Felis_catus Locus SRCAP
snOPY snoRNA Orthological Gene Database
Felis_catus SRCAP
Felis_catus
SRCAP
GeneScaffold_72
SNORA30
5127..5255
56233
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGTGGGTGTTTGAGACAGT
TACCAGCTCCTCTCTCCTTCCCTTCCCACCTTCCTGGTAAAGGAAACTCCCAAGATTGAT
GAGGAACCCACAGAGGTTTAGGTGATCTTCGTTTTTGTTTTCTAAATGTTTATTCATTTT
TGAGAAAGCGTGAGCAGAAGAGGGGCAGAGAGAGAGAGAGAGACAGAGAGACAGAGAGAC
AGGATCCAGAGTGGGCTCTGTGCTGACAGCAGCAAGCCTGATGTGGGGCTTGAACTCATA
CGAGATCATGACCTGAGCTGAAGTTGGACGCTCAACCAACTGAGCCACCCAGGCGCCCCT
GTTGTTGCTTTTTGAACATGGTGATAACTTAAATTTATTTTAATAGGTGAATCTGCCACA
CTTGCTGTGTAAATGAGGGAAGAATAGAGAGTTGTTTATGTGAGTGAAATCACTGAGGCT
CTGAAAGGATCATTAGCGTTTGAAGTTATATGCTGTAATATTATTCTTGAATTTGGGAAC
TGTGTAAATGTCAGGCTCTAACTCCTCTCGCATGCCAAGTATCTGTGAACTTGGCTCTGT
TATCTTTAACATTTTATGAAAAGATCGTCCCAAATATTTGTGTTTATGAAAATGAGGTTG
ATAATTTACTTCGTAGTTTTTTCTTGTGAAGATAGAATGAAATAATATGCTTAGAACTTC
TGGCACAGTGCTAAGCATTCATTTTATTTATGTTTTTCTAGATGGTGTCGGACGGCATGA
CAGGCAGCAATCCTGTGTCCCCTGCCTCATCCAGTTCCCCAGCCTCTAGTGGGGCAGGTG
GCATCTCTCCCCAGCATATAGCTCAAGATTCCTCTCTGGATGGACCTCCAGGGCCCCCAG
ATGGTGCCACAGTGCCCTTGGAGGGACTCAGCTTACCCCAGGCTGCTGACCTTGCTAACA
AAGGCCCAAAGTGGGAGAAGAGCCATGCTGAGATTGCAGAGCAGGCCAAGCATGTATGTA
TTGGAAATGCCTATGAGAGTTTTTGGGAGTCTTCCTTCTTTAACTCCTCTGTCCCATGGG
CCCTTTACATTTCTTTCCTTGTGGATTTAGAGTATAGGGTTTGCCTTAACTTACATGATC
TTGAGCAAGTTGTTTGATCTGAACCTAATTTCCTTTTCTATAAAGTAAACATCATGTAAT
AGTTCATGGACTTACGAGGTCTGTGTTAAAGGAGAAAATACACATAGAAGTGCTATGTCA
AATACAAAGCTCTGAACATTTGCTGGTTTCTGCTTCTCATTTCTGTCCTCTAGCCCCTAT
TATTTACCCAGCAATAAGTGTAGTCTCTGAACCAGCAGCATCAGCATCACTTGGGAAATT
AGAGATGCAAGTTTCTTGGTACCTCTCTTCTACCTATCCATTTAAAGCTTGAGGGGTAGG
CTCCAGCAATCTGACTTAAAAAGCACCCCAGATGATTTTGATGCATGCTTAAATTTGAGA
GCCATTGGTCTAATACCCAGGTCTTTCTTAATGTTTCCTTCACTGTCAGGCCATTTAGTT
CCCTGTCTCGTTTCTGGCTGTAATTTCCTCTGATTTAGTTTTTGTCAGGAGAGGCCAAGC
ATAATAAAGGCAATTGTCTTGAGTTTTTTAAGTCACTTCTGTTAAATAAAAAAAGTTTCA
AGTGCTTTCATCGTTTTGCTTATGAAATTTAACCATTATAGAAAGTTAATTTTTTTTAAT
CACAAAAACTGTTGTTAATCTTTTAGTATTTTCACAAAAAAGTGTACATTGTTATAAAAG
TATTTTTCAAAAACAAACAGGATTGTGTATGTGGGGCTTTGTAACCTATTTCTAAGCATG
AACATACTCTTGGGCAAGCAGATTTCTACAGTGATGAAGATCCTTTCTATCTAGTCTGTA
AGGAAGCATATACTCCTTGCTTCTCTGGAGGCTCCCCATGGATTTCATTTTTCTAAGTCT
TTCCAATATTCAATTTTTTTTTTTTAATGTTCAGTTTTATTTTTGAGAGTGAGCAGGGCA
GGGGCAGAGAGAGAGGGAGACAGAATCAGAAGCAGGCTTCAGATTCCCAGCTGTCAGCAC
AGAGCCTGATGGGGGGCTTGAATTCACAAACCACGAGATCATGACCTGGGCTAAAGTTGG
ACGCTTAACCGACGGAGTCACCCAGGTGCCCCATGTCTTTCCTATATTCATGGGGTGTGG
AGATTGAGTGAAATAATGGAAAGAATATGAATTCTGGTGTCTAGAGTCATTAGATGTATT
TTGAATTCCCAGCTCTTACCACTTTCTGGTTGTGTGATCTCAAGTAAATTGCTTAATCTC
TTTGATTTTTTTTTTTTTAATTCACCTGTGAAGATTGTAATACCTACCTTGTAGTATTGG
TATGTGTACTTAAGACAGACATAAAACACTCAGTTCAGACCGTGCCTGTACGTAATCAGT
GCCCAGGAATTCACCTATGTTCCTGAGGTGGACTTTATGTCCAGTAACTTGATTGACCTA
GCTCTTCCTCATTAGGAGGCTGAGATTGAGACTCGGATTGCTGAGCTGCGGAAGGAGGGT
TTCTGGTCACTGAAGAGGCTGCCTAAAGTGCCCGAGCCTCCCCGCCCCAAAGGCCACTGG
GACTATCTGTGTGAGGAGATGCAATGGCTCTCTGCTGACTTTGCTCAGGAGCGTCGTTGG
AAACGGGGTGTGGCCCGTAAGGTATGTCCTCAACTGAGCCTACCTTCCATATTTTTTTTC
TAGGTTTCCTTTTCCTTTATACGTGGGTTTGTTGGAAGGCAACCAAACAGAACAGTGTAG
GGTGCATGTTAATGTCCATAGTCTCAAGAGGCAAGCTCTGACTTCCCAAATGTCTTGGAC
TTGATTTTTGTTTTTGTTCTTGACATGAGGAGGGGATAGGAGACTGGCCTTGGAGTTTTC
ACTCTGGTTCCTCATTCCCACAGGTTGTGCGCATGGTCATCCGGCACCACGAGGAACAGC
GGCAGAAAGAAGAGCGGGCTCGGAGGGAAGAGCAGGCCAAGCTACGCCGAATCGCCTCCA
CCATGGCCAAGGACGTCAGGCAGTTCTGGAGCAATGTGGAGAAGGTCGGCAGCAGGGATT
GGGAAAGGGAAATGCCTTAGGTGTCCTAGGTGGGTAGCATGGTAGCAGGAATGGTCGAAA
CTTCTCCTTGAGAGAGTGAATATTCTAATTTCAAGCAACTCTAATGACATTTCTGGTTTG
TATTGGATGTCTCTAGTGTTGAGTGCCAAGAAGAAAGACAGTGGAAAAATATGGCCCTGC
CTTTGGGGAATATTAATAGGACTTTTTGATCCCTCTAGGCCATCTGTCCTTTGCAGGGCA
TTCAGCATGCTTTTTCTAAACCTCTGCTATTTACCTGCTTAAATGTTTACATCAAAGTTC
TCAAATTGTTCTTATATATTGTTTGTTGTTTCTCAAGTACTACCGGGTTTCTTTCTGTAT
TTTAGTTTTGTTTCCTGCCAGCTCCTTAACTTCTCTTTTCCACTTCAATTGTTCTTTTGT
TTTGTACATTTCTGGTAATTTACCTATGGTCTTTTTGCTGCCAAGCAATGCCTTTCTTTT
AATTTCCACTTAGGGAACACGTACTTAGTCTTTAAGATTCAGCTCCAGATACACTTGTAA
ATCTTCCCTGCTGCCTGAAGTTAAACTGGTTCTTCTCTTTCTTGTGCTCCCTTTGTGCTT
TCGTCAAAAGCACCTTTAGGGTCATTTAACTCTTCCCTCTTGGAAAGCCAGCTCAGGGCC
TAGCATAGAGGAGGCTTCCCTAAATATTGTATAAAAGAATACACGAATATTTTAGTGACC
GTCCATTTCATGCTGTGGCAGGTGGTGCAATTCAAGCAACAGTCCCGGTTGGAGGAAAAA
CGTAAAAAAGCTCTGGACCTGCACCTGGACTTCATTGTGGGGCAAACTGAAAAGTACTCA
GACCTTTTGTCTCAGAGCCTCAACCAGCCACTAGCATCCAGCAAAGCTGGCTCTTCCCCT
TGCCTTGGCTCTTCCTCAGCTGCCTCTAGTCCTCCACCCCCGGTTTCCAGGCTGGATGAT
GAAGGTGTGTGTCCTCTTTGGCTCTGTTACTCTTCCTCATGTACCCTTTCCAGAGCTGAA
AACCCACCCTGTGGCTTGCAGGGCCCCGTGGACTTTGTGACCTTGTTCTCCTGCTATAGA
TGGGGACTTCCAACCCCAAGAGGAGGAGGAAGAGGATGATGAGGAGACGATTGAGGTTGA
AGAACAACAGGAAGGCAATGATGCAGAGACCCAGAGGCGTGAGATTGAGCTGCTTCGACG
TGAGGGAGAATTGCCATTGGAAGAGCTGCTCCGTTCCCTTCCCCCTCAGCTGCTAGGAGG
GCCTTCCAGCCCCTCGAGAACCCCCTCATCTCGTGACAGTGACACTCGAGATGGGCCTGA
AGAAGGTGGTGAAGAAGAAGAGCCCTCTCAAGTGTTAAAGGTATAGGGAGAATGGGTAGA
GGAAGGGCTCAGAGTGGGAGCAGAGGTAGAGGTTCAAGGACTGAGTTCTGGTCTGTAAGA
TCATTTGTGGTTTTCAGGAGTCCTCCCTGGTTAAGGGCGATTGGCGCTCATTTGGGGATG
GATATGGAAGAGTCTGGGTTTGGGGCAAGTTGTATTTTGAGATGGGCATTTCCTAATGCT
GTAATGGAAGAGTATACTGTACTCTTTAATTGCCTCACGGTCTTGAAAATATAACTCTGG
TTCTTGCCACTTCTGTGAAATGGTCCTAATACTCCCTATTGGTTTGTAGGTTTGGACCTG
GGATGATAATCTTGAAGTCTTTTCTGGACCTAAGCTCTCTCTTTCTCCATATGTGTGAGC
GCATGGGGATGGTGTTGGGGGCCTTATCTAGCACTTTCACAGGTCCTCCCCCAGGCAGTG
GGGCCAGGATTTGGTAGCTGGTGCTGAAAGAAAACCCTTGATTGCATCTTTGCCCTGGGA
CTGTGCCAGTGGCAGCTGTCACTCAGTGGGACAGAGAGACTGTTCTGTGATATCATGTTC
AACATTGTACCTTTCTCCTGCTGCTCTAACCTTAGGTCTTCCTCCTTTTTATCTTTTGCC
ATACAGGTGAAGCCCTCACCCTCTGTCACACAGCGCAACAAACAGCCCTGGCATCCAGAT
GAGGATGACGAAGAGTTTACTGCCAATGAGGATGAAGGTCAGGCTTGTTCTCTTTGTCCT
GTTGCCCTTTACTCTTTGAATCATCTGGACCTACCATTTCATGTTTTCTCTTGTCTTCCA
CTGGGATTGTGTTCTATGATTCTGTTGCCATTGACTTTGCTTTATTCTCTTTCCTAGCGG
AGGATGAAGAGGATACTATAGCAGCTGAGGAGCAGTTGGAAGGGGAGGTGGATCATGCCA
TGGAACTGAGCGAGTTGGCTCGAGAAGGTGACATTCAGCAGACGTTTACTGAACATCCAT
TTGGTGTCTCCTCTTTGCAGAGTGCCAGGGATAAAGAGATGAATAAGACACTTTTTATCC
CCCTTGGAGGAACTCCAGGTCTAATGACAGAGACAGATGTCAACAAATAATTATAAATAG
AATTTGAGGACTGGTTGTGATGTAAGTTTGAACAAAGTGATGTGACAGCTTAGTGGAACT
AATGTAAGAAGCTTATTTGACTTGAACCTCAAAGAGAGATTTAGTTTGATATTATCTTTC
ACAGTGGGAGGCAGCAGCATCCATGGTTCCAGCCCAGGCTGTGGGGCTTGGCTTTAGTAG
CTGGTGCTGAAAGTAAACTCTTTCACCTCCCTTCAGACCTGGGCCTAGTAGTGTCTATAG
AAACTTAGGTAAAATGATCTGGCACCACTCAGACCTCCCTTTCTCCTTTGCGCCCTTTCC
CTTGAAGTTCCCAAAAGCTTATCCTTCGTTTCTTCTCCAGGTGAGCTGTCCATGGAGGAG
CTGCTGCAGCAGTATGCAGGAGCCTATGCTTCTGATGCCTCTGCCCCAGGCTCTGGGAGT
AGTGAAGAGGAAGATGAAGATGAGGTTGAGGCTAACAGCTCTGACTGTGAACCAGAGGGG
GCTACAGAAGCTGAAGAGGTTCCTCAAGAGGATAGTAGCAGTCAATCAGGTGGATGTGTG
GTCATGGGCACATCGGAGGGGAGACACTGGAGGAGTAGGTATGGTGAGCACTTAGCCTTC
GTTTTGTGTTTTAGAATCTGCTGAGGAGCAGAGCGAGGAAGAGGAAGATGAGCATTCAGA
AGAGGAAGAAACAAGCGGGAGTTCAGAATCAGAGGAATCTGAGTCTGAGGAATCTGAGGA
GTCTCGATCACAGAGCCAAGCAGATGAGGAAGAGGAAGAAGATGATGACTTCGGGGTGGA
GTACTTGCTTGCCCGGGATGAAGAGCAGAGCGAGGCAGATGGGGGCAGTGGGCCTCCCAC
CCCAGGGCCTGCCACTACTCTAGGCCCTAAGAAGGAAATTACTGACATCGCTGCAGCAGC
TGAAAGTCTTCAGCCCAAGGGTTATACCTTGGCCACTACGCAGGTATTCCCAGGCCCCAG
CTTCTGTTTTCTCTTATCTTGACTTTGCTGTTTCTCAGCGACTGATACCTCATTTCTACC
CTGATGCCTCTCTCCCTCCTACCAGGTGAAGACCCCCATTCCCTTGCTCCTGCGGGGCCA
GCTCCGAGAGTACCAACACATTGGCCTGGACTGGCTGGTTACTATGTATGAGAAGAAGCT
TAATGGTATTCTTGCTGACGAGATGGGGCTAGGCAAGACAATCCAGACCATCTCCCTACT
TGCCCACTTGGCTTGTGAAAAAGGTAACAAGGCAGGGCCTTTCGTCTTGGGCTGCTTGGC
CAGCTCCCTGCAAAGCTTGTTTAATGGTGATCCTAGCTGCAGGATAGTAAAACACTCACT
GTTTTGCTGCTGTCCTAGTAGCTTCATTGACTCTGGTTACTAACTATAAAGATGTTAGCT
TAAGTGCTAGCATTCTTAGGAAGGACCATCAGGACAGAATGGTCAGGGTTATACCTCAGG
AACCAGAACACAACCCCAAAGTTTGGGGCACCTGGGTGGCTTAGTTGGTTGAGCGTCTGA
CTTCGACTCAGGTTATGGTCTCGTGGCTTGTGAGCTTGAGCACCATGTCAGGCTGACAGC
TCAGAGCCTGGAGCCTGCTTCGGATTCTGTGTCTCCCTCTTTCTCTCTGCTCCTCCCCGC
TCATGCTCTGTCTCTCTTTCAAAAGTAAACAAACATTAAAAAAACAAAAACTCCCAAAGT
TATATTTCCTTACCATCTCTCATTCTTTTTTTTTTTTCTTTTCCTGCTTAAAATCTTTCT
AAGTTTATTTTGTTTTTTTAACTGGAGGTGTAATTGACATACAGCATTATGTTTTGGGTA
TACAACATGATTTTTTGATACTGGTGTGCGTTGTGAAGTGATTAGTACAGTAAGTCTCGT
TAACATCCACCACCACACGTAGTTAACAAAAATTTTTTTGTGTGTGATGAGAACTTTAAG
ATTTACCCTCTTAGCAACTTTGAAATATGCGATCCAGTATTATTAACTATAGTCACCATG
CTGTACATCTCTCATTCTTTTGCTAAACAGGTAACTGGGGTCCCCATTTGATCATTGTCC
CCACCAGTGTGATGCTGAACTGGGAGATGGAGCTGAAACGGTGGTGCCCCAGCTTTAAAA
TCCTCACTTATTATGGAGCCCAGAAGGAGAGGAAGCTCAAGCGGCAGGTTTGCCCCTCCA
TGTGATCACTTCCCCCTGAATGATTGCTCTTTTACTCTTAGGCCCTTTCCTCAGAGGAGC
TTTTCCCCCTACCCTTTCTGTTGCTCCCTTCTGCTTCTGGGACTTTGTCTTTCTCTCAGT
CTGATTTATGTTCCTTGAGGACCTTAACATATCTTCCCTTTCTCCTTTCTTTTCTTTTCA
CCCCACTATCTGGTGCTTTCTCCTAATACCTTAGGGCTGGACCAAGCCCAATGCCTTCCA
TGTGTGTATCACGTCTTACAAGCTGGTGCTGCAGGACCACCAGGCCTTCCGCCGCAAGAA
CTGGCGCTATCTCATTCTGGATGAGGCTCAGAACATCAAGAACTTCAAGTCGCAGCGTTG
GCAGTCATTGCTCAACTTCAACAGGTAGAGATGGAAATGGGGGTTTGTAGGAGGGTTGAC
TTGACCTGAAGGGTGGGATGCTTGGAAGGTTGGGACCTTGCTGACCATTTTCCCTCTAAT
TTCCTCTGTTTCTTTGCAGCCAGAGACGCCTACTCCTCACAGGAACTCCCTTGCAGAACA
GCCTCATGGAGCTGTGGTCTTTGATGCACTTTTTGATGCCCCATGTCTTCCAGTCTCATC
GCGAGTTTAAAGAATGGTTCTCTAACCCCCTAACTGGCATGATTGAGGGCAGCCAAGAGT
ACAATGAAGGTCTAGTCAAACGTCTCCACAAGGTAGGGCCTATAACAGTTTGTCAGGGGT
ATTGGGAATAATGAATGAAGGGCAATACCTAGAAAACCTTTATGGAGAGAAAGTCAGTGC
TGGGCTAAATTCACTGTTGTCAAGTGACTAACCCAATGCCAAATTGAGTGGCCTCATTTT
AGTCATCATTTTACCTGTTTTTTCCTAATGGTGACATTTCTGTCTTTATTCTCTGAGTAG
AATGACACTGCTGATCAGTCATTGCTTAGATTTTTTCCTTGCTGGGCTTTCTTCAGCTTT
CATCGGGATCTCTTTTTTCTTTGTTTTTTTTTTTCTTTTGTCTTCTCTGGCTCCTCTTCC
TTTGTCCAGCTTTTAGTATTCTTAATATTGTCTCAATAACATCTCAATATTCTTATTTTT
ATTTTTTTCTCAATTGACATATCTTAAGGCCTAAAGATCCTCTGTGTATTTTTATTCTCG
TGACTCTCTATACCAGTCAACTTGTATTTAAATTTGACTTGATTTCTTTAATTGAAAGTT
TCTCTTGAACTCGTTCTGTTCTAAGTCAAACAACTCAAGTCTTATAACCTACTATATCTA
CTCCATGTTGTTCAATCATACCATCATTTTCGTAAATTAAACTAGAAACCAAAAGATTGT
TTTCAGTTATATCTCTTTCCTTCATTTTATTCCTATTTTTCATTTCTTCCATAGCAATTT
AAAGACTATGTCCTGGGGCTCCTGGTGGCTCAGTTGGTTGGGTGTCCGACTTTGGCTCAG
GTCATGGTCTTGTGGTTCATGGGTTTGAGCCCCACATCGGGCTTCATGCTGGTGATGCAG
AGCCTGCTTGGGATTCTCTCTCTCTCTCCCTCTCTCTGTACCTTCTCCACATTCCCTTTT
TTGAAAATAAATAAATGAACATTATTCTTTTTAAAAAAAAAATTTTTAAATACATATAAA
GACAATGTTCTCTCCGGTTTTACCTCTTGGGATTTTCAGATTTGCCTTTTGTTTTCTATG
GTGTAGTCACTGCCACAATTTTTGTTTTCAGCTTCTCTCCTGGATTTACTTTCATAATAT
TGCAGATTTATAGTTACTCCTTGAAGTGTAATTGAGCCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGCCTGACGCAG
GGCTGGAACTCACGGACCGTGAGATCATGACCTGAGCTGAAGTCGGACGCTTAACCGACT
GAGCCACCCAGGCGCCCCGTAATAATTTTTTTTAAGGTTGGTGTCGTCATCATCATCTTT
ATGCATATCTCCTTCAACAGGTAGTAAAGTCCTGGGAAGAGGGCTTACTTTTGACTCATC
TTTGTGTGATTGGTTCCTGGCATGCTTCATGGCTTCATGAGTGTTTACTGAAGGGTTAAG
CCAGTGTTCTGCTGGTCATCAGGCCAATACCCAGCTAGAGGGGCTAGGTTGGGGCTCAGT
GCCCATTTTTCTCCTGTCAGCCACCTGCTTATTTGCTTTTAGGTTTTGCGGCCTTTTTTG
CTGCGCCGAGTTAAGGTGGATGTTGAGAAGCAGATGCCTAAAAAATATGAGCATGTTATC
CGCTGCCGGCTCTCCAAGCGCCAACGATGTCTCTATGATGACTTCATGGCACAGACCACG
TAAGGGAGGACAGAGGGTGGGCCCTGTGATGCTGTGTTAGAACAGATGTGACTGTCAGGG
TGCTCCATGTATTTTTTTCCTCTGTCCCAGAACTAAGGAGACACTAGCCACAGGCCATTT
CATGAGTGTCATCAACATTTTGATGCAGCTGCGAAAAGTCTGCAATCATCCAAACCTGTT
TGACCCTCGACCTGTTACCTCCCCCTTCATCACCCCAGGAATCTGCTTCAGCACCGCCTC
TCTGGTGCTAAGGGCCACTGATGTCCATCCCCTCCAGGTAAGTAGTTGCTCCCAAGATAA
TTGGCCCTATTCCAGTCCTGCATCTTTTTCTTTAGGCTGCCGTCCGATCTTTTGCATCCT
TACCTCCCTGTAATCTCAGCACTATTCCCTCAGTTTCATTGTTTTCTAGCTGTGTGATTT
TTGGGCAAGCTAATTATTAATCTCTAACCCTAAGTTTGCTTGCCCTTGAAAGTACTGATT
ACAAGGTCTATTATCTGTGGTATGTTTGTGAAAATTGTGTTAATGTTTTTGGAAGTGCCT
AGCATATTAGTAATACTTACAATGTTTTGTTTTTCTGTTCCTTTCCCTCTTTTTGGTTGC
TTCCCCCCCCCCCCCCAACATTTGGTTTTGTTACGGTAAAATACACAACAGGTTTTACCA
TTTTACCCATTTTTAAGCATATGGTTAGTGGCATGAGTACATTCACATTATTATACAACT
ACTACCACCATCCAACTTCAACACTTTTTTGATCTTTCCAGATTGAAACACCATACACAC
TTATAGTAACTCTGTATTCTCCCCTTTCCTCCAGCCCTTGGCAGCCACCATTGTACTTTG
TAGAAGTTTGACTACTAAATAGAATCATATAGTATTTGTTGTTTTGTGACTGGCTTATTT
CTCTTAGCAAAATGTCTTTCAGGTCCATCCACGTTGTAGTATGTGTCAGAATTTGCTTCT
TTAAGTTGGATAATTCTGTTCTGCATCTTTGTGTATCTATGTGTAGTCACACATATGTGT
GTGTATATATATTGCATTTTGTTTGTTTATTCATCAAGGGACAGCTGGGTTATTTTCATC
TTCTCATTATTATAAATAATGTTACTGTGAACGTGGGTGTACAAATATCAGTGTGAGTCC
CTACTTTCAATTCTTTTGGGTGCATACCCAGACATTGAATTCCTGGATCATATGGTAGTT
TTATTTTTAATGTTTTGAGGAATTTCCATAGTGTTTTCCATAGCGCTTTCTCCATTTCAC
ATTCCCACCAGCAGTACACAAAGGGTACTAATTTTATCAACATCATTTGCCAGCACCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAAATTTGGGGTGGAAAGGAGAGAGTTGAGGCTAGGCTGGAAATGTTTA
TGTGGGATTGATGCAAAATACTGTGAAGGATTTGGGGGAGAGAATAACTAGAAGAGGGAA
CTGGGAGGGGCCCTCATGTTTGTCACTGATCTTTCTCCATTTCTTTGCTTGGTGCTTTTC
AGTCATCTCAAGTTTTTTTCCCTTTTTCTCCTTTGTCTTCTTTCCCTTTACTCCCTTTGC
TTTTGTTACCTTGTCATGTATTTCTGCCTCATTTTCCTTGTTCCTTTTTTTTCCCCTATA
CCTTATTCTACTTCTCTCCCTACCAACCTTCTTCTTTTTGTCCTCATAGGATGCTGCAGC
CAGTGCCCAAGCAAGAAGGCCGGACAGTGGTGGTGGTCAATAGCCCACGGACCCCCCTGG
GCCCTGTCCCGGTCCGACCCCCTCCAGGCCCTGACCTCTCCACCCAGCCCCCACCTGGCC
CAGCCCCCCCAGTGCTGCCAGCACCACTGATGGTGTCAGCCTCGCCTGTTGGGCCCCCAC
TTATTCCGACATCGCGGCCTCCTGGCCCCGTTGTGTTGCCTCCACTGCAGCCAAACAGTG
CGCCTCTGCCCCAGGGTGAGTTACCAGGGGGCTAAGATGCTGGGGAGTACCTCATGTATA
TTATTCAGATTGGGGAAGAAATAATGAAATTGGGAGTGATGAGGAAGCTGGATTGGAGAT
AGGTGTGCTGTTTGATGGGTTGGCAGCGTGCATGGAGGCTTTTGGGAGCAGGCTAAGGCT
CTAGTTAGGATATATCTGACAGGTGTTTGCTTTGTGTCTACAGTGTTGCCATCCCCCCTG
GGGGTCCTGAGTGGGACCTCAAGGCCTCCTACACCAACCCTCTCCCTAAAGCCAGCCCCA
CCTGCTCCTGTTCGCCTAAGCCCTGCCCCACCTCCAGGCTCATCCAGCCTGTTGAAGCCT
CTGACAGTGCCACCGGGCTACACTTTCCCTTCTGCTGCCACCACCACCTCTACCGCCACA
GCCGCTGCTCCCACCACGGCAGTGCCGACTACTACCCCTGCGCCACAGCGCCTCATCCTG
TCTCCTGATATGCAAGCTCGCCTGCCCTGTAAGTTCTCAGGAGTCTGTGAGTGAAAGACT
TGAGATGGCAGGAAGGTTTATGTGCCACAGGGTTGGAGAAAAGCCAGGAAATGTGAAAGA
AAATTTTAGGTAGCTAATGTACATAAAGCATTTTGCCATATGCTGGAAATTCATAATCAA
GTAAGAGCTGTCGAGTCCTGAGGCTGATAAGGGAGATGACACAGAGATGTGTGAATTGTG
AAAAACCTAGCAGCAGAAAGTTATTTGAGGTAAAAGAGCAGCACAGAGTTGGGAGTGGTG
ATAAACTCAGCATGGTGGCAGACAATTAGAGGACGTAAAGGAGATTGCTAGGCAAACAAG
TGGGATTGGAAGGAGTAGCACATCGAAGGCTGAGTTTGTTGGAACCTGATAAATTGAGGG
GGAGGATTGGAGGAATTGGAGGCTTGTGCCTCATCAGGTGAAGGGGCATTAGGATGACCC
TTGTTTACATTAAACTCTTTCTTTGTTCCTAGCAGGCGAAGTGGTCAGCATCGGGCAGTT
GGCCTCACTGGCACAGCGTCCAGTGGCTAGTGCAGGGGGAAGCAAACCTCTCACCTTCCA
GATCCAGGGCAACAAGCTGACTTTGACTGGTGCGCAGGTGCGCCAGCTTGCTGTGGGGCA
GCCCCGCCCGCTGCAAAGTAGGTAAAACCCACCCCCTGTCCTGCCTTTTTTCTCCACTTC
CTTGTCTCTGTTTTTGTTGCTCTTTTCAAACGTCAGCCTTTATGTTTCTTTCCCTAGCTT
TTGGTGGGTGGGGCCCAGGGGAATGTTTGGAAGGGGTCTTTTGAAAAAGGGATGAGGTCA
TTCTAGAGAAGTTATCCCCTCTCTGTTTTTTCCTTTTCCTCTTGCCCTTGCCTCTACCCT
CCTCAGGCTGATAGCTGCTTCTCTTTCTTTCTCTCTTCCCTTAACCCAGGGAATGTGGTG
CACCTGGTGTCAGCAGGGGGGCAGCACCACCTCATCAGCCAGCCTGCCCATGTGGCTCTC
ATCCAGGCCGTGGCCCCGACCCCTGGCCCCACCCCTGTCTCTGTGCTGCCTTCTTCGACC
CCCAGCACCACCCTTGCCCCCACTGGCCTCAGCCTTCCGCTTGCTGCTAACCAGGGTGAG
GCGCCTGGCCTTCCTATTTACTTAGCCCTTGCTGGCCTTGGTCTTTTCAGGCATGCCCTG
GGCTACTGTCTGTCCAGCCTTCCCTCAATGTTGTTTTCCCTTGTCAGTATCTCCAGTATC
TGTCTGCTGCCCTCTCCTGCCCCTGGACTTCTTCCATCCTTTGGGTCTCTTGTTTCTTTT
CTACCTTCCCCTCAATGTAGCTTCCTCTTGCAGTGCCACCAACCATGGTGAATAATACAG
GCGTGGTGAAGATTGTAGTGAGACAGGCCCCTCGGGATGGACTGACTCCTGTTCCTCCGT
TGGCCCCAGCACCCCGGCCTCCAAGCTCTGGGCTTCCAGCTGTGTTGACTCCACGCCCCA
CGTTAACCCCTGGCCGGCTACCCACACCTACCCTGGGTACTGCCCGAGCCCCCATTCCCA
CGTCCACTCTGGTGAGGCCCCTTCTCAAGCTGGTCCACAGTCCTTCGCCTGAAGTCAGTG
GTGAGTCCAGGTGGCTTAAGAGCAGATGTTTTTGCCAGGAATGGAGATAGGGTGGCCCTG
AGGGGTTTCTTAGTCACAAAGATTCCTTGTTAAACAGCATACTGACTTGCTTTGTAGTAG
GCCCCAGAACTAGGCTGCTGAGCCCTTGCCTCATTTTAGAATTTACTTCTTAGAACATTG
GAGGGAAAGGAAATGTTAAATTGTCAGATTCCTTGAATCTTTGACTTCATGGTGTGGGAG
TGAATGTTTTCTGGGAAACATGTGAAGTGTGGGGGTAAGGGAAAAGATAATAGGTCAAGA
AAAGAATTCTGGGGCTAACTCATGCTCTGTCTCCACAGCTTCAGCACCCGGAGCTGCTCC
CTTGACCATCTCTTCTCCTCTCCCCGTGCAGTCCCCACTCCCTGGGCCAGCTTCTCCAAT
GCCGGTTCCCAATTCCTCTCCCCTTGCTAGTCCTGTGTCCTCTACGGTCTCCATCCCAGT
GTCATCTTCACTTCCCATCTCTGTCTCTACCACGCCTCCTGCCCCGGCCTCAGCTCCACT
CACCATCCCCATTTCGGCCTCCTTGCCTGTTTCGGCCTCTGGCCCGGCTCTGTTGACCAA
TGTGACTCCAACACTGGCACCTGTTGTCTCAGCGACTCCTGGACCTCCCTCTTTGGCACC
AGCTGGGGCTTCCCCATCAGCGTCAGCTTTGACTCTGGGTTTGGCCACAACTCCATCCCT
GTCTTCATCTCAGGCAACTGGTCATCCTCTGTTGTTGGCTCCAGCCTCTTCACATGTTCC
AGGGTTGAACTCAGCCATGGCCCCAGCATGTTCACCTGTATTGGTACCAGCTTCTGCTCT
GGCCAGCCCTTTTCCGGCAGCACCAAATCCAGCTCCAGCTCAGGCTTCCCTTCTGGCTCC
AGCACCTTCTGCATCTCAGGCTCTAGCCACCTCTCTGGCTCCCATGGTGGCTCCACAGAC
AGCAATCCTGGCTCCTTCTCCGGCTCCTTCTCTGGCTCCTCTTCCAGTCCTGGCCCCATC
GCCAGGTCCTGCTCCTGTCCTGGCTCCATCACAGACTCCAGTTCCAGTTCTAGCTTCTTC
ATCTACTCCAGGAACTCCTTTAGCTTCAGCTTCTTCACTGGTGCCAGCCCCAGCTCCTGT
GTTGGCTCCATCATCAACTCAGACTATGGTACCAGCCCCTGTTCCGTCACCTCTCCCAAG
CCCGGCTTCTACACAGACACTGGCCTTAGCCCCAACTTTAGCATCCACCCTTGGGGGCTC
ATCTCCATCTCAGACCCTCTCTTTGGGAATGGGGAACCCTCAGGGGCCTTTTCCAGCTCA
GACATTGTCATTGACTCCAGCGTCATCCCTAGTACCAACTCCAGCCCAGACACTGTCTTT
GGCACCAGGACCACCACTGGGTCCATCTCAGACGCTGTCTCTGGCTCCCCCTTTGACGCC
AGTTTCTCCAGTGGGCCCAGCCCCAGCTCACACGCTGACTTTGGCTCCGGTATCGTCATC
TGCTTCACTCCTAACCCCAGCTTCAGTGCAAACATTGACCTTGAGCCCTGCCCCAGTTCC
GGTGCCCACCTTGGGTCCAGCTGCAGCCCAGACTCTGGCGCTGGCCCCAGTCTCAACACA
GGCCCCAGCTTCCCAGGCATCTTCCCTTGTGGTTTCGGCATCTGGCGCTGCTCCCTTGCC
TGTCACCATGGTTTCCCGGCTGCCTGTTCCCAAGGATGAGCCTGAGACACTGACGTTGCG
CCCTGGTCCCCCCAGCCCTCCTTCCACTGCTACCTCGTTCAGTGGTCCCCGGCCTCGACG
CCAACCCCCACCACCACCTCGTTCCCCTTTCTATCTGGTAAGTTTTATTGCCTCAAAGGA
GAGGGAAGGCAGTTGGGTTTCATTGGAGTGTTGGTAGAGTGGATGGAATAGAATAATGTC
ATTTTTATCTTGGTAAATTACAAAGCCTAGTTTTGTAAACTTGATGCTTGAGTGTGCGGT
TGGACAAGTCCCTGGGCCTGTACTCTTATCTGTATAATGGGAATGATAATCCATATTCTG
GCATGGTGGCTCAGTTGGTTAAGCGTCTGACTTTGGTTCAGGTCATGATCTCACCATTTG
TGGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCTCTCGAAAA
TAAACATTTAAAAAATAATAATCCATATTCTGCCTTTCTCAGAGGGGTACCTGAGGACCT
AATGTGCCTTTATTTATTTATTTTAAATACTTCTAAGATTTGTATTTATTTTGAGAGAGA
GATAGCATGTGCACAAGGGAGGCAGAGAGAGGGGGAGAGAGAGAATCCCAAGCAGGCTCC
ATGCTGTCAGTACAAAGCCTGATGTGGGGCCTGAACTCAAAAACCATGAAATCATGACCT
AAGCCAAAATCAAGAGTCAGATCCCCAACCAACTGAGCCACCCAGGTGCCTCCCTAATGT
GCTTTTACAACTATGAATTACTGATATGTTCAAGGCTGTCTTGTTATTATTGGTCTTTTT
GGTACTTGTTCACTGCCGAGTTAGTGTTGGCATCTAATTGCCCCATCTTATAGATGAATA
AACTAGCCCACTATATGATGTTATAAATTATAAAGGTTACATGAGTTGTGAAAACTCAGA
TGTGCTGACTCTGTTGCTTTCTCCTTTCCACACAGGAGGCATTCCCCAGAGATAGACTTT
TTTTGGTTGCTAGAACCATTGTGTTTATTAAGTATTTGGATTTCTGAGGGAAGTCATGGA
ATACAGTTCCCTAAAGATGATCCTCTGAGTGGTGGTCATGTTTTTTTTTTTTTTTTTTTT
TTAAACCTTTTTTTTAAACCTTTTTAAATGGGCAATAAAAGAACTCTGTTCCCTGTCCTT
TCATGAGCTTTGTGATAGCTGTTTTTTTTCCTGTCTTATGTATGGTTCCGTATATGTTTG
GTTAAGTTCAGCTTACAGTTCAAATGAGAGTAAATAACACGGGAACTAACAGGAAAAAAG
ATCTAAAAAATCGTTCCAGGCCTTCTTTGTCTTTTTCTTCTTTTCTTCCCTTTTTTTTGT
TTTCTTTTTTAAAGTTTATTTATTTTGAGAGAGATGGAGTAGGGAGGGACAGAGGGAGGG
GTAGAGAGAGAATCGCAAGCAGGTTCTGCGCTGTCAGTGCAGAGCCCGCTGGAGGGCTCG
AACTCACAAATTGTGAGATGACCTGAGCTGAAATCAAGAGTCAGAGGCTTAACCAACTCA
GCCACCCAGGTGCCCCTCCTTTATTTTCAGAGCTGCTTCTTATTCTTTGCCTTAGCCCCA
GTCGCCCACTCCATCAGTGCCACTGACTCCACCTTTCATCTTTTTCTAATGCTGTCAGGT
TGGTCTGGCTTGTTCAAAGTAGAAGAGAGCTAGATTCTTGCCCAAGGATGGTAACCCTAT
GGTCTATGTTAAATTTTGTTTGCTCTGCAAGTAGGTAGAAGCTTCTTAACGCTTTTTTTA
AGCAGCTTGAGATAAAGATTACATACCATACAACTAGTCCACGTAAAGTGTACAGTCTAG
TGGCTTTTAGTATATTCACATACGTGCAACCATCATTGCAGTCAACTATAAAACATTTGC
ATGTTCCTAAAAAGAAATTCCACACCCTTAGCCATCATCTTCCAGCCATCCATCTCTCCT
AACCTTTGGCAACCATTACTTTCTGTCTCTTTAGATTTGCCTGTGGAGTCGTATGGTGTA
TGGTCTTTTGTGACTAGCTTTTTTCATTTAGCTTAGGGTTTTTGGGGTTCATCCACATTG
TAGCATACGTTGGTACTTCCTTTTTTTGTTTGTTGAATAATATTCTATTGTGTGGATATA
CATTTAATATGTCTATTCATCAATTGATGGGGTCACTTGGATTATTTTTACGTTTTGGCT
CTTATGAATAATACTGCTATGAACATTCATGTGTAAGATTTTGTGTCTTTCATATGCTTT
CAGTTCTATTGGATGTATGCCAGGAACAGAATTGCTGGGTCAGATAGTAACTGTTTAACT
GAGGACTACCAAACTGTTTTTCAAAGCAGTTGTACCACTTTACATTCCCACTGGCAGGAT
ATATTTCAAGTTCCCCACATTTTTGCCAATGTAGCTATCCTAGTGGATGTGAAGTGGTAT
CTTGTGGTTTTGATTTGTGTTTTCTTTCTTTAAAAAAAAAAAAAATTTTTTTTTAACATT
TATTTATTTTTGAGAGACAGAGACAGCATGAGCAGGAGAGGAGCAGAGAGAGAGGGAGAC
AGAATCTGAAGCAGGCTCCAGGCTCCAAGCTGTCAGCACAGAGCCCGACATGGGGCTCAA
ACTCACAAATTGCAAGATCATGGCCTAGGCTGAAGTTGGATGCTTAACCAGCTGAGCCAT
CCAGGCACCCCTTTGATTTGTGTTTTCTTAATCGCTATCGCTAATGATGTTGAGCATCTT
TTCAGTGGTTGGCTCTTGTGTATCTTCTTTGAAGAAATGTTAGATATTCAGATCCTTTGT
ATTATTTTTAATTTTTTTTAATGTTTATTTTTGAGGGAGAGAGTGCAAACAAGAAAGAGG
CAGATAGAGGGGAAGACACAATTTGAAGCAGTCTCCAGGCTCTGAGCTGTCAGCATAGAG
CCTGATGCAGGGCTCGAACTCATGAACTGCGAGATCATGCCTGAGCCAAAGTTAAGCCGA
AGAATGCTTAACCAACTGAGCCACCCAGGCACCCCTGATTTTTATTTTTTAAGTTTTTAT
AATTTTTTTGAATTACTTTTTTTTTTTTTTTTTTTAAGTAATGTCTATACTCAATGTGGT
TCTGAACTCAAGACCCTGAGACCAAGTGTCACATGCCCTACTGACTGAGCCAGCCAGGCA
CCCCTGACCTTTTTAATTGGGTTATTTTATTTTATTTTATTTTATTTGAAAGAATTCTTT
ATATATTCTGAATACAAATAGCTTCTCAGAAATATGATTTGCAAATGTTTTCTTCTTTGC
TACTACTCTTGAGACCCTGGCCTGTTCTGCTAGGATGCTTTCCTTTTTCACTTTGATCAC
CAGGAGCCAAGAGGTCAAGTTTAAAGGGAATAGTCAAGAAGGGAAATTTGGGACACTACT
TTTATTCAGGACTGTCTGCTAGGATCCAGCCTCCTTCATCTGTTCATTCTAATAACAACT
ATTTATTGACAGCCTACTAGGTGCCAGATAACAGCTAGATAGTGGGTGAGAATAGCAAAA
TCAAATATGTTTTGTGTTAATATGGGGCTACAGTTTCGTGGATAGAAAACATTAATCAAA
GAATCATACAGATGTGGTAAGTGCTGCAGAAAAGAGTTCTGTCACAACCTGTGAAACCGA
AAACGCTAGTGATGGGGAAGAACTGGATCAAAGTTCTATAGATTTCCTATCTGCCAGGGC
ACTCCCCTTTTCTCTCTTAGGGTGATGATACCTAGATGTCTGATTAGCTGTTGCCATCCT
AACCCATTCCAGTCTGGCCCTTGGCAGAAACCTGCCATGGATTTGATTAGCCCCTCTGTG
TCCTGGTCAGGAATTTGAGGAAGGCTTTTAATAATTGTTTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGCTTAACCAGCTGAGCCATCCAGGCACCCCTTTGATTTG
TGTTTTCTTAATCGCTATCGCTAATGATGTTGAGCATCTTTTCAGTGGTTGGCTCTTGTG
TATCTTCTTTGAAGAAATGTTAGATATTCAGATCCTTTGTATTATTTTTAATTTTTTTTA
ATGTTTATTTTTGAGGGAGAGAGTGCAAACAAGAAAGAGGCAGATAGAGGGGAAGACACA
ATTTGAAGCAGTCTCCAGGCTCTGAGCTGTCAGCATAGAGCCTGATGCAGGGCTCGAACT
CATGAACTGCGAGATCATGCCTGAGCCAAAGTTAAGCCGAAGAATGCTTAACCAACTGAG
CCACCCAGGCACCCCTGATTTTTATTTTTTAAGTTTTTATAATTTTTTTGAATTACTTTT
TTTTTTTTTTTTTTTAAGTAATGTCTATACTCAATGTGGTTCTGAACTCAAGACCCTGAG
ACCAAGTGTCACATGCCCTACTGACTGAGCCAGCCAGGCACCCCTGACCTTTTTAATTGG
GTTATTTTATTTTATTTTATTTTATTTGAAAGAATTCTTTATATATTCTGAATACAAATA
GCTTCTCAGAAATATGATTTGCAAATGTTTTCTTCTTTGCTACTACTCTTGAGACCCTGG
CCTGTTCTGCTAGGATGCTTTCCTTTTTCACTTTGATCACCAGGAGCCAAGAGGTCAAGT
TTAAAGGGAATAGTCAAGAAGGGAAATTTGGGACACTACTTTTATTCAGGACTGTCTGCT
AGGATCCAGCCTCCTTCATCTGTTCATTCTAATAACAACTATTTATTGACAGCCTACTAG
GTGCCAGATAACAGCTAGATAGTGGGTGAGAATAGCAAAATCAAATATGTTTTGTGTTAA
TATGGGGCTACAGTTTCGTGGATAGAAAACATTAATCAAAGAATCATACAGATGTGGTAA
GTGCTGCAGAAAAGAGTTCTGTCACAACCTGTGAAACCGAAAACGCTAGTGATGGGGAAG
AACTGGATCAAAGTTCTATAGATTTCCTATCTGCCAGGGCACTCCCCTTTTCTCTCTTAG
GGTGATGATACCTAGATGTCTGATTAGCTGTTGCCATCCTAACCCATTCCAGTCTGGCCC
TTGGCAGAAACCTGCCATGGATTTGATTAGCCCCTCTGTGTCCTGGTCAGGAATTTGAGG
AAGGCTTTTAATAATTGTTTTGGATCCACTTCAAGGAAGTAAATTAACTTGACTGTTGCA
GAGTTATTTAAGAAAATTCCCAGAAATCCTCTATTTTATAAGCTTGTTGGATATGCAGGT
CTTAATTTTAAATGTTCAGGCATTCTGCTTTGGTAGCATACAAGGGAAGATCAGTTTTTT
CTTGCAGAGAAGTTACTTCATTTTTAACCTTATGAGAGGTATAACATTCATTATTGACAA
CTTGGAAAACCACTAAAAATATAACGTAATTTTGAGTCTTACAGTTTACATCAGTTATGG
TTAATTCGGGGAGGAATGGTCAGGTTTTTCTGTGAGGATACTGATTACTTTTTCTGTGTG
TGTGTGTGTGTGTGTGTCTAATTTTCCTCATCCCAAGACTCTCTGGAGGAAAAGCGGACT
CGGCAACCGTCTGAGCTCCGTGAACGGATTCTCCAACATAGTGAGGCTCAAGGGGCCCTG
GCACCTGTGTATGGGACTGAAATCTTGGATTTCTGTACCCTGCCCCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGATTTCTGTACCCCTGCCCCCAACCTGTT
GCCAGCCCCCATCGGCCCTCGTTCTCCTGGCCCCAGCCACCCCACCTTTTGGACTTATAC
CGAGGCTGCCCGCCAGGCTGTACTGTTTCCCCAGCAACGACTAGACCAGCTGTCAGAAAT
CATTGAGAGGTTGGCAGGGCTAAGTGTTAATGGGAAGCGGGTCTTGGGGCCTCTGAGTGG
ATGTAGTGGTTAGGGCTGGTGAAGGTGCACTTCTGGGGCCTTTCAGAATTCCACCTTTTA
TACTGCTTGCCTTCTTTCTTCACAGGTTCATCTTTGTCATGCCTCCTGTGGAGGCACCTC
CCCCTTCCCTGCATGCCTGCCACCCACCTCCTTGGCTGGCCCCACGTCAGGCAGCCTTCC
AGGAGCAGTTGGCCTGTGAGCTCTGGCCCCGGGCTCGCCCCTTGCACCGTATTGTGTGTA
ACATGCGCACCCAGTTCCCTGACTTGAGGCTCATCCAGTATGATTGTGGTAAGTTCATTG
TCCAGTGAGGATCCCTTGACCTCTTCCCCTCTTTTAGTAGCGATACTGCTACTTCAGAGA
GCTGCTGTACATGAGTCTTTGTGAATTTCATTAAACATTAGACAGTTCAGGTTATGCTTA
TAGGCAAGACAGAAATGTAGGCCTTTATGCTATATTCTTGGCATTTGTGAATTTGATGAA
AGTTGAAAATGTGTGCTAACTCATTTATTCATTGATTCAGTGGTTATTTTGTGAATATCT
GTTGTATTTTGCTAACCATTTGGGATACAGTGACAGATAAGATAGTACAACAGAGTTTTC
AGATTCGTGGGGAAAGGTGTGTGGTGGTACAAGACTGCATGGTAACCGGTTTTTCTTTTG
GGAAAACACAAGGAACTTTTTTCTTGGTTTTGGTTAGGATGCATTTGACTGCAAGTAAGA
GAAAACTGACCAATAGTGGCTTAAACCACAAGAACATTTAGTGTTTACTTAATGAGAAAT
TCTGAGAATAGTGGTATATGACTGGCTCAGCTTACTGGTGTTTTCATGGACCCAGGAACC
TTCTGGTCTTTCTCCATTGCTTATCATCCTTAGCTTTTATCTTTGTAGTCTCATGTTTAT
TTCTTAATGGTCTTACCATGGCTGCCCATAACTCCAGGGAGCACAGCAGTGCTTTGAGCA
AGAAGCAGGGGTTGAGACAAGACTCTAAGCAAGTTTCTCTTTTTTGGGGGGTGGAGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
GAGGAAGAGACTGTGGCCAGCAAGCAGACCCATATCCTAGAGCAGGTGAAAAAAGAGTGG
GCAATCTATAGAGCAGAGCTAATAGTTATGATGTCTATGATTTCTCAGCCCATTGAGCTT
TTGTAGGGGGAAAGGACGTTTTTGCTGCTTTCCAGATTACTGTTGACCTTTTCTTTCTTT
TTTTCTTTTTCATGTTTATTCATTTTTATTTTGAGAAGAGAGAGAACATGGGCAAACAGG
AGGGGTAGGTAGAGAGAGGGAGAGAGAGAATCCCAAGCATGCTCCTTGCTGTCAGCACAG
AGCCTGATGCAAGGCTTGATCTCACAAACCATGAGATCATGATCTGAGCTGAAAGCAAGA
GTCGTAAGCTTAACCAACTTAGCCACTCAGGCACACCCCTACTGTTGGCCTTTGATGGTT
GGGAGTAGATTGTTTATTGGTTCACAAGATTTCATAGAAAAAAGGCTTTGGACTCCTCAG
TTACAGGTTTGAATTCTAACAGTACTCGTTAATAATTGTGTTTGTTAAGTCAAGTGTGTT
TAATCTTATGAGTCTCACTTTCCACTTTTTGAAAGTTAATGAGAAGGAAGTAACTGTGGG
GCGCCTGGGTGGCGCCGTCTGCTAAGCCTCCGACTTCAGTCATGTCAAGATCTCACGGAC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCTCTCTGTCCCAAAAATAAATAAAAAACGTTGAAAAAAAAATTTAAA
AAAAAAAAAAAATTATTTTTATTCTTATTATTCACGTATTTATCTTGAGTGAGAGTGCAC
ATGCACAAGCAAGGGAGGGGCAGACTTAAGCAGGCTCCGCGCCCAGCGTGGAGTCCAGCT
TGGAGTTCAGTCTCAAAACCATGAGATCACAACCTGAGCCAAAATCAAGTTGGACCCTTA
ACCACTGAGCTGCCCGGGCCACCCTGGGACTTTTTTTTTTTTTTCTCTAGATGTTTATTT
TTGAGAGGGAGAGACAGAGGGCAAGTGGGGAAGGGGCAGAGAGGGACACAGAATCCAAAG
CAGGCTCCAGTCTCCAAGCTGTTGGCACAGAGTCTGACGTAGGGCTCGAACTCATGGACC
ACGAGATCGTGACCTGAACTGAAGTCGGCCACTTAACTCACTGAGCTGCCCAGGCAGCCT
AGGATTGTTTTTTTTGTTTTTTGTTCTTTTTTTTTTTAAAGGAGATCTAAGGCTGACTTG
AATGGAAAAGGAAGCAGAGCTAGAGGTTTCTAAAAACAGTTCATCACTGGTGGGCCACCA
AGTCAAATCTGTTTCATCCTATGTGGAAATACTGCATTGCTTTGGTAACTCTGAGGGCCC
AGAAGAGAGTTGAGTTCTGTTGTAAACCTGGTTTGGTGTAAACTTGGCTTCAGATTCTTG
CCAGAATCGAACTACAGGATATAAAGTTCTTTAATTTTTGTGGTTTTTTGCTTCCCCACA
TCCTTGCAGGCACTGTGTCGGGCAGAGGATGAAGAGGATATCCGTGCGGCCACCCAGGCC
AAAGCTGAACAGGTGGCTGAGCTTGCAGAATTCAATGAGAATGATGGATTTCCTGCTGGT
GACGGAGAGGAGGCCGGCCGGCCTGGGGCTGAGGATGAAGAGATGTCCCGGGCTGAGCAG
GAAATTGCTGCCCTTGTAGAACAGGTCAGTGTCGGACCCACTAGTTCTTAACCTCACCCT
TCTCAGCTTCTTCCTCTGGACCTTGTGATCCTCCTCCTATCTTCCCTGGTGAAAATAATC
AAGGGTGATGGGCCCTGGTTGCCAAGTTCCTATGTTCATCACCGCTTCTCCTTCCCACAG
CTGACCCCCATTGAGCGTTATGCCATGAAATTCCTGGAAGCCTCACTGGAGGAGGTGAGC
CGAGAGGAGCTCAAGCAGGCAGAAGTGAGTATTTCTAGGGGGTGAGGATAGAAGTGGGAA
GTTGATTCTTTCTAACCAGTCCCAGTCTGCTTGCCTCCCTCTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCCCCGGAGCTGGCTGATATGGCCAGTTCCGAGACTTACCCACTTACTCTTGTGC
CCCCTAAGGATCTGTTGCCAGTTGCTGTTGAGATCTGCCTATGTCAGAGAAGAACCTTTC
TCTCGCCTCTTCTGCACCTAGCCCAACCCTGGAGGCTGACAGCGTCCCCAACGGTCAAGA
GCAGGAAGTGCCAGAGCCTGCTGAGGGGACCATCCTCACAGTGCTGCCTGATGGTGAGGA
GGTGCCCTCCTGTCTGAGTGAGAGCAATGGGCTGGAGCTCCCACCTTCAGCAGCATCTGA
TGAGCTACTTCAGGAGCCGTTGGAGGCTGACAAGAGCTCAGAAGAGCTGGTGGAGGCCCA
GACCCCAACCTCCAGCCCAGAGAAGCCACAGGAACTTGTTCCAGCAGAGGTCACAGCCCC
ATCAACCTCATCTTCGGCCACCTCCTCACCTGAGAGTCCTTCACCTGCCCGGCCCCCTCG
GCGTCGCACCAGTGCTGATGTAGAAATTAGGGGTCAGGGGGCTGGTCGGCCAGGGCAGCC
TCCAGGCCCCAAAGTGCTTCGCAAGCTGCCAGGACGGCTAGTGACTGTGGTAGAGGAAAA
GGAACTGGTGAGGCGACGGCGACAGCAGCGGGGAACTGCCAGCACCCTAGTGCCTGGGGT
CTCTGAGACTGGTACCAGCCCGGGAAGCCCATCTGCCCGCAGCATGTCGGGGCCAGAATC
CTCACCTCCCACCGGTGGGCCCTGTGAAGCTGCTCCCCCATCCACACTGCCCACCCCAAC
CCAGCAACCCTTCATAGCTCGCCGTCGCATTGAGCTGGGGGTGACTGGTGGGGGCAGCCC
AGAGAACGGAGAAGGGGCACTTCTTGCCATCACCCCTCCTGCTGTGAAACGTCGGAGGGG
GAGGCCCCCCAAGAAGAACAGGTCTCCAGCAGATGCTGGGCGAGGGGTGGATGAGGTACC
TTCATCCACCTCTAAGGGAAAAACCAATGGGGCTGACCCAGTCCCTGGGGCTGAGACCCT
TATTGTTGCGGAGCCTGTCCTGGGACCCCAGCCTAGTCCTGGGTCCCAGCCTCTTGGACC
CCAGCCAATTCACAGACCCGAGCCCATCATCCTATCACCTGTGGAGAAAAGAAGGCGTGG
GCGGCCCCCTAAGGCACGAGATTTGCCCATTCCTGGGACCATTTCCTCTCCAGGGGATGG
CAACTTAGAGAGCCGGACACAGCCACTCCCGCTACCACCTCCCCTGCCACCACTCCCACC
ACTCCTAGCCTGTCCCACTGCTACTGTCGCCAACACTGTCACCAATCTCACCATTTCAAC
ATCCCCACCCAAGCGGAAACGGGGTCGACCTCCCAAGAATCCACCATCACCTCGGCCCAG
CCAGCTCCCTGTCTTGGACCGTGACAGCTCTTCTGTCCTCGAGAGCTGTGGATTGGGGAG
GCGGCGGCAACCCCAGGGCCAGGGGGAGAGTGAGGGTAGTTCCTCTGATGAGGACGGAAG
CCGCCCCCTCACCCGCCTGGCCCGCTTGCGGCTTGAAGCAGAGGGAATGCGGGGGCGAAA
GAGTGAAGGGTCCATGGTGGTGGCTGTAATTCAGGATGACCTGGATTTAGCAGATAGTGG
GCCAGGCGGGTTAGATTTGACACCTCCTGTGGTCTCGTTAGCTCCAAAACTGCGCTCTAC
CCGGCTGCGTCCAGGGTCTCTAGTTCCCCCGCTAGAGACTGAGAAGGTGCCTCGCAAACG
GGCAGGGGCCCCAGTTGGCGGGGGCCCTGGGCTGGCAAAGCGGGGCCGCCTACAGCCCCC
GAGTCCCTTGGGACCTGAGGGTTCTGTAGAGGAGTCTGAGGCTGAAGCCTCAGGCGAGGA
AGAGGAAGGGGATGGGACCCTACGTCGCCGGCCTGGCCCCCGTCGACTTGGTGGGGCCAC
CAACCAAGGGGACCAGCGTATCCTGCGCAGCAGTGCCCCCTCCCACCTGGCTGGCCCTAC
CGTTAGTCACAGAGGCCGCAAGGCCAAGACGTGAGTGGGCTGCCCCTCCACCTGGGCTTT
CCGCCATGGCCCCTCTCCCTCCACAACCAGGCCTGACTCTGTTAACCACTACTTGAAGTC
TTTTGAGGGGGAAAGCCTCCAGGGAGACATAGGGGCCTTCTCCCTTCTTTCCACCAAAGT
AGGGGGTAGGCAACTGGTTGTCATGGAAACGGGGCTCTTCATATACCCCCTTCCCTTCCA
CCCCACAAGGCTGGGCAGTGTTAAGGGTGGCAAGATAGTCTCTGTCCCCACCCCCTTGTA
CTTGATTCCCCAGCTATCTTTCACAGCCCCCACCTTTAGGGGAAGGGGGAGGGGCTTCTT
CTCTACCATGAGTTTTTTTTTTTTTCTTTTTTTTTTAAGAAGAAAAAATAATAAACTTAG
TTTCTGTATGAGCATCCGCGTAAGGAGGCTTCTGATTTTCTGGTCTGGTGGAGGGTTGGG
TGGGAACTTGGGCATCGTTTTCCTCCTCTCTCTTGTTCTTGCCAAAACCCTAGTACCTGA
TCTCTAACCCAGAATTATGTGTCTTTGAGGTAGAAATCACCCAAGAGGAGGGAAGATTGG
CAAATCTGATCTGGTAGGGTGTCTTTCCCTAAAGTTTCAGTTTTAAGTCACTCCAACTCA
TACTTTTTCTCTCCTCCTATTCCCTTAGTTCTGGACTTTCCCTCAGAGCTCTCTGATGCC
TCAGATTTTCCCCTGCTTTTACTCCTCTTGCTCAGGTGCTTTCACTCCTTTTCCAGAAGG
CAGGCATCCTACCTCCAGTTGCTCCATCCCCCTTTTGCTTCCCTCCTTCTAGCCAAACTA
GTTTGAGTCAGCCACACCCCATTCCGAGCTCCTGGGGCTTTTCAGGAGGTGGCTGGCCAC
CCAACCCCACCCCTGGGCTTGGCTTGGAGACCTGAGTCAGCTCCTTCTCCACCCAAGCCA
AATCAAACCTGAGGCAGGAGCCGAAACTCACAGTCCCTCAAGGCCTATAGCCAGGTAAGA
GCTCCTGTTCATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1252, 2775..2960, 3203..3343, 4101..4323, 4439..4719, 5346..5436, 5577..5666, 6160..6348, 6434..6762, 6865..7042, 7830..7966, 8194..8363, 8479..8671, 10242..10378, 10470..10656, 12770..13034, 14012..14176, 14853..15119, 15458..16956, 22416..22545, 22672..22688, 22690..22808, 22945..23146, 35820..35864, 52029..52223, 52380..52463, 53225..53314, 53317..55233
1001..1252, 2775..2960, 3203..3343, 4101..4323, 4439..4719, 5346..5436, 5577..5666, 6160..6348, 6434..6762, 6865..7042, 7830..7966, 8194..8363, 8479..8671, 10242..10378, 10470..10656, 12770..13034, 14012..14176, 14853..15119, 15458..16956, 22416..22545, 22672..22688, 22690..22808, 22945..23146, 35820..35864, 52029..52223, 52380..52463, 53225..53314, 53317..55230
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved