTGAGAATTTTGGGGTG
TGTGGCAAGAGAAGCTGGAAGCTCCAAAACATCTCTAGTGTGGTGTGTGAATTTAGAGGA
TTCCTGAAAGTGGCAGAAAATTGAAAGATGTTTGGTGGCCACAACAGAGTAGGCTTGGGT
TGTTTTCTGTATATAACCTTGGTTTTTATAGTGTGGTTTCCAAACCCAAAGTTTCAGCAT
CATTTGGAAGCTTGATGGCAATGCAGATTATATGGGTACCACCCCAGACCTACTGAGTAT
GAATATGTATTCAAATAAGATCTCCAGGTAATTGGAGTTTGAGAAGCAATGATCTGTATA
ACTTTCTACCCCTCTGGCTAGGATGTGGTAAAGAATAGTACTTCTGTTTGGGTTGTTGTG
ATTTTCTCCTGTTACTCATTGTTTTATGTTTTAAAGTAACTAGGAATGTTGAGTCCTAGT
GCTAAACTAAAATTAATTTCTTAAAAACCAAAGTAATAATGATCAGTATCTCGTGGTAAC
ATGTTTTGAGTAAACTAAAAGGTTTCATAACAAAAAGATTTGTATTTTCCCGTCTCTAAT
TGCACTTTATGGAAGGTAATCACTAGTTAACCTTTATTTTTTTTAATTTTTTTATTTTTT
TGCTTTTTTCCCTAATGGTTCTGTGACACCAGGTATAGGCACTGTTCTCTCAGTTTATCA
AACTTCAGGTGTTTATGATTTTTTTTCATGAGAGATGTTTGTTCGTGTTGTTTTGTTATT
TGAAAATTTTAATCCTTTAAAAGTAATCTAAATGTTATATATGTGTGTGAAGTAATCTCT
CTCTTCTTAAATTGTCAGCGTCATTGACATTCACTTTCTGTCCTTTAACTGGAGTGGTCT
TGCTGCTGGTTGATTCTAAAAAGTTGAAAACCAGAAAAACGGTTTCCATTGTTATGGCTG
GAAACATGCATTGTTGGGCTTATTAGTGAGCTAGAATTGTACTTCCTCCTCTATAGGTCC
AGCTCATCAGCTCATGTGGCTCAAAAGAGAACCTTTTTTTTTTTTAAGTTTATTTCAGTA
ATCTCTAACCCAACGTGGGGCTGAAACTCATGACTCCAAAATTGAGTTGCATGTTCTTCT
GACTCAGCCAACCAGGGGCCCCAAAAGAGAATATTCTTGGTGTTAAGATCAACTGCAAAT
TGTCATGACATAATTCTTACTTTTGTTTAAAATTGTGCTAAAGTGATTCGTTCAAAAGGT
TGGGTTAGTTCTATACAATATCCTGTCTCTGGATTTGTCTGGTTACTCCCTTACGTGGTT
CTTTAACTTGTTTTTTCCCCTTAGTGTTTCCTTTAACTGAAATACGAATTTGAAAGCTCA
ACTGACTGAAGTTAAACATTTTTGGCAAGAATTCTTCATAGTTGATATTTTGTGTACCTC
CTGTTTTGTTGCAAACTTGGTTGTTCCGTAATGAGTGATTTTAGTTTCATTGTGACAGTC
TGGTCCTGTACTTGATCTTCTCTCCTTGAAACTAGAAAGCAGTTTCTGGTGTCATGTGAT
CCTATAGTAAAGACTAGATCCTCAGCAGATCTTTTCTTAATGTTTATAACATGGAGTAAT
GTGGTCAGCTTGAAACCGTAATTTCATAGGGTTTGTGAAGGGGCATTTAAAAATCTGAGT
TCGGTTAGGAAAAATTGATGTTCATGAGCTTTTTGTGGTGCTTTGCACTCTGGTGATTTC
TTGCTGTCCTTTCTTACAATAAAGTGTGGCCATAGCATCATGGGAAGGAAGATTGTTAGA
TTAAGTCAGAAGAAAGTGCTAGTCCTGACTTCCTTGATTAGCCACATAACTCTGGGCAAG
TTACTTATGTTTCTTAGCTTTAGCGTTTGGGGAATGTAATAAGAATTTTAGGTCATGTGG
TCTTTGATGTTCGTTTTACCTTTGAAATACTCAAAGTTCACTTAGATTAAACTGAAAGGA
TGGGAAGTGCGGGGAGATTGGACTGTTTCCTCCCTTGTGAGACACTGTTTTTTTCTGGGT
TAATACAGGTCGCGGTGTTTTTTGGTGGTCTGTCTATCAAGAAGGATGAAGAGGTGCTGA
AGAAGAACTGCCCGCATATCGTCGTGGGGACCCCTGGCCGCATCCTAGCCCTGGCTCGAA
ATAAGAGCCTCAATCTCAAACACATTAAACACTTTATCTTGGATGAGTGTGATAAGATGC
TTGAACAGCTCGGTGAGTGGCAGTGCTGGCAAGGGGGCTGGTGATCAGGGAGTTGCCCTT
TAGAGCCAAATGATGTTTTTTTGATTCAGGAGCACTTTAGTGCTGGGACGACTCTTCATC
TATCACCCATGACTGATGGCTCTGGCTCCCCTGTCGATTTTTGTGAGGCCTTTTAAGGAA
CTTGGGTGAGCAAGGAGAAGTGTGTTTTGTCCTGTGATAGAGGTTTTGTTTCTTTGAGAG
GAGTGACTTTGCTGATCTTAGACATTGCTCACACCACTATTCTCTCCTTTACAGATTCTT
ATACTGGGTGTCAGGGGTGGGGTAATAAACTGAAGGAAGAAGCCATTTACTCTCTGGCAT
TCTCTGCACAGCATCTATCAGTTTATAGCTGAGTAAATCTTTAGACCTAAGTTCTAGGAT
TAACGTGGAGAGTTTATGGGGTTTTTCTGTATTTCAGTGTGTCCCGTGCGGTTAAGAAAG
GAAAATTGTGAGAACTCACATTTAATAAATGAGAGCGTTGGGATGGACGTGGCCCCAGGG
ACAAGTCATTCCAAATGATTGACTCCTAAAAAAATTTTTTTTTTAATGTTTAATTTTGAG
AGAGAGACAGAGCAGGAGTTGTGGAGGGGCAAAGAGAGACAGTAGCTGAAGCAGGCTCCA
GGCTCTGAGCTGTCAGCACAGAGCCCGATGCGGGGCTCAAACCCGCAAACTGAGATCATG
ACCTGAGCCACCCAGGTGCCCCTGATCTTTGACTATTTTAACGTGAGCTCTAAGATGGGC
TCCAGGTAGAGATGTCTTGTTTGCCTGGCTGGATAGGAAAGCATGATCCAGAGGAGCCAC
GAAATGGACTCTGACAACTGGAATGTAATTTGGTGCACAATATTTGTAGACAGCAGGGGT
GTGGGGAGAAAGTATGGACAAGGGCCTTGTAAAGAATTTCTCAAGGGTCTTATGCTTGTA
AGTTTATGCTTATGCTTATACTCAAGAGCCTCTGCAGTGGGCCTTATCTCCATATCATAA
TTGTGAGCTTTGGGGTTTTTTCGTCTCATTTCTTGTCTGGTTAAAACAGCTGGAATCCGA
TCCCAAGTCTTTATTTCAGATTCCACTGTGTGCTGTTTCTATTGTGTTATTACAATGGAT
GTGATTTTATGGTGGTCGGAATAAATGGAGACCTGAGACACATCTTACTGTGAAATGACT
GTTCCTTACCCATTTCCAGCAGCCATCACCTCATTGGGCTGTCTCTGGTCTTTGTCTATG
ATGTATGCTACTTGTCTTACAGTCTTCTTCCTTTTTCTCGTAGACATGCGTCGGGATGTC
CAGGAAATTTTTCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTG
AGCAAAGAGATCCGTCCAGTCTGCCGCAAGTTCATGCAAGACGTAAATACCCTTCTACCT
TCTCTCCCTCCACTCCCCGCCCACTGCCTCCTCCCCTTCCGCGCCCTCTTCCTCCAGACT
CCCTTGTCCTTCAAGTGCCAAGAAGGGGGCACGTGCCCATCTGGGAGTGATGACTCCTTG
AAGAGACACATAGAGGCAGAGACAGCTAGTGTTAGGGTCTGCGCGGGCGCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAATGAGAGCGTTGGGATGGACGTGGCCCCAGGGACAAGTCATTCC
AAATGATTGACTCCTAAAAAAATTTTTTTTTTAATGTTTAATTTTGAGAGAGAGACAGAG
CAGGAGTTGTGGAGGGGCAAAGAGAGACAGTAGCTGAAGCAGGCTCCAGGCTCTGAGCTG
TCAGCACAGAGCCCGATGCGGGGCTCAAACCCGCAAACTGAGATCATGACCTGAGCCACC
CAGGTGCCCCTGATCTTTGACTATTTTAACGTGAGCTCTAAGATGGGCTCCAGGTAGAGA
TGTCTTGTTTGCCTGGCTGGATAGGAAAGCATGATCCAGAGGAGCCACGAAATGGACTCT
GACAACTGGAATGTAATTTGGTGCACAATATTTGTAGACAGCAGGGGTGTGGGGAGAAAG
TATGGACAAGGGCCTTGTAAAGAATTTCTCAAGGGTCTTATGCTTGTAAGTTTATGCTTA
TGCTTATACTCAAGAGCCTCTGCAGTGGGCCTTATCTCCATATCATAATTGTGAGCTTTG
GGGTTTTTTCGTCTCATTTCTTGTCTGGTTAAAACAGCTGGAATCCGATCCCAAGTCTTT
ATTTCAGATTCCACTGTGTGCTGTTTCTATTGTGTTATTACAATGGATGTGATTTTATGG
TGGTCGGAATAAATGGAGACCTGAGACACATCTTACTGTGAAATGACTGTTCCTTACCCA
TTTCCAGCAGCCATCACCTCATTGGGCTGTCTCTGGTCTTTGTCTATGATGTATGCTACT
TGTCTTACAGTCTTCTTCCTTTTTCTCGTAGACATGCGTCGGGATGTCCAGGAAATTTTT
CGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATC
CGTCCAGTCTGCCGCAAGTTCATGCAAGACGTAAATACCCTTCTACCTTCTCTCCCTCCA
CTCCCCGCCCACTGCCTCCTCCCCTTCCGCGCCCTCTTCCTCCAGACTCCCTTGTCCTTC
AAGTGCCAAGAAGGGGGCACGTGCCCATCTGGGAGTGATGACTCCTTGAAGAGACACATA
GAGGCAGAGACAGCTAGTGTTAGGGTCTGCGCGGGCGCCAGGGAAACTCCGGAAGACTTG
GTCGGGTTAACTTGAGAGCGGGTAGTGTTCGACCTTTTTTTTTCATCACAGCATTTTTGA
ACCTCTTCTTCCTTTTTGGGGGGAGGGCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGA
ATTTTCTGCCCTACCACCCACCCATCGTCTCCTATACACCCCTTTACAGCCACGCACCCT
CAAGGTGGCATCGAGCACACAGTTGGAGCCTTCTGCTCCTCAAAACTCATAACCTCCCGG
TGGCAGGAGAGCAAGAGAGGGACAGACAGATGGCAGGGCATGTCCAAAAGAAGAGCAAAC
AGCACAAATGAATCCGCTCCCTCCCCGCCTCCAGGGGTGGGGGCCTCTGGCACCTCAGTC
CCCGATCCCTTACTCCTTACCATCCATACCTCCTCGCACCCATCCGGAAGCTCGGTTGAT
GTGAGCCGGCAGCGGAGAAGCACCGTGGAGCGGCGGGGGAAATGCAGACGGCACCAGCGG
TGGATGGCGGCAGCGGAGGCCGCGGGGAAACCTGACCAGGAAGCCGAGGACCAAACCAGC
CTCTTTTTCCGTTCCCGGTTTTTTTCCTGAATCCAAGGCGTGCCGTGCTCCCCGTTTCCC
CCCATATGTGTTGGGGGGAGGGGTGTCCTGAAAGGGGGGGTAGATTTTTTTTTTTTCTTT
TTTAAGACATTTTTTTTTTTTTAATACTCAAAGGAGAGGGATGTGGGAAAGGTAAAGTGA
GGAGCTCCACTTGGAAGTAACCAGGTGGGTGTTAGGGTTTGGGGCTAGACGGGGCCTGTC
GTATAAGTAGTGCAGTGTGTTCTTTTCCCATCCTGTACTGCTCCGCCCCATGGGATGTTT
GCTATTTTTAGCTATACGTGGGGCTAGAATTAGATTTGAAGGAGGTCATGGAACTTCTTT
TTGGAAAGCCTGCCTTTGCTATCCTGCTAGCTTTCTGGGATTGGGCTTTTGGTTTTCTCC
CGTGGCACACATCCTTTCCTAAAATCTTGGACCCTGGGTGTTCATGTTAATTATGTCCCC
AGGTTAGTAAAGAGTGCTAGGAAAGTTGGGCTCTAGAGTGGAGTCTTGTGTCAATTTGTG
TTTTTATTTTTTTATGCTACCTTCCTCCCCTTCAAGGGTTTTGTGCGTGTGTGTGTGTGT
GTGTGTGTATTTTTTTTTTAAGATGAGTGTATATCTACTGCTCTGAATTTGTTTCTTAGC
ACCATCCGTTGGTACCTTCCACGTAACACTATAGTTGGTTTGGCTCTTAGTTCAGAGACC
AATGTTCTGTTCCCTTTGTTCCCTTGTGGTCTGAGGGCAAGTTGTTACTCGCCTTGAGTA
ACGTTTGCTTCTCTTTTTATGGCATTTTGACTGTCCATTGTAGTATTCTGATCTTAACNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTCCCCCCTCCCCCCCAGC
CAATGGAGATCTTCGTGGATGATGAGACGAAGCTGACGCTGCATGGGTTGCAGCAGTACT
ACGTGAAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGACCTTCTCGATGTCCTTG
AGTTCAATCAGGTCAGTTGTTTAAGGTCCAGTAGAGGGATGAGCACGTCTCCAACTGTAG
CAGAAACCTGGTTAAGTACCCTTTAATTGAGGATATGACCCATGCGATGTGAGAGAGAAT
GGTGGAGAAATTGTCTTTAAATGAAATTCTCTTAAGTGAGAATTCAGATGTCTTCTGGGG
CTGAGCATGAACAAGGTGTGAGCAGCTGCTTTCCTGTTCCATGGCTGTCACAGCCGGGTA
TTTAGTAAATAAAAATCTCAATGAAGAAAATCCTTGAGGGGGTTTAATCTTGTAAAAGTT
CCAAAATATCTTAGGTTTGTTGGGTTCTTAAATTTGTTTCTTGTGTTATTTACCGAGAAG
AAGCATTTCATCACTTTACCTGTTGTGTAGTTTATCTGCACCAAAAACTTTCTAAAATTA
AGGTAGAATTCTTATGTTGGATGTTCTTGATGAGCAGGAAATATTGGTCCTGGTCTTTCC
AGACTTTAGTTTTGATTTTTACCACTTTCTCATGAGGTTGCCTCATTCTTGTCTCTCAAC
ACACCTGGTAGTTTTGGTTATTTTCTGTACTTTCTCTGCAGCATGTCTGCTTAGGAGACG
TCAAGAGCTGAGTGACAAAGGCTAAGTTGTATTTAGATCAGAAGAGGAATATATGGGAGG
GACTAGGAGGAATTCCTTTAGAAAAGCATAGTTACTGAAAACATTCCTTGCACGTACGTA
ATCTCTCTAACATTCCACATGGGCCCACATCCCCCTACTCTCCACACACAGGTGGTGATC
TTTGTGAAGTCTGTGCAGCGTTGCATTGCCCTGGCCCAGCTTCTAGTGGAGCAGAACTTC
CCAGCCATTGCCATCCACCGAGGGATGCCCCAGGAGGAGAGGTGAGTCAGAGATGGAAAG
ATGTTTTGTGTCTTTGGGAAGGAAAAGAGACCATTGAGAGAAAGGACTCAACATTTTTCT
AATTTCCTTTCTCACAAAGGCTTTCTCGGTATCAGCAGTTTAAAGATTTTCAACGACGAA
TTCTTGTGGCCACCAACCTATTTGGCCGAGGCATGGACATTGAACGGGTGAACATTGCCT
TCAACTATGACATGCCTGAGGATTCTGACACCTACCTGCATCGGGTAAGCTGCACGCCCA
CACGGACATCCCAGTGTCCCCTCCCACCTCCTGATTTCCTATGTCTTTATACCGTATGTT
CTCATCCCTCCTTTTGGGTGTCTTCCTACTTTTGGGTCTTCCCAGTGCCACCCTCTGTCT
CCTTCCAGGTGGCCCGAGCAGGCCGGTTTGGCACCAAGGGCTTGGCCATCACGTTTGTGT
CAGATGAAAACGATGCCAAGATCCTCAATGATGTGCAGGATCGCTTTGAAGTCAATATTA
GTGAGCTGCCTGATGAGATAGACATTTCCTCCTACAGTGAGTATTGATCTCATGAGACTG
GCTCTTCAGTCTCCTTGTTCTTAGTGTGTTTGTCTTAAATCCCATTTACGTAAATAAGGT
CTCTGGTGCATAACAGGCACTCGACAAGTTCATGTCCCCTGATCTTGATGCCCTTGTTGG
GATGTGTAGTTGTCCTCTGTGTGGGGTCTTTTTCTCATGACAGATTATTTCTGTCCCCAC
TTCCAGTGTGTCCTCTGCACCCACAAACTACACAGACATCTGCATGTAATGGGGGGTGTT
TCTGCCAGCCTCGCCATTTCCATGTCCTATTCCTAATTGTGCCATGTTCTCTCTTCAGTG
AACAGACGCGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAGAGTCATGAGAGTGAGGATTGGCAGTCCCTTCACTCCTCCCTCCCGCCCCCAACTAA
GAAATGATTAACTGTTAGGTGAGGGGAAATTCCTGTTCAAGGACTTCATGGACTCTGCAA
GGAGAGAGCTCTGTGGGGAGAGGGAGCCCTGAGGTCTAGAGTGGGGTGGGGGTGGGGAAG
GTGCTGGGGATCTGGGGATGGGAAGTAGGACACAAACTTGGGGGGGGGGTGGCATCTACT
TGCAGGACTGTGACAAAAAGGGATTCCTTCATGCCAGTCTCCCCCCTGGTATCCCCACTC
TTGGTGCTACTTACCCTTGGCGGTGACCTCATCTTCTCACTGCATGTGGAGCTGGTCTGC
TCTTTTGTGCTTGCCTTAGGGCTCTGGGAGCAGCACCTCCAGGAACCCTGGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 2196..2323, 2618..2710, 5108..5291, 20251..20369, 23579..23710, 24471..24580, 24679..24823, 24968..25114, 25439..25453
1001..1211, 2196..2323, 2618..2710, 5108..5291, 20251..20369, 23579..23710, 24471..24580, 24679..24823, 24968..25114, 25439..25450
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved