Felis_catus Locus MED17
snOPY snoRNA Orthological Gene Database
Felis_catus MED17
Felis_catus
MED17
GeneScaffold_3078
SNORA46
4974..5109
33131
TACTAACTATCCGTGAGATGTAGAGGCAGTCATGAGACCCTTTAAGAATGCAGCCGTCA
GCATCTATTCGATCTTTATCAAAACTATGCACACTATAGGTCAGCCTTCTGGGCTAAAGG
TGAACACTTTTCTGCTCATATCCTTCATCGATGATAAATGGTAGACACAATTCCTTAAAT
AGTTTTGCGATATCTGTCCTCCTCTGTGGAATTAATACTTACGACATAGTCTCGGGCACT
CAGACTGTTAAGTTTTACCACTGCTTCTTAACCCTTTAAGCATTGCTTATCTCCATTACT
CAGGCATAAAATAAAAATTAAGCTCATATTACATGCCAGTGTCTATTATTAAGCTTGCTG
GAGATAGTCCCTCTCCAGGAGTTTACCACTAATGGGAAAACAGATGATAAGCACAATGTA
TTGTTTTCCTCAAATTACGTCTTCGTTTTATCACTCTTCAGACATGTTTCCTGAGGTGTA
AGCCCTCAAATCTCAGCATTCTCAGAAGGACGCTCATTGCTAAGACCCAGGGACCCATTC
ATTTCCTTTTCCCGACTTCTTGCCGGCCTTCTCCAGCTTCCCGCCTTCCATCGCTTCAAG
CAAGTAACTTTTAAAACGCAGACGAACACCACGGACCAGCCCGCCCTTGCCCTCGGCACT
AAGATCCCTCCCCACCGCCCTCTGCCGGCCGCGCCTCCTTACAGACGAGGAACTTTTTCC
CGGCGCTGCACTGGGATTCACCGGAAGCGCTCCCCCCGGAAGCGTGGAGAGCCAGCGCCT
GCCAGTCGGGTTCCGGGAGACTCCGAGCGGGGGCGGGGAACTGCAGTGCATTCTGGGAAA
GCCGCCAAGCCCTCGGCTTTGTTTCCCGCCCCAGCGCGGCGTTTGGTTTCCGGAGGTCCG
CAGAAGCACTGCGGTTCCCGGCTTGCGGGCTTTCCTCGGAGGCGTCTCTCCTTCCCACCT
CGGGTTTTGGCTCGCGCGGCAGTCCTCCCGACGCCGCCAGCATGTCTGGGGTGCGCGCTG
TGCGGATCAGCATCGAGTCGGCCTGCGAGAAGCAGGTCCAGGAGGTGGGCCTGGATGGCA
CTGAAACGTACCTGCAGCCGCTGTCCATGTCGCAGAACCTGGCGCGCCTGGCCCAGCGGA
TCGACTTCAGCCAGGGTTCGGGCTCCGAGGAGGAGGAGGCGGCGGGGGCCGAGGGGGACG
CGCAGGACTGGGCTGGCGCCGGGTCCAGCGCAGACCAGGACGACGAGGAAGGTAAGGCCC
GTGTGTGCTACTCCAGTCCGCGGGCCGGTCTGGGGACCCCGGTACCCGCCCAGGTAATGC
CACCCTGCGTCTCGCGTGCTAGACGAGATGCGGTGCGTGGGCGAACTTTGAAAGTAACTT
CAGTGCGGAAGAGTGATCGTGCTCACTGTGGTCTTTTCACAGCCTGACGATTTAGGGCGC
TGCCTGCCTCCTAATACTCCTTATCCTTCTGCACGTTTTCTTGAATTGGAGCATTTGAGG
CACTGTCACTGATGAAGCGTTTAAGTCTGTTATGGGGCATACTTGGTGAAGAAGCCTGCG
GTTCATATCGCGGCTCTGCCACGTCTAGTCGAGTTACTTTGCTTCCCTTTGCAATGTGGA
TGATGCTAATTACACCTACTGAAAAGAGAGGTCTGTATTGACTGGAATATATGATAAAGT
CTAAGAGGTAGGCTGGGACCAAATCGTGTACAGCCAGTACGCCAAGGTAAGCATGTGACT
TTTATTAGAAGCCAGCTGAAAGCTTTTGAGGATTTTAAGTAGACTGATGATTCTGTTTTA
AAAAAGAATTATCTTGGGGGGCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTAGTTTCTTCCAACCCCAGTGGAGTGAAATTAGGAATCAATTACAGAAGGGAA
ATTTGGGAAATTAAACCATATACTCGTACATAACCCGTGGATTAAAAGAAGGAATCACAG
GGAAGGTAGAAAATTCCTTAGGAACCATGAAAATGAAAACACATCATATCTGGTACAGCC
ACCCTGGAAAACAGTATGGAGGTGACTCCAAAAGTTAGAAGTAGGACTACTCTGTGATGG
AGCAAATTGCAATACTAGGTATTTACCCAAAGGGTACCAAAAACACTAATTCAAAGGGAT
ACATGCTTATAGCAGCATTATCTACAATAGCCATGGGGGGGGGGGAGAGACAAGGCACTA
GAAAAACAGCCCAAAGGCATAAACAGCTCACAGGAAAAGACTTCAGATCTTGCAATTAGG
GAGAGGCAAATTAAAACACTATTCTGGTGCATTAGCAGCAACATAGTATCCAGTGTTGGG
AATGTGAATTGGTAAAGCCTTTTTGGAAGGTTAGCAGTTCAGTATGTGTCAAAAATGTTA
AACGTGTATCTCCTTTGACCTACTAAATCATGGCTAGGAATTTAACCTACAGAAAAAGTT
GTCCACATACACAGATGTGTGTTGAGCATGTTTACCATTACTGACCTTATGGAAAGCAAC
GTACATGTCCGTTAAATAGGAATGGTTAAACTTACTGTACAGCTATGCTCCAGAATGTCA
AATAGCGTTAAAAGAATGAAATAGATCTATGTACTGACATGGAAGTAGCTGTAGGACATA
TTAAGTGAGGAAAAAAAAAAGTAATAGAAACATGGAAGTAAGTGTATATAAATGCATCGA
AAAACAGTTGGATGGGTACACCTCAACTGTTAATATTGATTACTTCTCGGGATGGGACAG
AACTAGGGGTGGGGAACAAAGGAAAACTTTTACTTTTTTACTCTATAACTATTTGAACTC
TATATAATGAGCATGTATTTGGTGGAATTTAATGAAGTGATTGAAGAGGTTGGAAGGCAT
GTTAACAGTTTTTAATATCGGAATGCTGCCCTTATAGATCATTTAAAAAAAATTTTTTTT
TAAGGTTTATTTTGAGGGAGAGAGAGAGAGCCCGCATGTGCATGGCAGTGTGGGGAGAAG
GGCCGAGGGAGAGAATCCCAAGCAGGCTCCTCCCTGTCATCAGAGAGCCCAAAGTGGGGT
TGAACTCAGGAATGTTACCCAAGCCTACCTGAGCCAAATCTTGGCCTGAGGCAAAATCAT
GAGTCATTTATCTGACTGAGCCACCCAGGTGCCCCTGTAGGTCACTTTTATTTTTGTACT
TTAATGTATTTTGGAAATTCTCTCGTTATTCAAGTTTTTTTTTTTTTTTTTTTTAATGTT
TCTTTTTGAGAGAGAGACACAGAGTGTGAGTAGGGGAGGGGCAGAGAGAGGGAGACACAG
AATCCGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCATACAGCCTGACACAGGGCTCAAAC
CTACGAACCGTGAGATCATGACCTGAGCCGAGATTGGACATTTAACCAACCGACTGAGCC
ACCCAGGCACCCTTCCAGTTACTCAAGTTTTAAAAGCTGGAAGAAAAGGGGTATTTAAAA
GTCTTGCATATATTGAAAAAAAATACTGAAATGCTTACCTGTAATGTTGGAATGTTAGAT
TTAAGCTGTGGAAATTAGATATCATGTTTGTTTTGCCATTGTAGGAATGCGAGCTTAAAT
ATTAACACAAAGATTCATGAAAGGGTACGTGGAATGGGATAAAACAGGAAGCGATTTGAA
ATGAAAGTCATTGTTCTTTTAGTAATTACAACATCTCAGTGAGATTTCTGCCTTCTAGTC
AGTGTAACTCATACCTGTGTGTTTCCTTTTTTCTTTCTCTTTTTAGGGTTGGTAAAATTT
CAACCTTCTCTTTGGCCCTGGGACTCAGTGAGGAACAATTTGAGAAGTGCCTTGACAGAG
ATGTGCGTTCTCTATGATGTCCTTAGTATTGTTAGAGATAAAAAATTTATGACTCTTGAT
CCCGTCTCTCAGGATGCACTTCCTCCAAAACAGGTATTTGTGGGCTTTAATTGAATAATG
ATACCATTTTATTGAGTCCCAGGACCACTTTTCAGGCTGTGTGCCTTCTGTCCCCTTTGC
CTTTCATGCAAAATTAAGTCAGATGAAGCTGTGAAGACTGGTTCAAAACAAAGGTGTGAA
ACCTCATCTCCTTTATTTATCATTTTATTAATGGTCCTGAGACCCTTAGAGGAGTTAAGT
TTCATTAATAATATAACACTTGAAAGTTTCCCAGATCTTAACAAATTCTTACAGCCCGGA
TCATTGGTCTGCATGTATTACACAAAAATGTGATAGTGAAATGGCTGTGGAGTCAGACAG
ACCTGGGTTCAAATCCTGCCTCTGCCGTCATTAGTCCTGGGTCCTTCAGCAAGTGAGTTT
TTTCAAAGTCTCACTTTTCCCCTCAACCTGTTTCTAGGGCCTGGTTTAAAAAGGCCAAAT
TATGAAAGCTAGGTGAGATTGTTGCAGTTTGAGGAAGAGCGTGTTTAATTTTTGAGCACG
AGAGGATGAAAGGGAGGCAACAGAAGGATGCACCAGTGAATGGAAAGTCTGAAATTAAGG
AGGCCACTTGGGAGGTTCTCAAGGAAGAGCAGCATTAGGTCCACGACCAGGTTAATGGCG
AGAAGAGGAAGTAATGGTTGTTCTTGCCCATTTGTACGTAAAGTGCATTGAATGTAATTA
CTCATGTGGTAATAGTTTCGGAATCTAGAAACGCCATGCTGGAAGACTTCTTAGAGATCA
TTCAGCCTGGCTCCTTCGTTGTACAGAGAGGACACCGAGGCCCAGAGGGATGCGTGACAC
ATTCCGAGGCAGCACAGCCCGTGGTTAGAGAGCCAAGACCACAACTCTGGCACCTTATTC
CTAGCCCACGGCCTTTACCTGTGCTCTTCCCAGAGAGGGGTCTCCAGGAATTTCTTGATC
TCTCCAAGAATTTAGAATTCACTTCCCTGACACGGTCCAAAGATGATGGTGACCTGCACT
ATTCTTTAAACCTGTGGATGGGAATTTTCCCCATTCTTGGTTACGCTGTAGTGCAAAAGA
ATTCCTGGCTCTTTCTCTTGCACAGCTGACCTGCCATTCTGCTGTTGCTATGTAGAGTTA
AGGAACATAACTATTCAGAAAATTAAAAATGTATTACGTTTTAAAAATTGACAAGTGATT
ATTGTGACATTTTATGAAACTTGGTGATTTTGATTCATGCAGCCAGAAGACTTTTCTTTT
GTTAAATTTGGCTTATTTGGAAGTGTATCCGGTTACTAGAGTACACAAATCGGTGGTGAT
TAATGGGTATTTAGGTATGTACATATAATACATAGATTATGCTGTCTCATCAGTTTTCCG
GAAATCAGCCTTCAGTGAAGTGCATTAATTTTAATGCTGTGTGGCTTCAGTCTTTATTCC
AAAGGCACATTGGTAGCTTGCCATCGTGTAATTATACAGCTGTACTCATTGGGGTCATTC
ATTTATTCCAGAAATCAAGTAGTAGGTGCTGAGCATTGTTCTAGCGTCCATGGACATAGT
GGGTCTCGCCATCGTGGGTGACTTTGAAGCAGGGATTACAGAGAAAGGGTATACACGGGG
CCGGGGGTGGGCATTTGTACGACACGAGAGGGCAACCCCATCTAGACTGGGCAGAGTTCG
CATGAGTTCTGATTTGTAGTCCAGTGTGGTGTTTGTGGTTTAACATAAGTTCATTTGGGT
TGACGGGAGAAATCGTTAAGGTTGTTATTTTTCAAAAAACAGTGCTTTTCTTTAATTTCT
TAATTTTCTCCTGAGTAGGTATTTTATTATTGAGAAATGTTGAAATCATTTACAAATACA
GAACTGTATGGTTGGATTGTTTTTGCTAGAACCCTCAGACACTGCAGTTGATATCTAAAA
AGAAGTCGCTGGCTGGAGCCGCACAGATCCTATTGAAGGGGGCGGAAAGATTGACCAAAT
CAGTCACTGAAAACCAAGAAAATAAGCTGCAAAGAGACTTCAACTCTGAGCTTTTGAGAT
TACGGCAACACTGGAAACTCAGAAAAGTTGGAGATAAAATTCTTGGAGATCTGAGCTACA
GAAGCGCAGGTATAGATCATTGTTAGAAACGGTCCTTTTAAGCTGTAGCTTGTCACAAAA
CTATACGGGGTTGACTGTGATGTTTATACGTATGGCTATAACGTATGGCTTCTCAGTTAC
GGGTTACATTTTGAAATTTTAATTTCTGTACACATAAGCCTGATAAGCTAAAATTACTCA
TATAGCCTTATAAGTGAATATAGAGAGAGAGGGAGGGAGGGATTCAGTTTGAAAATCTTT
AGATGCATTTAACAGAAAGCTTATGTGCTAACACACCCGGAACCATAATTGACATTTTAG
TCAGAGATAAAGGAGCTAGGACTGGACTCGATCAGGGGCTCCTTTGTAACCCTTAAAAAT
TAAGCAAAAGGGGCACCTGGGTGGCTCCGTCGGTTAAGCATCTGACTCTTGACTTGGGCT
CAGGTCATCATGTCATGGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCTCCCTCTCTCTCTCTCTCTCTCTCTCTCTCTGCCTCTCTCTCTCTCTCTCTCTCTCT
CTGCCTCTCTCTCTCTCTCTCTCTCTCTGCCCCTCCCCTATGCTTGCACATTCTCTCTCT
CTCTCTCTCTCTCTCAAAAAATAAATAAAAATAAGCTTAAAAAGTTAAAAAAAAAACCAA
CTGAGCGTAAAAGGAAAAAGAAATGTTTCCAGTCCACCTTAATTCTTTTTTTCTCCATTA
AGTCATCTAAGCTGTTGTCACACCCTGGCTTAAGGGAGAGAGTGGTGAAAACACTTTGCC
TTTTGCCCCATTCTACCAAGGTTGCAGGAATATATTTTGTTGGCATATACCAAAATTTGA
TGATCTTGAATTCACATCTGTTTGTACAAACTTTTTATTGTTGACCTATAATACGTTTCC
GGAGGTAATCATGCTGCTGTCTTGTAAGCCACTAAGGTGTATTCAGAGGAGCGACACAGT
AAAGGTTTACAAGACTCCCAGCTCAGTGGAGTAAAAGCTTTGAGTGCCAAGGGACAAAGC
AAGGAGCCCTGGCTGTGATCACCGTGGTAACAGGAGAGTGATAGTTTAAACAGACTCATT
TGCCAGAGGGAGCCATCGTTGTCCTACCATTAAAAGCAGGCAAGGTGAGGTGGTTTAAGT
CAGTACCGGAGAACCTAAGTGTCTCAGCATTTGATGTAAACTGGGGAATTCTGAAGGTAA
AATCCTATTTCAAGATGACCAAGACTTTTTTCTGGTTTTTTTACATATTTTTAAAAATTA
ATTACTTAATTATTTCATTTACATCCAAGTTAGCATATGGCGGAATAATGATTTCAGGAG
TAGATCCCAGTGAATCATCCCCTATGTATAATACCCAGTGCTCATTCCAACAGGCGTCTT
CTTTAATTTCTCTTACCCATTTAAAATGCCCATCCCCCAACCCACAACCCTCCAGCAAAC
CTCATTTTATTCTCTGTATTTAAGAGTCTCTTATGTTTTGTCCCTCTCCTTGTTTTTATA
TTGTTTTTGCTTCCCTTTCCTTACGTTCATCTGTTCTGTGTCTTAAAAAGTCATATGAAG
TCAAGATATTTGTCTTTCTCTGACTGGCTAATTTCGCTTAGCATAATATTCTCTAGTTCC
GTCCACGTAACTGCAGATGGCAAGATTTCATTCTTTTTGATTGCTGAGTAATACTCCGTT
GTGGATGTGTATAAATATATATATATATTTATACACACCACATCTTCCTTATCCATTCAT
CCATCGATGGACATTTGGGCTCTTTCCATACTTGGGCTATTGTTATAAACATTGGGGTGC
ATGTGCTCCTTTAAAACGGCACACCTGTGAAATACTATATACTTAAGGTATGTCAAATTT
ATGTGTTAACTTGTTTCTATTTTCTTGTTTTTAATAAATACCCCATTAGGATCTCTCTTT
CCCCATCACGGTACATTCGAAGTAATAAAGAATACAGATATTGATCTGGATAAGAAGATA
CCTGAAGATTACTGTCCCCTCGATGTACAAATTCCTAGTGATTTAGAGGGGTCTGCATAT
ATCAAGGTATTTGCTGAAGTTTTTTGTTTTTTTTTTTTGAATGTTTATTCTTGAGAGAGG
GAGACCACACAAGCAGGGCAGGGGCAGAGAGAGAGGGAGACGGAGAATCCCAAGCAGGCT
CCGTCTACGCTGTCAGCACAGAGCCCGATGGGGGACTCAGACCTGCAAACTGTGAGGTCA
TGCCCTGAGCCGAAGTCAGACACTCAACTGACTGAACCACCCAGGTGCCCCTTGTTAAAG
TATGTTTTAGTAATTTCTTCACCCAGAAGTTAATTTGCTAACATTTTTTCATGTTTTTAT
TGTCCCATAGGTTTCAATTCAAAAACAGGCTCCAGACATAGGTGACCTTGGCACAGTCAA
CCTCTTCAAACGACCTTTGCCCAAATCCAAACCAGGTGCAGTTATGTTCTGTCCTCTAAC
TTCTGGTCCTGTCTGAGCTTACGTTCCCAAATAAACTGGTGATAAACATAGATAGGAAAA
GTCGGTACTCTGGAGTAAGGACAATTGGAAATTTATTATTTATAATCCGTTAATAACCGT
TGGTGAATAGCTGTGCAATCTTTTTTTTTTAAATCGAACTTCTTTACCAGTTTTCTATGT
AAACGAAAGGAAAATTTTTCAGTTTTGGGAAAGATATGCTGTAATACAGTGTTTTCTGAA
CTTTTATTGTATGCATTCAAGTCCCCACTTAAGCGAATTAATGCATAATCCAGTCAGATA
ATTGATATATACATATGTCCCCTGTCTTTCAGGTTCCCCACACTGGCAGACGAAATTAGA
AGCAGCGCAGAACGTTCTCTTGTGTAAAGAAATTTTTGCGCAGCTCTCTCGGGAAGCCGT
TCAAATTAAGTCACAGATCCCTCACATTGTGGTGAAAAACCAGATTATCTCTCAGCCCTT
TCCAAGTAAGAGCAGCCAACCCTTTTGAATTTATAAATAGGACTTTGTGGTTTGGGGAAC
AGGGCAGAGGGGCTAGTTACGTATTTGGCTGCGTTGAGGGAACAGTAAGAGCAAAGCGGT
AGCGTGCTGTCCATAGTGGTGGCTCATAAAGCGCGCAAGACACAGCACGTCTCCAATGCT
AGTCTGTGTCCTAAGTAGTGTCACTCCTGGATTTTAAACCACATACGCGAAAAACGTGTA
CTAGCAAGGCTGTTATTCAGCAGCAGTTGCTTTGAGGTGTCTGCTGACACCGTTCGTGGA
CTGTTTCCCAGGGATCCTGTCCTGCTGGCTAAATAAGATGTCGGTCAGACAGTGGTTATT
AAATGCCCGTAATATTCCTAAATTTGTGGAAATTGGGATTTTAATTATATTATTATTCAA
GAGCAGTTGGAATTGCCCTGGAGATCAATTTGTTGTTAGCCGTGTCACTGATTTTTGTTT
GTTTTTAAAATTGTGAGATGTAGCTTCTTGAGTCTTGTCAAAGGAATGGGTTTTACAAGT
GAAAAATTCCATCCATGCTTTCATGGCAGCAAGGAAGAGTATTTGTCTTTTTTCTAATCA
GCACGACCAGATACCCACTTGGTGGGGTTTTTTGTGGTTGTTTTTCCAAGGTTGTTGTTT
GTTTTTTTTTTTTAACATTAATTTTTGAGAAGAGAGAGTGAGCATGGAGTAGGGGCAGAG
AGAGAGGGAAACAGAATCAGAGGATTGGAAGCAGGCTCTGTGCTGACTGCAGAGAGTCTG
ATGTGGGGCTTGAAGTCATGAACCGTGAGATCATGACCTGAGCCGAAGTTGGACGCTGAA
CTGACTGAGTCCCCCAGGCGCCCCAACTAAGTGTTTTTTGTTTTTTCAAAAATGGCGTTG
TGTTTTTTGTTTTTAATTTAAAGGCAAGAAGAAACTAATTCACATACAGTTTCTGTTGAA
CTCTCTTTATCCACAGTTCAAAGTCAACAGCCACAATGTAGGTCAATAGAACTTGAATTG
TTAAAAATACGTGATGGTTGATTATATTCCTGAATAGTCATTTTGGTGTGAAAATGGTAA
TCGTGAAGCCTGATCTCCAAGTTTAGAATGCTCTTTTGAGAAAGGGCTGTGATTATACTT
CATGAAGACAGTTGTGCTTTTCTATATCTTCGGTTATTTGCATCTGTCCTATTTCTTTTT
ATAAATAGGCTTGCAGTTACTGATTTCTTTGTGCCATTCCTCAAATGATAAGAAATCCCA
AAAATGTGCTACTGAGAAGCAAAGTCCGGAGGACCATCTTTATGTCTTAGAGCATAATTT
GCATCTACTAATTAGAGAGGTAATGGAATAAATGTCTCTTCTTGCGTTTTGGTAAGCATA
CCCAGTGCGGTGAATGTGCACAGGCTCCTCTCTGCTGAGTCCTCGTTATTCCCCTAGTGA
TGGCTTTCACCGTCTGTGATGTGAAGGATCCTTACTCTGTGTTGGGGGAATACGCCGATA
ATCAGAATTCTCAGTCTGTGTTCACAAGCTTAACTTCTAGTGGTAGAAATAAACCTCAAG
CTTGATACAGACGCACCAGGAAAGTGTGCAGGGTACAGAGGGAAAAGTGATTCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTGAACGGCTCTTCTTGTTACAGTTTCATAAACAGACCT
TGAGTTCCATCACGATGCCTCATCCAGCAAGCGCACCTTTTGGTCACAAGAGAATGAGAC
TTTCGGGTCCCCAGGCTTTTGATAAAAACGAGATTAATTCATTACAATCCAGTGAAGGGC
TTCTGGAAAAAATAATTAAACAAGCAAAGCATATCTTTCTGAGGAGCAGGTAAAGATGAA
CAAAGTAATGGTTTTTCTTCAAAGCCTCAGTCATGTTTCCTTTATTACTTACCTCCTCTG
CATTATTTTTGGCATGCTGTAACCTTTTGTGCCAGGGAGAGGAAGCGGGGTGTGGGATAA
GAGTTGACACGGATGGTCCTGTCACGTGTGGGGAAGACTTAGCTTCAGGGCCCATGTAAC
TGACAAGATGGCTTCTGACGCTGGCTGCAGTTTCGGAAGGCACCTGACTAGGAGTATGCC
CTGAACCCCACACCTTCTTCAGTGACCCATTCGGGAGATACTTGTTCCTGAACGGATTCT
AATCTTTTTTTTTTTTTTTTTTTGAAGCTTTCCCTATTTTTTTTGGGCTGTCTCACGTTT
TAGGACTTGGGAAGGTGCTTTCCCATATGTTGACTTCTCTCGCTTTTGTTCTCTGGCATC
AGGTGGTATTAGTTATTTTCAGTGATGAGAAGGTTCCAACTTAGAGAAGTTGTACAACTT
GCTCCAAGTGAGACTTGGAAAGAGTAGCAAAATCCGGGTTCATGCCCAGCTCTGTGGAGC
TCTGGAGCTCATTTTCTTGCTTCCATGCACACGACAGGAGAACCTTGGTCTGTGAGCGTA
AGTCGTTCGGAAACATGCTTGTCATCCCAAGCACTCTTCTCCTATCAAAGCGAATTTCAG
GAACCATTGGCTCAGTTGTGATCATGTCACACTGGGTGTCACGTACTGTTCGAATTGTAA
GACACGCTCGTTTATCAAGTTAATATTTGTTAGAAGTGTTTGCTTCTCTTGGGGAACACT
AGCAGAACAAGTTACTTGCAACCCAAAGTTTTATGTTTACAAAAGAACTTGTACTTAAAT
GTGCGTTCCTCACATGCTAAAGGATTGCGCGCCCGAGTGGCTCAGTTTATTTTGAGAGAG
ACAGAGACAGTGCAAGTGGGGGGAGGGGCACAGAGAGAGGGAGGCAGAAAATCCCTAGCA
AGCCCCGTGTGCCAGCTGCAGAGCCCGATGCGGGTCTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTACTCAGGTCATGATCTCAAGGTACTAGATTCGAACCCTGTCAGGGGGCTCTGTG
CGATTGAAGGGAAAGAGCCCCACATCGCGCTTCTGTGCTGACAGCTCAGAGCCTCGAGCC
TCATTCAGATTGGGTGTCCCCTTCTCTCTGCCCCTCCCCTGCTCGTATTCTCTTTCTCAA
AAATAAGTAAACATTAAAACAACAACAAAAACAGGGCTCAGTTACTTGCTAACTAACTTT
GGGGCATTTTTTGTTTTTTTAGTTTAAGTTTATTTATTTATTTTTAGAGACAGCATGTGC
ATGAGTGGGGGGTCGGGGGGCAGAGAGAATGGGAGGGAGAGAATCCCAAGCAGGTTCCGC
TCTGTTAGTGCAGAGCCAGACGAGGAGCTCAATCCCACAACCTCTAGTTCATGACCTGAG
CCAAAATCAAGAGTCAGGCACTTAACTGACTGAGCCACCCAGGCGCTCCACTAACTTTGG
TTTTCATATCTATGGCCCTCCACCTATTTTTCTGCCAGTTAGGGATATAGGAGTCTGGTC
TTCGGGTCAAAAGAAATATATGCAGAAGTTCCTTATAAACAATAAAATAGGGTAGGTTAC
TGTTGTCACTTTCATTTGTACGTTTCAGTTATAAAAACCTTTAACCTAAAGTCAGGGGAA
TGAAGGTAGCTATTTTTGGAATCCTCATACATTTTCAGAGTATTGTTATAGTGTTGGAGG
CAGCAAAGCTTTAAAAATATTCCTGTGTTCCCCAGTTATAAAATAATTTTCCAACGTATC
AACCCCAACTGTATAAATACCATACACAAGCAAGACCTGTTATTAACATGCTCATGTATT
TTGATATATATGTGTGCTAGGGTATGTGTATCTTTTTTTTTTTTTAATCTGGAATCGGGG
CGCCTGGGTGGTTCAGTCAGTTTATATCCTGCTTTCACTTAATATTATAAATGTTTTTAT
CTTTCATTAAATGCTTTTCAGAGATATTTTAATAGCTGTGCAATATCCCATTATGTAAAC
ACTCCATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTTTGA
GACAAAGACAGAGCATGAGCAGGGGAGGGACAGAGAGAGAGGGAGACACAGAATCCAAAA
CAGGCTCCAGGCTATGAGCTGTCAGCACAGAGCCCATTGTGGGGCTCGAACCCACGAACT
GTGAGATCATGACCTGAGCTGAAGTTGGACGCTTAACCGACTGAGCCACCCAGGCGCCCC
TTAAATTGTTATTTTTTAAAATTTTTTTTTTTATGTTTTATTTTTGACAGAGAGAGACAG
AGCATGAGCGGGGGAGGGTCAGAGAGAGAGGGAGACACAGAATCCGAAGCAGGCTCCAGG
CTCTGAGCCATCAACACAGAGCCCGATGTGGGGCTCGAACTCACGGACCGCGAGATCATG
ACCTGAGCCAAAGTCAGACGCTCAACCAACTGAGCCACCCAGGCGCCCCAATTGTTATTT
TTTTAATATAGGGACTTTAATTCACTATTTTTCAAAAATGAAAAATCGCTAGGGAGTATG
ATGTAAAAGATTGGATATAGAAGATAAAGGAATACACAGTGGAAATCAGTATTGCAACTT
CCAGGAAAAGATGGTGGGGTGAAGGTGGATCATGGGTTTTCTTCCCCCTATACTATAGAG
AAATAAGGAAATAATTGAGGTGACTTGGAGTGTGGTGGGAGAGTAGCTGTAGAAAAAGGT
AAAACAAGTTTGGCATGCATTTTAACTGTTACGGCTAGGTGATGGGGCCATTGGCTTTCA
TTGTATTTCATTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
TGTAAGTTTTTCATTTAAGCGTCTGAACTAAGTGTTTTCTTTGAAAGAAACATGTAAACC
TTTTAATACATCAAAATTACAATTTTACATAGATAACTGACACAATGTTTATTCCTAAGT
GGTCACTGTAAAGTCAAGTCTAAAAAAAGAGGTATTTTCAAATGTGAGGAGATATAATGC
TATTTTATCCTTCAGTTCATCTAGATGGTTTGATTTGGAGAATTTCATGTTTCTCATAGA
TGTTGTATGCTAGTGCTAAAAATTTGTAAATTGGTTTGGAAGAGGGTCGTTATCTGCATG
TTGTTCTATGAGTTTCTTTATTTGACCTAAGCCAAGTTAATAGAGTATATATTTTGACTT
GTTTGCCGATTATTTCAGGAGAGGGTGTGGAGTTAATAAGAGCTTTTCCTTTTCCGTATG
AGAATTTGATCTTCGGTTAACTCTTTAGCTATAGTCCCCTAGTAACCTGCTAAGAAAAGA
TGCCACCTGTGTTACTAGGCAACATTGCTTTTGGCAAAAATAATCCCAAACTGGTAAAGT
GGATCTGGACTGGAAGGAATTATAAACACCTGATGGAGGTGCGTTTGGCTTTTCCCAGAT
GGAGTGACTTCTCAAACTGGGCAGTATCTCCTGGCGGGGGACTGTGGAGACCATGTCTAT
GGAGTTGTCATGAGGACATGTGGCTCTTATACGGAATGAGGCTTCTAAAGTCGGGGCAGG
TCCCCCACATGCCCAGTGTAGATCTCATCTCAGTGCAGCAAAGGTGTGCAGATTGTCAGA
GCAGAGTGGCAGTGGGTGTTGGCCGGCTGGCAAGCTGGGCTTCCTCTCCTGCATCCTTCT
GCGTGCATGGGTGACCTAGGGGCATCTGGTGGGAGTCTGATGGTTACCTTGAACCTAAGA
CAACCCCTCTCTCCCATGGGTGTTGGTGTAGGTTATCAAAATTGTTATTTTCGGTTTCTT
TGGTGTTAAGGTTTAATGTCTGTGGCATCGTATGAGGTAATTTTGAACATTTCTGATTTT
TAGTATATGTGTCTATAAAGGTCCATTCAGCTGCAGTTGAATATCGGAGTTGAGCAGATC
CGAGTTGTACACAGGGATGGAAGAGTGATCACACTGTCTCACCAGGAGCAGGAGCTACAG
GACTTCCTCCTGTCACAGGTAAGAGTTATAGACCGCAAGTCTGGGGCCTCTTGCCCTTGT
TACCGCTTAAAGAACAAAATGAGTAAGGAAGAGTTAAGGTATATTATAAAAAGAAAGCTA
TTTTTGTCCGCCATCTTGTTTAATTTCTAGTGCACATTTTACAACTTAATGGCTAATTGT
GAAACTTTGATAAATTGTTCTAGATATATTTCCAGTTAGTTTGTGGTTAAGATGAAGGAG
CAGCTCGGAGACTGTAAACTTCGGATTTCTCACGTTTGCCTGGGTTTACAGCCCCTTTGG
GTCCACACAAAAGTGGAGAATTACCCCAGAAAACCGAGGAGAGATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTAAGAATAGTATTTCTCCTGTGTTCTTCATGGAGTTATGATCCAGTGAAAAATTGACTT
GTGGGAGAAAGGGTAGGTTTAGGGAAGCTAATACGCTTTTCACAATATACACATTTATAT
TTCACATAAAGCTGAAAAAAACATGCTCTCCATCCTAGAAGCAATAATCTTCTATACTGA
CTTCTTTCTTTGGTGCCAAGTAAATAAAATGCATTTGTGAGATACGGCAGTTCTTGGTTG
ATTACACTTAAACTGACTTTCGTGTCTCACACACACACACACGCACACAGAACTATATTG
GGAGGCTGTTGGGTAGCTCTGAGAACCAATGGAAAGTCTAAAGAACAAGGCTGGCAGGTG
GCGGAGATCAAAGGAAGCTGCCCCGTCAGAAGCACAGCCAGGACAGCGGCTGCTGTCAGT
TGCCATCCTGACACTCCCACTGCCTTCATCGCTAGTGGCAGAGCGCGCTCTAACTTGCCC
CTGTGCATTAGTCAGGATTTTAGTAGAAAATAGGTGGCACTCAGTAATTTTTCTAAGGAT
TTACAAAAGTGTGGGTGTAGGAGAACCGCCAGGGAAAGTGTGGTGACCTGGTGCTAGTAC
CAACCAGGTAACCAGGCCGGGGGGTGCTGAGTGGTCACCAGTCCTAAGCCAGACGGATAA
GGGGAGGGCTTGTAGGTGCCCTAAAGGGGGAGAGTCATGTGGAACAGGCCACCTTGGAAA
AACACTAGTCGCCTTTCATCACCGGATACAAGCTCACGGGGAAGGGTACCGACCTTGCTT
TCCTCTCTCTTTCGCCATCCTCTGGCTCCCATTACCTTGGTTGCTCCCGTTATCTGAACC
CACCCTGAAGCCAAATGATGTAACCATATGGGTCATCCTCTCTGGGTGGAGTAGGGTGGA
GAGTGGATTTGCAGGGGTAACTGGAAGATACTCAGCACACCCCGCTGCCTTTGGTACTGC
GCCACATTCGGTGATCCAGGTGGGAGTCTTTGGTTGGCCAAGTTTAGGTCACGTGTCTGT
GCTCAAGCTGCCATCGGGCAGGGAAGGCGAGCATCAGGCTATTTTAGCCTCTGCGGTGGA
AGGTGGGATCCTCCCCCGGTAATCACAGAGGAGGGTTCCTCACACAGAAGATAGGATTCC
TGTCTGTGCTCGGCAGCGGACACCCCAACAAAAAGTTCACAGTCGTGATGTCAAGCTACC
GCAAAGTAAATATCCATGGCAATTACACATAAAGTTTCCTTTTTCGTTCACAGATGTCAC
AGCATCAGGTGCATGCAGTTCAGCAGCTCGCCAAGGTTATGGGCTGGCAAGTGCTAAGCT
TCAGTAATCACGTGGGCCTTGGACCCATAGAGAGCATTGGCAATGCCTCTGCCATAACGG
TGGCCTCCCCGAGTGGTGACTATGCTATCTCAGGTACTGGCTGCTGCTTGGAATGTGAAG
AGGCCTTTGGGAGTTTGGTCTTAACATTTACCTGTAATAGACATACTTGGGAGTCATTTA
TCTCTGCAGTGAGTTCATATAGCAGTTATGCTGAGCTTTTATCTGATCATAGCTATTATT
CAGAGCAACAAATTATTCTCTTCTAGTGGTCTTAAAAATGTTTTGCTTGGTGACACATTT
TCCTAAGAGATCTGAAAACTGCCATCAGCATCATTACTCCTAAAGTTCAAAACCTTTGAT
GGATAAATGCTTTTTGAAAATGTACTGCAAATTGGCAAGAGTAATATCGGATCCTAAGGA
CATGACGGGATGGAACAGAGAGGAGAGGTGTTTTTGGAGTACTTGCGGCTTTAGTGTAGT
CTTTTCTTTCCTTCTTTCTTTCTTTTTTTTTTTTTTTTTACCGTTTATTTTTGAGAGGCA
GAGAGAGACAGCACAAGCAGGGGAGGGGCAGAGAGAGGGAGAAACAGAATCTGAAGCAGG
GTCCAGGCTCTGGGCTGTCAGCACAGAGCCTGACATGGGACTCAAACTCACAAACTGCGA
GATCATGAATTGAGCCGAAGTCGGACACTTACCTGACTGAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1250, 3826..3992, 5849..6068, 8029..8165, 8470..8554, 8912..9064, 10268..10398, 22724..22908, 30020..30137, 31973..32131
1001..1250, 3826..3992, 5849..6068, 8029..8165, 8470..8554, 8912..9064, 10268..10398, 22724..22908, 30020..30137, 31973..32131
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved