Felis_catus Locus RPL10
snOPY snoRNA Orthological Gene Database
Felis_catus RPL10
Felis_catus
RPL10
GeneScaffold_1545
SNORA70
2437..2569
4020
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAGTAAGCCACACTCAGGGGTACTTTCCTTCTTTCAACCCCAGGAGTATATGGCG
TTCATAGTTACGGCAAAGCTCGGGGAAGAGTTCTACACCCAAGATGGCCGGCAGGAAACA
GGCTTCTCGCGCCGATGTGGCGAGGCCAGATTGGCTAGCTGGCCGCCCGCATTTGAACGC
TCAGCTGTGTCCCGGTTCAGCTCTGGAGCGGAGCCCCGCCCGCACGCAGGCGCACAAAGC
TGCTGCATCTATGGTCCGGAAGTGTGACAGAGCGTCCACCCGCTCTGGCCGGGACTCTAT
GGTTCCTATGCGCGAAGATCGGCCGCCTATATAAGGCATGCGCAGGCGTGGGAGCGCCTC
TTTTCCTTCGGCGCGGTGAGTAGTCGTGGTTCTGGAGTTGTGCGTTGTCCTTGCTGGTTC
TCTGTCCCGGTTTGAGGCCCGTCCGCGTCTTCTGTTCCGACTTTGTCTGTTTCGTTGCAG
CCACTGAAGATCTTGGTGTCGCCATGGGCCGCCGCCCCGCCCGGTGGTGAGTGCCAAATC
CGTGCAATTTCGCTGATGTGAAAAATGGAGGGAGAACTGTATTTCAACGCTAAAATTAAC
CGTGGGGTGGGGCCTCCGGGGCACCTTTTCTATATTGCGAACGGACTCCACGTTTTTACT
GATATTCCGGGTCGCTTGGGGACTTCGTTTACACTGTCTGTTTCTTTTAAGGTTCAGGCC
TTTCTTAAGCGTTTCTTCTGTTTTGTTGGGGGGCCAGATTTACCTTGGCCTGCATGTGTT
CCGCCACTTACGGGCTGAAATCGACGGCCGCCTTACATCTAGTCTCCGTCCTGGAAATTA
GCCACCTTTTCAGACTCGATACCCTCTCAGGGCCTTTGTGTGCCATCCCCATCTTATTTC
CGGGCGACATGCCCGTTCGGCCTCGGTCGCCAAGGGCCGCCCTGACCAGAGGGCTCAGCC
ACCTCGTGTGCCCTGCAGGGGGCGTCAGAATCTTTTCACATGTGGTTTCGAAGGCGGATT
TATTGCCACGTGCCCAAAAATCAGTGGCATGAATTATGTTACTAATTAGCAAGAAATTTG
CAGTGCCTTTGAGATGTTTCTCTTATTTAACTGAAAAAGTGCCTTTCCACCTGTTGACCT
TATAGGAAGCATGGAACCATAATAATACGGGGTTGAAGGAGATTTTTTGCTTCTATGTTT
TCTGTATGAGTGTTCTCTAATTTTTGGTCACTTTGTTTTGACCGTGTTTTGCTTAGCGCC
AAATTCCAGGAGTGGAGACCGCTAGAGATTGAGATGTTGCCCCCGGTCCCCATTCCCTGC
CCTCCTTTGGTCTTAATTTAAGGGAGTTCTCAAAGTGCTTATTGGGTTCACTTGTGAACT
ATAAACTTGGATTTCTCCCCTCCCCACAGTTACCGGTATTGTAAGAACAAGCCGTATCCA
AAGTCTCGTTTCTGCAGAGGTGTCCCTGGTAAGTAGTGAGAGAGTTCCCAAACTGGTTTG
GCTGCACTGACTCAGTTGCCTCCGGTGCCCCTCCCCCACATACTTATCTCCATATTTTTC
AGATGCCAAGATCCGAATTTTTGACCTGGGGCGTAAGAAGGCAAAAGTGGATGAGTTCCC
ACTGTGTGGCCACATGGTGTCAGATGAATACGAGCAGCTCTCCTCTGAAGGTGAGGCCGG
ATTCCTTGTTAATCCCATCCTTTCTAACTGCTCCCCTCCCCCACCAGACCCAGAACAAAC
TGCACCAGATTCACCATTTAATCAAGAGTATCTGATGGCGAGCCTTTTTATGAAGTTCAC
CCAGTCGATACAGATGTACACTGAGGGCCAGGGACGGTTACAGTAAGTGGCTCTGTCCTA
TTTTGTCTCACTGCTGCCTCCCACCTGCCCCCAACCTAGCCCTGGAGGCTGCCCGAATTT
GTGCCAACAAGTACATGGTGAAAAGCTGTGGCAAAGATGGTTTTCACATCCGGGTGCGGC
TCCACCCTTTCCATGTCATCCGTATCAACAAGATGTTGTCCTGTGCTGGAGCTGACAGGT
GAGCTGGGTCCTGGGTGTCTGTCTTTTGAGGGGTTTTCCCATAACTTGAGGCTTTTGTTT
GCCTTGTTTTTTCCATCGGAACAAAGAGATGGTTTCTCGTACGGGACTCCCCCATAATAA
AGCCAAGTTAAAGGTTCCCAAAACAAAAGGTATCACGACTAAGTCTTAGCCTCTGGGTGA
CAGGTGGAGGGAGGTGCTTTTGAGGAAGAGGCTTTAATCCTGATGATACCCATCTGCCAG
CAAGCAGGTAGCTGGCGCAGCCACCAGTTGGAAGGCTTTCAGCTGAGCCCAGTGACACCT
TGTAGGGGCTGCCTAGTCTTTTCAGGTTTTCCATTTTCTGCAGCCAATTAAGCCGACTGT
GCTCTTTCCCCATGGGGCCCAGTGTGCAATGGCTGCGAACAGCAGCCTCCTTGGTAGTGT
ATGCAGCCTGTTGGTTGTACGGGTTGCCCTAAGGGACCTTGGAGACAGTTTTGTTCCAGT
GGACATTGAGGGTTGGCCTCATGCTTTCTCCAATTTAGGCTCCAGACAGGTATGCGGGGT
GCCTTTGGAAAGCCCCAGGGCACAGTGGCCAGGGTCCACATTGGCCAAGTCATCATGTCC
ATCCGTACCAAGTTGCAGAACAAGGAGCATGTGATTGAGGCCCTACGTAGGGCCAAGTTC
AAGTTCCCTGGCCGCCAGAAGGTAAGTTGTGCCAAAACCTTGGGCCTGCTTTACTTGCCC
CGGTCAGTGTCCAGGTTTCCTAATTCCGTTATTTTCATCTTATCACAGATCCACATTTCC
AAGAAGTGGGGCTTTACTAAGTTTAACGCGGACGAATTTGAAGACATGGTGGCTGAAAAG
CGGCTCATCCCAGATGGCTGTGGGGTCAAATACATCCCTAATCGTGGCCCCTTGGACAAA
TGGCGGGCTCTGCACTCATGAGAACCTCAGCACTGCCCTTCCCCATTCATGCCCACCAAT
AAATCCTGCTTCCTGTCTATTTTTGTCTTTGCATCTGGATTCAATGGTGGTGGACTGGGA
GGGGGACTCTAGAGTCACTACCTTGTCTTTTCAGAAGAAGGTTGATGAGCTGGCCAAGGC
CAGCAAGGAGACAAACCTAGCAACATGGCCTGGGACCAGCATTCTCTCAATTGTCCGGTT
GGGACTTTGACTTGGACCTGCCTAGATCAGAAGCTATCAATTCAGGTTTTCCCTGCCAAG
TTCATGCTGTGATTAGTCCAGTATAGTCCAGTGGATGCTGCCTTAGTAAAGTGCCCTGCC
CAGTGATGAAATAGGGCTGGTGGCCTAAGGTTGACCTCTGGCTGCTTGTGGAATCTTTCC
CCACAGGTCCCAGACCAGCAACATCACTGGAAACAGAAGTGAATCAGACCAGGCATGGTT
CCAGCCATGTTTTAACCAGCACTCAAGGAGACCCGGTCCTCCAGTTGGCCCTTGAATAGT
TTTCCTGTGTTGGGAGTTGTCCAGCTTTGACCCACACCATCCACCGCTCCCGTGGCTTCA
TTTCTGGGTCCCTCCTCACCACCCTGGCCAGTGTCCCCTGACCTCGAGCTCCCCCAGCTG
AAACAGCCCAAAGGCTTGGCAATGAGACAGTGGCAAGTATGCAGCTCCCCTGGCCTGGAG
CTCCTGATGTGCTGGCCAGCACTTCTGAGGGCCAGGATTACAAGAGCAGGAACAGGCCTG
GGGAGTTCTTAGCAGGCTGGATGGCCTGGGGCTGTGCATGCATAAGGGGATCTGGTTCCA
GAGCTGTGCACGGTGGCCCCAGAGCTGCTGTGTACTGCTTCCTGGAGCTGGACTGTGCTG
CACTTAATCCTTGTGGCTCCTGAGAGTCCTTTTGTAATCATTACTTCCAGCCATTTATGA
AGTTTAAAATGACCTTTATTTTTTACCTTGAGGTGGTTCTAAACCATAAACATTTGTGCT
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1012..1056, 1058..1066, 1071..1072, 1469..1527, 1622..1729, 1959..2097, 2618..2780, 2868..3020
1001..1009, 1012..1056, 1058..1066, 1071..1072, 1469..1527, 1622..1729, 1959..2097, 2618..2780, 2868..3017
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved